This Article Abstract Full Text (PDF) All Versions of this Article: 147/4/1591    most recent Author Manuscript (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Papari-Zareei, M. Articles by Auchus, R. J. Search for Related Content PubMed PubMed Citation Articles by Papari-Zareei, M. Articles by Auchus, R. J.

Arginine 276 Controls the Directional Preference of AKR1C9 (Rat Liver 3-Hydroxysteroid Dehydrogenase) in Human Embryonic Kidney 293 Cells

Division of Endocrinology and Metabolism, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas 75390-8857

Address all correspondence and requests for reprints to Richard J. Auchus, Division of Endocrinology and Metabolism, Department of Internal Medicine, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390-8857. E-mail: Richard.Auchus{at}UTSouthwestern.edu.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Rat liver AKR1C9 is the best-studied 3-hydroxysteroid dehydrogenase (3HSD) of the aldo-keto reductase superfamily. The physiologic function of AKR1C9 is to catalyze the reduction of 5-androstane-17ß-ol-3-one (dihydrotestosterone) to 5-androstane-3,17ß-diol (androstanediol) rather than the reverse reaction, and all of the known AKR1C enzymes with 3HSD activity also preferentially catalyze dihydrotestosterone reduction in intact cells. Because the utilization of pyridine-nucleotide cofactors NAD(P)(H) primarily governs the directional preference of HSD enzymes in intact cells, and because R276 participates in NADP(H) binding, we hypothesized that mutation of R276 would alter directional preference in intact cells. To test this model, we constructed stable lines of human embryonic kidney 293 cells expressing wild-type AKR1C9 and mutations R276M, R276G, and R276E. Mutations R276M and R276G retained reductive preference with slightly reduced magnitude compared with wild-type AKR1C9. NADPH depletion by glucose deprivation minimally altered the equilibrium steroid distribution for wild-type AKR1C9 but further reduced the reductive preference of mutations R276M and R276G. Mutation R276E, in contrast, showed an oxidative preference under all conditions. The intrinsic rates of the reductive and oxidative reactions for all four enzymes were similar at the functional equilibrium states. We conclude the R276 maximizes the reductive preference of AKR1C9 in intact cells and maintains this strong preference despite NADPH depletion; mutation R276E reverses the directional preference.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
THE HYDROXYSTEROID dehydrogenases (HSDs) complete the biosynthesis of potent endogenous androgens and estrogens. HSDs also regulate intracellular hormone potency by interconverting pairs of steroids, only one of which is a potent hormone (1). HSDs may be dichotomously classified either by their structural class or their apparent catalytic directionality in intact cells. Structurally, HSDs belong to either the short-chain oxidoreductase (SCOR) family, containing a ß--ß-structure with a Rossman fold and a YXXXK motif (2), or the aldo-keto reductase (AKR) family, characterized by the triose-phosphate isomerase (TIM-barrel) fold (3). Functionally, each HSD appears to drive steroid flux in one direction when the cognate cDNA is expressed in intact cells. For example, 17ß-HSDs types 1 (4, 5, 6) and 3 (7) preferentially reduce the ketosteroids estrone and androstenedione to the hydroxysteroids estradiol and testosterone, respectively; conversely, 17ß-HSD type 2 preferentially catalyzes the reverse (oxidation) activities in intact cells (8).

The strong directional preference creates the illusion that HSDs catalyze reactions in only one direction; however, we have shown that the human 17ß-HSDs types 1, 2, and 3 of the SCOR family catalyze rapid bidirectional interconversions of ketosteroid and hydroxysteroid pairs in intact cells (9). At functional equilibrium states, when metabolism appears to have ceased, 17ß-HSDs types 1 and 3 establish a greater than 90:10 ratio of product:substrate, and 17ß-HSD type 2 establishes a greater than 95:5 ratio of product:substrate. Nonetheless, bidirectional metabolism continues at equilibrium in all cases at rates much higher than predicted from earlier experiments (9).

The directional preferences of SCOR enzymes in intact cells are governed primarily by their relative affinities for the pyridine-nucleotide cofactors NAD⁺/NADH vs. NADP⁺/NADPH (2, 10). The cytoplasmic concentrations of reduced and oxidized cofactors are quite disparate, with [NADPH] > [NADP⁺] (11) and [NAD⁺] > [NADH] (12). Consequently, HSDs that use the phospho-cofactor pair NADPH/NADP⁺ direct chemistry in the reductive direction in intact cells, driven by the abundance of NADPH and by thermodynamics, which favors NADPH oxidation. In contrast, oxidative HSDs bind NADPH poorly, which allows them to harness the 700:1 NAD⁺/NADH concentration gradient and force hydroxysteroid oxidation by mass action (2). Cofactor concentrations primarily determine equilibrium steroid proportions achieved by each HSD for two reasons. First, cofactor concentrations exceed those of steroids by several orders of magnitude, thus dominating the equations for HSD kinetics in both directions. Second, cofactor concentrations are maintained by cellular metabolism and thus change little as steroid metabolism proceeds to functional equilibrium (10).

Residues within the Rossman fold (13) of SCOR enzymes interact with the 2'-phosphate of NADP(H) to stabilize cofactor binding (14), and this interaction is critical for maintaining the directional preference of reductive SCOR enzymes. For example, 17ß-HSD type 1 mutation L36D introduces a negative charge adjacent to the 2'-phosphate of NADP(H) and thus reduces the affinity for NADP(H) over 200-fold (15), which dramatically changes the equilibrium steroid distribution to favor oxidation in human embryonic kidney (HEK)-293 cells (9). Some structural determinants of cofactor binding in the AKR enzymes have also been identified. The x-ray crystal structure of rat liver AKR1C9, the prototypical 3-HSD, identifies a similar salt-bridge interaction between R276 and the 2'-phosphate of NADP⁺ (16), which implicates R276 as the critical residue for favoring NADP(H) binding and thus ketosteroid reduction. Substitution of the nearly isosteric but neutral methionine for R276 reduced the affinity of the enzyme for NADPH and eliminated a fluorescence kinetic transient seen in stopped-flow experiments of cofactor binding to purified enzyme (17, 18). Mutation R276M also altered the rate-limiting step in steady-state kinetics from product dissociation to hydride transfer, which demonstrates a critical role of R276 in NADP(H) binding (18). However, the influence of mutations at R276 on directional preference for the reductive AKR1C HSDs in intact cells is not known. Consequently, we generated stable lines of HEK-293 cells expressing AKR1C9 and mutations R276G, R276M, and R276E, and we determined the consequences of these mutations on equilibrium steroid distributions and rates of dihydrotestosterone (DHT) and androstanediol (Adiol) metabolism in intact cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Chemicals and reagents
Radiochemicals, provided and diluted in ethanol, were obtained from PerkinElmer Life Sciences (Shelton, CT; [1,2-³H(N)]-DHT, 42.0 Ci/mmol and [1,2-³H(N)]-Adiol, 54.0 Ci/mmol) and American Radiolabeled Chemicals, Inc. (St. Louis, MO; [4-¹⁴C]-DHT, 55 mCi/mmol). Unlabeled steroids were obtained from Sigma (St. Louis, MO) or Steraloids (Providence, RI) and dissolved in ethanol. Other chemicals and reagents were obtained from Fisher Scientific (Pittsburgh, PA) or Sigma.

The [4-¹⁴C]-Adiol, 55 mCi/mmol, was prepared by incubating [4-¹⁴C]-DHT (45 nmol, 2.5 µCi) dissolved in 24 µl acetonitrile with purified recombinant AKR1C9 (10 µg; gift from Dr. Trevor Penning, Department of Pharmacology, University of Pennsylvania, Philadelphia, PA) and 0.4 mM NADPH in 0.6 ml of 0.1 mM potassium phosphate (pH 6.0) for 60 min. The crude product was extracted four times with 1 ml of 1:1 ethyl acetate:isooctane and concentrated to dryness under a nitrogen stream. The residue was dissolved in a small amount of dichloromethane and applied to a 70 x 6 mm column of silica gel 60 (230–400 mesh; EM Sciences, Darmstadt, Germany) equilibrated with hexanes. The column was washed with 5 ml each of hexanes and 10%, then 20% ethyl acetate in hexanes. The remaining [4-¹⁴C]-DHT and the product [4-¹⁴C]-Adiol were eluted with 10 ml of 30% and 5 ml of 40% ethyl acetate in hexanes. The remaining [4-¹⁴C]-DHT eluted in the first 2.5 ml fraction, and three fractions containing pure [4-¹⁴C]-Adiol [as examined by thin-layer chromatography (TLC)] were pooled, concentrated under nitrogen, redissolved in ethanol, and quantified by liquid scintillation counting (yield 20 nmol, 1.1 µCi, 44%).

Site-directed mutagenesis
Restriction sites (5' KpnI and 3' XhoI) were engineered into the wild-type AKR1C9 cDNA using PCR primers GGTACCATGGATTCCATATCTCTGCG (sense) and CTCGAGTTAATATTCATCAGAAAATGG (antisense), with restriction sites underlined. Mutations R276G and R276E were constructed with oligonucleotides CAACGCGAAGxyzATCAAAGAGCTAAC (sense, xyz = GGA or GAA for R276G and R276E, respectively) and CTCTTTGATxyzCTTCGCGTTGAAAC (antisense, xyz = TCC or TTC for R276G and R276E, respectively). PCRs were assembled in 50 µl using template pCMV-AKR1C9 (10 ng) with 50 pmol of each primer, 2% dimethylsulfoxide, 2 mM deoxynucleotide triphosphates, and 2.5 U of Mercury brand True Fidelity polymerase (Continental Lab Products, San Diego, CA) and the manufacturer’s buffer. The first amplifications (sense terminal + antisense mutagenic primers for 5' piece or antisense terminal + sense mutagenic primer for 3' piece) were conducted for 25 cycles of 95 C/30 sec; 60 C/30 sec; 72 C/2 min. Amplicons were gel-purified (Qiaex II; QIAGEN, Valencia, CA), and 10 ng of each 5' + 3' pieces were coamplified with the terminal primers for 25 cycles of the same conditions. The final product was adenylated with Taq polymerase (Promega, Madison, WI) and 1 mM deoxy-ATP at 72 C for 10 min and cloned into vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA) using the A-overhang method. The cDNA was sequenced to confirm that only the desired mutation was introduced, excised by digestion with KpnI and XhoI, and subcloned into KpnI/XhoI-digested pcDNA3 (Invitrogen) to yield vectors pcDNA3-AKR1C9[R276E] and -[R276G]. The cDNAs for wild-type AKR1C9 and mutation R276M were amplified with the terminal primers as above using pCMV-AKR1C9 and pET-AKR1C9-[R276M] as templates, respectively.

Cell culture and cell line preparation
HEK-293 cells (ATCC no. CRL-1573; American Type Culture Collection, Manassas, VA) were grown in complete medium (DMEM containing 10% fetal bovine serum, 100 IU/ml penicillin, and 0.1 mg/ml streptomycin; Mediatech, Herndon, VA) at 37 C with 5% CO₂. Stable lines were prepared by transfecting a 10-cm dish with 10 ml medium at 50% confluence using a transfection reagent prepared with 1 µg of plasmid pcDNA3-AKR1C9 (wild-type and mutations) and 3 µl of FuGENE6 (Roche Diagnostics, Indianapolis, IN) in 0.25 ml serum-free medium. After 48 h, the cells were split 1:12–1:25 into 15-cm gridded plates, and the next day, the medium was changed to complete medium with 0.5 mg/ml G418 (Research Products International, Mount Prospect, IL). This medium was exchanged every 3–4 d for 14–21 d. Individual clones were harvested with a pipette tip into 24-well plates with 0.5 ml of medium containing 0.5 mg/ml G418. When the wells were nearly confluent, the cells were harvested and transferred to duplicate six-well plates, one for assay and one for propagation. For each transfection, three clones with the best growth and activity were further expanded and used for experiments.

Metabolism of single substrates in complete or modified medium
Cells were seeded into six-well plates at 50% confluence the day before the experiment, and incubations were performed with 3 ml of fresh medium containing 300,000–400,000 cpm of [³H]-steroid plus unlabeled carrier steroid to yield 0.1 µM final concentration as standard assay conditions. The plate was returned to the incubator, and 0.5 ml aliquots of medium were removed at 2, 4, and 8 h. Each aliquot was extracted with 1 ml of ethyl acetate:isooctane (1:1), and the organic phase was concentrated under a nitrogen stream. The residue was resuspended in 30 µl of dichloromethane and applied to plastic-backed TLC plates (250 µm silica gel with fluorescent indicator; Whatman, Kent, UK). The plates were developed with 3:1 chloroform:ethyl acetate, dried, and sandwiched against a BAS-TR2040 tritium phosphorimaging screen (Fuji Medical Systems, Stamford, CT). The plate was read using a Molecular Dynamics (Sunnyvale, CA) Storm 860 PhosphorImager, and steroids were quantitated with ImageQuant version 5.0 software. Alternatively, dried reaction products were mixed with 200 nmol of each DHT and Adiol before application to the TLC plates. The developed plates were placed in an iodine chamber for 10 min to reveal the locations of DHT and Adiol, and these regions of the plates were excised with scissors and placed into a vial with 5 ml of liquid scintillation cocktail (Budget-Solve, Research Products International), then counted for 3 min in a Beckman LS5000TD Liquid Scintillation counter. The two methods yielded similar results, although the scintillation counting method was preferable at the extremes of steroid distributions.

After an initial set of experiments using complete medium, experiments were repeated in parallel using wells containing complete medium, glucose-free medium with 10 mM 2-deoxyglucose, or 0.1 mM methylene blue. The cells were seeded into six-well plates with complete medium, and the medium was changed 1 h before the start of incubations. Steroid (0.1 µM, 400,000 cpm) was added in 0.1 ml glucose-free DMEM to the 2 ml of specific medium in each well, and aliquots (0.5 ml) were removed at 2, 4, and 6 h, extracted, chromatographed, and quantitated as above.

Intrinsic rates of half-reactions at equilibrium
Cell lines were incubated with medium containing one steroid labeled with [³H] and the other with [¹⁴C] in the relative mass proportions found at equilibrium (9). In general, the more abundant (product) steroid bore the [¹⁴C]-label, and enough [¹⁴C]-steroid was added to provide >40,000 cpm per time point at a final concentration of 0.5–0.7 µM, which afforded adequate mass and radioactivity for reliable data analysis. Unlabeled substrate steroid was added achieve the previously determined equilibrium mass proportions, and [³H]-labeled substrate steroid (contributing negligible mass) was added to provide slightly more [³H] than [¹⁴C] radioactivity. The proportions of the two steroids were then adjusted until negligible mass flux occurred during incubations. The amounts of each component used in these incubations are summarized in Table 1.

View this table: [in this window] [in a new window]   TABLE 1. Conditions for equilibrium kinetics experiments (data in Table 4 and Fig. 3)

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Equilibrium steroid distributions for wild-type AKR1C9 and mutations
Stable lines of HEK-293 cells expressing wild-type AKR1C9 and mutations R276M, R276G, and R276E were prepared to study equilibrium steroid distributions in intact cells. Amino acid substitution were chosen to provide a range of alterations, from a roughly isosteric but neutral sidechain (M, also studied previously in vitro (17, 18) to a negatively charged sidechain (E), or no sidechain (G). At least three clones of each cell line were propagated and assayed for enzyme activity, and the growth and steroid metabolism rates of the clones were similar within each line (not shown). Consequently, one clone for each line was used for all experiments.

The line expressing wild-type AKR1C9 metabolized 0.1 µM DHT almost completely to Adiol, reaching a functional equilibrium state in 4–6 h (Fig. 1A). Lines expressing mutations R276G and R276M achieved similar equilibrium states but at progressively slower rates (Table 2). As anticipated, these three lines achieved comparable equilibrium steroid distributions when starting with 0.1 µM Adiol (Fig. 1B). In contrast, the line expressing mutation R276E exhibited the opposite directional preference, oxidizing Adiol to DHT, presumably using abundant NAD⁺ as cosubstrate (Fig. 1, A and B). The background rates of DHT and Adiol metabolism in HEK-293 cells was less than 4% of that of the line expressing wild-type AKR1C9 (Table 2).

View larger version (15K): [in this window] [in a new window]   FIG. 1. Metabolism of DHT to Adiol (A) and Adiol to DHT (B). Metabolism of 0.1 µM steroid by cell lines expressing wild-type AKR1C9 () or mutations R276M (), R276G (), and R276E () is shown as a function of time. Data points are means ± SD of triplicate experiments, and curves are best fits to the data: (t) = A(1 – e–kt) for DHT to Adiol, r2 > 0.99 for all fits, and (t) = A·e–kt + C for Adiol to DHT, r2 > 0.95 for all fits. Background metabolism in parental HEK-293 cells is shown by diamonds (). Equilibrium steroid distributions derived from curve fits are summarized in Table 2.

View this table: [in this window] [in a new window]   TABLE 2. Initial rates of steroid metabolism (0.1 µM steroid, derived from data in Fig. 1)

Glucose deprivation had little influence on the equilibrium steroid distribution achieved by the cell line expressing wild-type AKR1C9, but more complete NADPH depletion with MB significantly attenuated the reductive preference (Fig. 2 and Table 3). In contrast, for cell lines expressing mutations R276M and R276G, glucose deprivation reduced the Adiol/DHT ratio at equilibrium to about 60:40, and MB further reduced this ratio to favor oxidation (Fig. 2 and Table 3). As predicted, the line expressing mutation R276E demonstrated an oxidative preference under all conditions (Fig. 2 and Table 3). These data suggest that R276 maintains the strong preference of AKR1C9 for DHT reduction to Adiol, even in the face of mild intracellular NADPH depletion. Neutral substitutions R276G and R276M also show a reductive preference, but a negatively charged glutamic acid residue at position 276 is sufficient to reverse the directional preference of AKR1C9 in intact cells.

View larger version (23K): [in this window] [in a new window]   FIG. 2. Steroid metabolism in HEK-293 cell lines incubated with complete medium (), glucose-free medium with 2-deoxyglucose (), or glucose-free medium with 0.1 µM methylene blue (). Metabolism of DHT to Adiol is shown to left, and metabolism of Adiol to DHT is shown at right. Data derive from HEK-293 cell lines stably expressing wild-type AKR1C9 (A) and mutations R276G (B), R276M (C), and R276E (D). Data points are means ± SD of triplicate experiments, and solid curves are best fits to the data: (t) = A(1 – e–kt) for DHT to Adiol, r2 > 0.95 for all fits, and (t) = A·e–kt + C for Adiol to DHT, r2 > 0.98 for all fits. Dashed lines indicate poor curve fitting statistics (r2 < 0.86; see Table 3), and dotted line connects data points that cannot be modeled with exponential functions (both in panel A). Equilibrium steroid distributions derived from curve fits for complete medium and 2-deoxyglucose experiments are summarized in Table 3.

View this table: [in this window] [in a new window]   TABLE 3. Equilibrium steroid distributions (% Adiol, derived from data in Fig. 2)

View larger version (23K): [in this window] [in a new window]   FIG. 3. Kinetics of DHT and Adiol metabolism at equilibrium from double-isotope experiments. Metabolism of [3H]-steroid () is shown at left, and metabolism of [14C]-steroid () is shown at right. Data derive from HEK-293 cell lines stably expressing wild-type AKR1C9 (A) and mutations R276G (B), R276M (C), and R276E (D). Data points are means ± SD of triplicate experiments, and curves are best fits to the data: (t) = A·e–kt + C, r2 > 0.97 for all fits. Conditions used for these experiments are listed in Table 1, and initial rates calculated using constants derived from curve fits (rate = A·k) are shown in Table 4.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Among the HSDs, all of the known AKR1C isoforms show a strong reductive preference in intact cells (21). In contrast, the SCOR isoforms are dichotomously classified into those with oxidative and reductive preferences (1). The SCOR HSDs contain a Rossman fold (22), and within the ß23 loop of this motif, residues interact with the 2'-hydroxyl or phosphate groups of NAD(H) or NADP(H), respectively. SCOR enzymes with reductive preference generally contain a positively charged arginine in this position (23), whereas oxidative enzymes display a negatively charged aspartic or glutamic acid at the adjacent position (14). The electrostatic interaction provided by a salt bridge between this arginine and the 2'-phosphate is sufficient to favor NADP(H) binding, whereas the carboxylic acid side chains of aspartic and glutamic acids repel the 2'-phosphate and favor NAD(H) binding by exclusion (24). These paradigms are supported by the reversal of cofactor preference engineered by mutation L36D in human 17ß-HSD type 1 (15) and mutation D36A+K37R in human 3ß-HSD/isomerase type 1 (25). Thus, the directional preference for SCOR HSDs in intact cells is the physiologic correlate of their structural features that govern cofactor binding.

The AKR1C HSDs, however, lack a Rossman fold, and the determinants of cofactor binding are different. The absence of known AKR1C HSDs with oxidative preference in intact cells suggests that cofactor binding in AKR1C enzymes might always favor NADP(H) and that a single residue does not dictate cofactor usage. On the other hand, the crystal structure of AKR1C9 identifies a salt bridge between R276 and the 2'-phosphate of NADP(H) (16), analogous to the salt bridge in the Rossman fold of SCOR HSDs (23). The observation that AKR1C9 mutation R276M alters NADP(H) handling is consistent with an important role of R276 in NADP(H) binding, but the consequences of R276 mutations on the directional preference of AKR1C9 in intact cells was not studied previously. Our data indicate that R276 dictates the reductive preference of AKR1C9 in intact cells by maximizing NADP(H) binding.

Although the reductive preference of AKR1C9 in intact cells is driven by the NADPH/NADP⁺ gradient (10), the enzyme does not specifically require NADPH for reduction. Using published kinetic constants (26) and the Haldane equation, the reaction catalyzed by purified AKR1C9 at pH 7.0:

has an equilibrium constant that strongly favors reduction (K_eq = 12.0). For the equivalent physiologic reaction:

the equilibrium constant is almost identical (K_eq = 13.8; Penning, T. M., and W. C. Cooper, unpublished results). These equilibrium steroid distributions both favor androstane-3,17-dione reduction by over 10-fold, due to the thermodynamic drive for oxidation of NAD(P)H. However, the affinity of AKR1C9 for NADH (K_d = 200 µM) is 1000-fold weaker than its affinity for NADPH (K_d = 150 nM) (26). Consequently, under normal physiologic conditions, the enzyme will always be saturated with NADPH, and this tight binding will preclude access of NAD⁺ despite the comparable abundance of these two cofactors (27) and maintain the enzyme’s reductive preference. If this model is true, then intracellular NADPH depletion should reverse the directional preference of AKR1C9, which we observe in cells treated with methylene blue (Fig. 2). For wild-type AKR1C9, only profound NADPH depletion reverses this directional preference, but simple glucose deprivation is sufficient to lower the directional preference of mutations R276M and R276G. Thus, these cell-based experiments illustrate the physiologic consequences of previous in vitro studies of mutation R276M (17, 18, 27).

The AKR1C enzymes are critical components of peripheral androgen and progestin metabolism by virtue of their 3-, 17ß-, and 20HSD activities (21, 28, 29). A strong reductive preference is critical to their physiologic functions, such as the inactivation of progesterone in the uterus by AKR1C1 (28) or the inactivation of DHT in the prostate by AKR1C2 (27). High affinity for NADPH is required to maintain this reductive preference in the face of conditions that alter intracellular redox state, such as starvation or hypoxia (10). R276 provides a critical interaction for maintaining high affinity for NADPH, and the physiologic importance of R276 is exemplified by the alterations in equilibrium steroid distributions derived from mutations at this site. Consequently, mutations in R276 might provide a mechanism for disturbing AKR1C behavior, which could have clinical consequences, including delayed parturition (20HSD activity) and increased sensitivity to androgens in prostate cancer (3HSD activity).

	Acknowledgments

 
We thank Dr. Trevor Penning for the generous gift of purified, recombinant AKR1C9, vectors with cDNAs for wild-type AKR1C9 and mutation R276M, and for helpful discussions.

	Footnotes

 
This work was supported by the National Institutes of Health (Grant R21DK059942 to R.J.A.). A.B. was a University of Texas Southwestern Summer Undergraduate Research Fellowship student.

The authors declare no conflicts of interest related to this manuscript.

First Published Online December 15, 2005

Abbreviations: Adiol, 5-Androstane-3,17ß-diol; AKR, aldo-keto reductase; DHT, dihydrotestosterone (5-androstane-17ß-ol-3-one); HEK, human embryonic kidney; 3HSD, 3-hydroxysteroid dehydrogenase; NAD(P)(H), nicotine adenine dinucleotide (phosphate), (reduced form); SCOR, short-chain oxidoreductase; T, testosterone; TLC, thin-layer chromatography.

Received September 6, 2005.

Accepted for publication December 7, 2005.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Duax WL, Ghosh D, Pletnev V 2000 Steroid dehydrogenase structures, mechanism of action, and disease. Vitam Horm 58:121–148[CrossRef][Medline]
2. Jornvall H, Persson B, Krook M, Atrian S, Gonzalez-Duarte R, Jeffery J, Ghosh D 1995 Short-chain dehydrogenases/reductases (SDR). Biochemistry 34:6003–6013[CrossRef][Medline]
3. Jez JM, Penning TM 2001 The aldo-keto reductase (AKR) superfamily: an update. Chem Biol Interact 130–132:499–525
4. Miettinen MM, Mustonen MV, Poutanen MH, Isomaa VV, Vihko RK 1996 Human 17ß-hydroxysteroid dehydrogenase type 1 and type 2 isoenzymes have opposite activities in cultured cells and characteristic cell- and tissue-specific expression. Biochem J 314:839–845
5. Luu-The V, Zhang Y, Poirier D, Labrie F 1995 Characteristics of human types 1, 2 and 3 17ß-hydroxysteroid dehydrogenase activities: oxidation/reduction and inhibition. J Steroid Biochem Mol Biol 55:581–587[CrossRef][Medline]
6. Tremblay Y, Ringler GE, Morel Y, Mohandas TK, Labrie F, Strauss III JF, Miller WL 1989 Regulation of the gene for estrogenic 17-ketosteroid reductase lying on chromosome 17cen®q25. J Biol Chem 264:20458–20462[Abstract/Free Full Text]
7. Geissler WM, Davis DL, Wu L, Bradshaw KD, Patel S, Mendonça BB, Elliston KO, Wilson JD, Russell DW, Andersson S 1994 Male pseudohermaphroiditism caused by mutations of testicular 17ß-hydroxysteroid dehydrogenase 3. Nat Genet 7:34–39[CrossRef][Medline]
8. Wu L, Einstein M, Geissler WM, Chan HK, Ellison KO, Andersson S 1993 Expression cloning and characterization of human 17ß-hydrosteroid dehydrogenase type 2, a microsomal enzyme possessing 20-hydroxysteroid dehydrogenase activity. J Biol Chem 268:12964–12969[Abstract/Free Full Text]
9. Khan N, Sharma KK, Andersson S, Auchus RJ 2004 Human 17ß-hydroxysteroid dehydrogenases types 1, 2, and 3 catalyze bi-directional equilibrium reactions, rather than unidirectional metabolism, in HEK-293 cells. Arch Biochem Biophys 429:50–59[CrossRef][Medline]
10. Agarwal AK, Auchus RJ 2005 Minireview: cellular redox state regulates hydroxysteroid dehydrogenase activity and intracellular hormone potency. Endocrinology 146:2531–2538[Abstract/Free Full Text]
11. Veech RL, Eggleston LV, Krebs HA 1969 The redox state of free nicotinamide-adenine dinucleotide phosphate in the cytoplasm of rat liver. Biochem J 115:609–619[Medline]
12. Williamson DH, Lund P, Krebs HA 1967 The redox state of free nicotinamide-adenine dinucleotide in the cytoplasm and mitochondria of rat liver. Biochem J 103:514–527[Medline]
13. Rossmann MG, Ford GC, Watson HC, Banaszak LJ 1972 Molecular symmetry of glyceraldehyde-3-phosphate dehydrogenase. J Mol Biol 64:237–245[CrossRef][Medline]
14. Duax WL, Pletnev V, Addlagatta A, Bruenn J, Weeks CM 2003 Rational proteomics I. Fingerprint identification and cofactor specificity in the short-chain oxidoreductase (SCOR) enzyme family. Proteins 53:931–943[CrossRef][Medline]
15. Huang YW, Pineau I, Chang HJ, Azzi A, Bellemare V, Laberge S, Lin SX 2001 Critical residues for the specificity of cofactors and substrates in human estrogenic 17ß-hydroxysteroid dehydrogenase 1: variants designed from the three-dimensional structure of the enzyme. Mol Endocrinol 15:2010–2020[Abstract/Free Full Text]
16. Hoog SS, Pawlowski JE, Alzari PM, Penning TM, Lewis M 1994 Three-dimensional structure of rat liver 3-hydroxysteroid/dihydrodiol dehydrogenase: a member of the aldo-keto reductase superfamily. Proc Natl Acad Sci USA 91:2517–2521[Abstract/Free Full Text]
17. Ratnam K, Ma H, Penning TM 1999 The arginine 276 anchor for NADP(H) dictates fluorescence kinetic transients in 3-hydroxysteroid dehydrogenase, a representative aldo-keto reductase. Biochemistry 38:7856–7864[CrossRef][Medline]
18. Heredia VV, Penning TM 2004 Dissection of the physiological interconversion of 5-DHT and 3-diol by rat 3-HSD via transient kinetics shows that the chemical step is rate-determining: effect of mutating cofactor and substrate-binding pocket residues on catalysis. Biochemistry 43:12028–12037[CrossRef][Medline]
19. Agarwal AK 2003 Cortisol metabolism and visceral obesity: role of 11ß-hydroxysteroid dehydrogenase type I enzyme and reduced co-factor NADPH. Endocr Res 29:411–418[CrossRef][Medline]
20. Merker MP, Bongard RD, Kettenhofen NJ, Okamoto Y, Dawson CA 2002 Intracellular redox status affects transplasma membrane electron transport in pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol 282:L36–L43
21. Hyndman D, Bauman DR, Heredia VV, Penning TM 2003 The aldo-keto reductase superfamily homepage. Chem Biol Interact 143–144:621–631
22. Ghosh D, Wawrzak Z, Weeks CM, Duax WL, Erman M 1994 The refined three-dimensional structure of 3, 20ß-hydroxysteroid dehydrogenase and possible roles of the residues conserved in short-chain dehydrogenases. Structure 2:629–640[Medline]
23. Ghosh D, Pletnev VZ, Zhu DW, Wawrzak Z, Duax WL, Pangborn W, Labrie F, Lin SX 1995 Structure of human estrogenic 17ß-hydroxysteroid dehydrogenase at 2.20 Å resolution. Structure 3:503–513[Medline]
24. Pletnev V, Weeks CM, Duax WL 2004 Rational proteomics II: Electrostatic nature of cofactor preference in the short-chain oxidoreductase (SCOR) enzyme family. Proteins 57:294–301[Medline]
25. Thomas JL, Duax WL, Addlagatta A, Brandt S, Fuller RR, Norris W 2003 Structure/function relationships responsible for coenzyme specificity and the isomerase activity of human type 1 3ß-hydroxysteroid dehydrogenase/isomerase. J Biol Chem 278:35483–35490[Abstract/Free Full Text]
26. Askonas LJ, Ricigliano JW, Penning TM 1991 The kinetic mechanism catalysed by homogeneous rat liver 3-hydroxysteroid dehydrogenase. Evidence for binary and ternary dead-end complexes containing non-steroidal anti-inflammatory drugs. Biochem J 278:835–841
27. Rizner TL, Lin HK, Peehl DM, Steckelbroeck S, Bauman DR, Penning TM 2003 Human type 3 3-hydroxysteroid dehydrogenase (aldo-keto reductase 1C2) and androgen metabolism in prostate cells. Endocrinology 144:2922–2932[Abstract/Free Full Text]
28. Penning TM, Burczynski ME, Jez JM, Hung CF, Lin HK, Ma H, Moore M, Palackal N, Ratnam K 2000 Human 3-hydroxysteroid dehydrogenase isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones. Biochem J 351:67–77[CrossRef][Medline]
29. Steckelbroeck S, Jin Y, Gopishetty S, Oyesanmi B, Penning TM 2004 Human cytosolic 3-hydroxysteroid dehydrogenases of the aldo-keto reductase superfamily display significant 3ß-hydroxysteroid dehydrogenase activity: implications for steroid hormone metabolism and action. J Biol Chem 279:10784–10795[Abstract/Free Full Text]

This article has been cited by other articles:

				W. C. Cooper, Y. Jin, and T. M. Penning Elucidation of a Complete Kinetic Mechanism for a Mammalian Hydroxysteroid Dehydrogenase (HSD) and Identification of All Enzyme Forms on the Reaction Coordinate: THE EXAMPLE OF RAT LIVER 3{alpha}-HSD (AKR1C9) J. Biol. Chem., November 16, 2007; 282(46): 33484 - 33493. [Abstract] [Full Text] [PDF]

				M. E. Baker Rat 3{alpha}-Hydroxysteroid Dehydrogenase: To Oxidize or Reduce, that Is the Question. Endocrinology, April 1, 2006; 147(4): 1589 - 1590. [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 147/4/1591    most recent Author Manuscript (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Papari-Zareei, M. Articles by Auchus, R. J. Search for Related Content PubMed PubMed Citation Articles by Papari-Zareei, M. Articles by Auchus, R. J.