help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2004-1619
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seely, J.
Right arrow Articles by Rainey, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seely, J.
Right arrow Articles by Rainey, W. E.
Endocrinology Vol. 146, No. 8 3605-3613
Copyright © 2005 by The Endocrine Society

Transcriptional Regulation of Dehydroepiandrosterone Sulfotransferase (SULT2A1) by Estrogen-Related Receptor {alpha}

Jeremiah Seely, Karla Saner Amigh, Takashi Suzuki, Bobbie Mayhew, Hironobu Sasano, Vincent Giguere, Josée Laganière, Bruce R. Carr and William E. Rainey

Division of Reproductive Endocrinology and Infertility (J.S., K.S.A., B.M., B.R.C., W.E.R.), University of Texas Southwestern Medical Center, Dallas, Texas 75390; McGill University Health Center (V.G., J.L.), Montreal, Quebec, Canada H3A 2B4; Tohoku University School of Medicine (T.S., H.S.), Department of Pathology, Sendai 980-8575, Japan

Address all correspondence and requests for reprints to: William E. Rainey, PhD, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390-9032. E-mail: william.rainey{at}utsouthwestern.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The estrogen-related receptors (ERR{alpha}, -ß, and -{gamma}) are a subfamily of orphan nuclear receptors (designated NR3B1, NR3B2, and NR3B3) that are structurally and functionally related to estrogen receptors {alpha} and ß. Herein we test the hypothesis that ERR{alpha} regulates transcription of the genes encoding the enzymes involved in adrenal steroid production. Real-time RT-PCR was first used to determine the levels of ERR{alpha} mRNA in various human tissues. Adult adrenal levels of ERR{alpha} transcript were similar to that seen in heart, which is known to highly express ERR{alpha}. Expression of ERR{alpha} in the adult adrenal was then confirmed using Western blotting and immunohistochemistry. To examine the effects of ERR{alpha} on steroidogenic capacity we used reporter constructs with the 5'-flanking regions of steroidogenic acute regulatory protein (StAR), cholesterol side-chain cleavage (CYP11A), 3ß-hydroxysteroid dehydrogenase type II (HSD3B2), 17{alpha}-hydroxylase/17,20-lyase (CYP17), and dehydroepiandrosterone sulfotransferase (SULT2A1). Cotransfection of these reporter constructs with wild-type ERR{alpha} or VP16-ERR{alpha} expression vectors demonstrated ERR{alpha} enhanced reporter activity driven by flanking DNA from CYP17 and SULT2A1. SULT2A1 promoter activity was most responsive to the ERR{alpha} and VP16-ERR{alpha}, increasing activity 2.6- and 79.5-fold, respectively. ERR{alpha} effects on SULT2A1 were greater than the stimulation seen in response to steroidogenic factor 1 (SF1). Transfection of serial deletions of the 5'-flanking DNA of the SULT2A1 gene and EMSA experiments indicated the presence of three functional regulatory cis-elements which shared sequence similarity to binding sites for SF1. Taken together, the expression of ERR{alpha} in the adrenal and its regulation of SULT2A1 suggest an important role for this orphan receptor in the regulation of adrenal steroid production.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE ESTROGEN-RELATED RECEPTOR (ERR) family is composed of three members: ERR{alpha} (NR3B1), ERRß (NR3B2), and ERR{gamma} (NR3B3) (1, 2). Although all three ERR family members are closely related to the classic estrogen receptors, natural estrogens do not activate these receptors. At present, only synthetic compounds such as 4-hydroxytamoxifen, diethylstilbestrol, and XCT90 have been shown to bind and antagonize the effects of ERR family members (3, 4, 5, 6). The question remains as to whether an endogenous activating ligand actually exists for this receptor family. Recent crystallographic studies suggest that in the absence of ligand, ERRs assume the conformation of ligand-activated nuclear receptors (7). It is thus possible that ERRs are constitutively active orphan nuclear receptors regulated mainly in an antagonistic manner.

Of the three isoforms of the ERR, ERR{alpha} is the most widely expressed in adult tissues (1, 8). ERR{alpha} is expressed in both fetal and adult tissues with high levels of expression noted in the heart and kidney (1, 9, 10, 11, 12). However, relatively little is known concerning its regulation or gene targets in development or adulthood.

Although ERR{alpha} displays some sequence similarity to estrogen receptors (ER), its transcriptional activity is not limited by recognition of estrogen response elements. Although ERR{alpha} can bind estrogen response elements as homodimers or heterodimers (13, 14), it can also bind extended nuclear receptor half-sites (i.e. TnAGGTCA), also known as ERR response elements (ERRE) as monomers or homodimers (8, 13, 15, 16) and have been shown to both enhance and repress gene transcription (8, 9, 14, 15, 17, 18, 19, 20, 21, 22). Another orphan receptor, steroidogenic factor 1 (SF1; NR4A1) also regulates transcription through nuclear receptor half-sites and has been shown to be critical for development of adrenals and gonads (23, 24). In addition, SF1 regulates transcription of the genes encoding the steroidogenic acute regulatory (StAR) protein and several of the enzymes involved in steroid hormone biosynthesis (25, 26, 27, 28).

The ability of SF1 and ERR{alpha} to regulate transcription through similar cis-elements and their coexpression within adrenocortical cells led us to define the role of ERR{alpha} in the regulation of steroidogenic enzyme gene transcription. Herein, we demonstrate that ERR{alpha} is expressed in the human adrenal gland and that it acts to increase expression of 17{alpha}-hydroxylase/17,20-lyase (CYP17) and dehydroepiandrosterone (DHEA) sulfotransferase (SULT2A1). In addition, the effects of ERR{alpha} on transcription of the genes encoding steroidogenic enzymes was unique from that seen for SF1.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
RNA extraction, cDNA synthesis, and real-time PCR
Normal human adult adrenals were obtained through the Cooperative Human Tissue Network (Philadelphia, PA), and normal human adult testis and liver total RNA were obtained from the Clontech master panel II (catalog no. K4008-1; Clontech, Palo Alto, CA). Human ovaries and placenta as well as whole fetal brain, heart, and kidney were obtained from Parkland Memorial Hospital (Dallas, TX) and were determined to be normal. The use of these tissues was approved by the Institutional Review Board of the University of Texas Southwestern Medical Center (Dallas, TX). Total RNA was extracted from tissues as previously described (29). Purity and integrity of RNA was checked spectroscopically and by gel electrophoresis before use. Two micrograms of DNase-treated total RNA were reverse transcribed in a final volume of 50 µl using the high-capacity cDNA archive kit (Applied Biosystems, Foster City, CA) and stored at –20 C.

Primers for the amplification were based on published sequences for human ERR{alpha} and SULT2A1. The following primer sequences were used: ERR{alpha} (NM_004451) forward, 5'-CACCATCAGCTGGGCCAAGAG-3' (exon 5), and reverse, 5'- GGTCAGACAGCGACAGCGATG (exon 6), which produced a 55-bp fragment; and SULT2A1 (NM_003167) forward, 5'-TCGTGATAAGGGATGAAGATGTAATAA-3' (exon 1), and reverse, 5'-TGCATCAGGCAGAGAATCTCA-3' (exon 2), which produced an 83-bp fragment. PCR were performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems) in a total volume of 30 µl reaction mixture following the manufacturer’s recommendations using the SYBR Green Universal PCR master mix (Applied Biosystems), 0.1 µM of each primer, and 5 µl of each first-strand cDNA sample. A dissociation protocol was performed at the completion of each experiment to verify that a single specific PCR product was amplified. Standard curves were prepared using the human ERR{alpha} expression vector. No-template controls contained water in place of first-strand cDNA. Each sample was normalized on the basis of its 18S rRNA content. The 18S quantification was performed using a TaqMan rRNA reagent kit (Applied Biosystems) following the manufacturer’s recommendations.

Protein immunoblotting analysis
Cultured H295R adrenocortical cells and adult adrenal and liver samples were used to prepare nuclear extract following the protocol described previously (30). PAGE was carried out on the samples using a precast Novex gel electrophoresis system with 4–12% bis-Tris NuPage gels (Invitrogen, Carlsbad, CA). Proteins were electrophoretically transferred onto polyvinylidene difluoride membranes by wet transfer for 1 h at 30 V. After transfer, the membranes were incubated overnight at 4 C with rabbit ERR{alpha}-specific antibody (1:1000 dilution) designed against the N-terminal region of ERR{alpha} (catalog no. AB16363; Abcam, Cambridge, MA). Membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, and immunoreactive bands were visualized using enhanced chemiluminescence Western blotting detection reagents from Amersham Pharmacia Biotech (Piscataway, NJ). Lamin B (catalog no. SC-6216; Santa Cruz Biotechnology, Santa Cruz, CA) was used as a loading control for nuclear extracts.

Cell culture and transfection assay
Transfection assays were performed using CV-1 cells, which were derived from the kidney of the African green monkey (ATCC CCL-70; American Type Culture Collection, Rockville, MD) (31) because of their significantly lower levels of ERR{alpha} expression than adrenal cells (data not shown). CV-1 cells were cultured in DMEM/F12 medium (Invitrogen) supplemented with 5% NuSerum (Collaborative Biom, Bedford, MA) and antibiotics. For transfection experiments, Fugene 6 (Roche, Indianapolis, IN) was used to transfect 1 µg of reporter plasmid and 0.3 µg of expression vectors. To assure constant amounts of DNA per well for each transfection, pCMX empty vector was used. The cells were cotransfected with 50 ng/well of ß-galactosidase plasmid (Promega, Madison, WI) to normalize luciferase activity. Cells were harvested 22–24 h after recovery and assayed for luciferase activity using the luciferase assay system (Promega).

Preparation of reporter constructs and expression vectors
The 5'-flanking DNA from the human genes for StAR, cholesterol side-chain cleavage (CYP11A1), 3ß-hydroxysteroid dehydrogenase type II (HSD3B2), 11ß-hydroxylase (CYP11B1), aldosterone synthase (CYP11B2), CYP17, and SULT2A1 were inserted upstream of the firefly luciferase gene in the reporter vector pGL3basic (Promega). SULT2A1 deletion constructs were described previously (32). Empty pGL3basic served as the control vector to measure basal activity in all transfections. The human ERR{alpha} and VP16-ERR{alpha} were described previously (4). The coding regions of human SF1 and DAX (dosage-sensitive sex reversal, adrenal hypoplasia congenital, critical region on the X chromosome, gene 1) were inserted into the eukaryotic expression vector pcDNA 3.1 zeo (Invitrogen) (26). Mutations to putative ERR{alpha} binding sites in the SULT2A1 promoter were created using the QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) following the manufacturer’s recommendations. Primer sets used for the mutations have been previously described (32).

Immunohistochemistry
Immunohistochemical analysis was performed employing the streptavidin-biotin amplification method using a Histofine Kit (Nichirei, Tokyo, Japan). Antibodies used include SULT2A1 (rabbit polyclonal) (33), SF1 (rabbit polyclonal) (kindly provided by Dr. K. Morohashi, National Institute for Basic Biology, Okazaki, Japan) (34), and ERR{alpha} (mouse monoclonal; 2ZH5844H) purchased from Perseus Proteomics (Tokyo, Japan) (35). Antigen retrieval for immunostaining of SF1 and ERR{alpha} was performed by heating the slides in an autoclave at 121 C for 5 min in citric acid buffer (2 mM citric acid and 9 mM trisodium citrate dehydrate, pH 6.0). The dilutions of the primary antibodies used in this study were 1:1000. The antigen-antibody complex was visualized with 3.3'-diaminobenzidine solution [1 mM diaminobenzidine, 50 mM Tris-HCl buffer (pH 7.6), and 0.006% H2O2] and counterstained with hematoxylin. For negative controls (data not shown), normal rabbit or mouse IgG was used instead of primary antibodies, and no specific immunoreactivity was detected in these sections. Histological identification of three zones of the human adrenal cortex was based on previously published criteria (36).

EMSA
Nuclear extracts from human adult adrenal tissue were prepared as described above. EMSA were performed as previously described (30) using the oligonucleotides for cis-elements in the SULT2A1 gene as described previously (32).

Data analysis and statistical methods
Data from at least three experiments run in triplicate, for a total of nine independent observations for each condition, were pooled and analyzed using single-factor ANOVA with Student-Newman-Keuls multiple comparison method, using SigmaStat version 3.0 (SPSS, Chicago, IL). Significance was accepted at the 0–0.05 level of probability.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Human adrenal tissue expresses ERR{alpha} mRNA and protein
To demonstrate expression of ERR{alpha} in the human adult adrenal gland and to characterize the expression pattern of ERR{alpha} in steroidogenic tissues, quantitative real-time RT-PCR was performed using mRNA isolated from human adult adrenal, ovary, testis, placenta, and fetal adrenal as well as control tissues (fetal brain, heart, and kidney) reported to highly express ERR{alpha} (1, 8) (Fig. 1Go). ERR{alpha} transcripts in the fetal adrenal (0.61 amol/µg 18S) and placenta (0.60 amol/µg 18S) were comparable to the levels detected in the testis (0.50 amol/µg 18S), fetal brain (0.49 amol/µg 18S), and fetal kidney (0.60 amol/µg 18S) tissue samples. Compared with other tissues, the expression of ERR{alpha} mRNA in the liver was low (0.205 amol/µg 18S). This observation is in agreement with the levels of ERR{alpha} mRNA detected in previously published Northern analysis data (1, 11). Once the presence of ERR{alpha} mRNA in the human adrenal was demonstrated, Western analyses were performed to confirm the presence of the ERR{alpha} protein (Fig. 2Go). Incubation with ERR{alpha}-specific antibody revealed the presence of ERR{alpha} protein in nuclear extracts of human adult adrenal glands as well as in the H295R adrenocortical cell line. No detectable level of ERR{alpha} protein was found in liver nuclear extract, which correlates with the real-time RT-PCR data and with previous studies indicating low levels of ERR{alpha} expression in liver (1, 11).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 1. Quantification of ERR{alpha} transcript levels in human steroidogenic tissues. Real-time RT-PCR was performed to quantify the level of ERR{alpha} mRNA in adult adrenal (a. adrenal), fetal adrenal (f. adrenal), placenta, ovary, testis, liver, fetal brain (f. brain), fetal heart (f. heart), and fetal kidney (f. kidney) as described in Materials and Methods. Data represent the mean ± SEM of at least three independent DNase-treated RNA samples and are expressed in attomoles of mRNA per µg of 18S rRNA.

 


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 2. Western analysis of the human ERR{alpha} protein. Fifteen micrograms of nuclear extract protein from cultured H295R cells, human adult adrenal, and human liver were separated on a 4–12% Bis-Tris NuPage gel (Invitrogen) and blotted onto a polyvinylidene difluoride membrane as described in Materials and Methods. Lamin B was used as a loading control.

 
Finally, immunohistochemical staining of adrenal sections was performed to localize the expression of ERR{alpha} within the human adrenal gland (Fig. 3Go). ERR{alpha} immunoreactivity was detected in nuclei of cortical cells of the entire adrenal cortex, including zona glomerulosa (Fig. 3AGo), fasciculata, and reticularis (Fig. 3BGo). No ERR{alpha} was detected in the cells of the adrenal capsule or inner medullary cells. No staining was observed in the absence of ERR{alpha} antibody.



View larger version (158K):
[in this window]
[in a new window]
  		FIG. 3. Immunohistochemical analysis of ERR{alpha} (A and B), SF1 (C), and SULT2A1 (D) in human adult adrenal gland. ERR{alpha} immunoreactivity was detected in the nucleus of cortical cells in zonae glomerulosa (A), fasciculata, and reticularis (B). SF1 immunoreactivity was detected in the nucleus of cortical cells in all three zones (C), whereas SULT2A1 immunoreactivity was detected in the cytoplasm of cortical cells in zona reticularis (D), as reported previously (36 37 ). Panels B–D were demonstrated as same tissue field in the serial sections. Bar, 100 µm. G, Glomerulosa; F, fasciculata; R, reticularis.

 
ERR{alpha} activates the transcription of SULT2A1 and CYP17
To better determine the role of ERR{alpha} in the regulation of adrenal steroidogenesis, we examined its effects on the transcription of the genes encoding the enzymes involved in steroid hormone biosynthesis and the StAR protein. The promoter constructs tested include CYP11A1, StAR, HSD3B2, CYP17, CYP11B1, CYP11B2, and SULT2A1. To minimize competition with endogenously expressed ERR{alpha}, CV-1 cells were used for transfection studies because these cells express low levels of ERR{alpha} (data not shown). Of all constructs tested, only CYP17 (1.5-fold) and SULT2A1 (2.6-fold) showed transcriptional activation when cotransfected with 0.1 µg ERR{alpha} (Fig. 4AGo). We also examined the effects of a VP16-ERR{alpha} chimera, which contains a VP16 insert directly 5' to the ERR{alpha} coding sequence. This VP16 insert is a portion of the viral protein 16 promoter region isolated from the herpes simplex virus, and when placed upstream to the ERR{alpha} coding sequence, it mimics a ligand-activated transcriptional response. Again, only the CYP17 (12.1-fold) and SULT2A1 (79.5-fold) reporter constructs exhibited a marked responsiveness to the VP16-ERR{alpha} chimera (Fig. 4BGo).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4. Effects of ERR{alpha} (A) and VP16-ERR{alpha} (B) expression constructs on steroidogenic promoters. CV-1 cells were transfected with luciferase promoter constructs containing CYP11A1, StAR, HSD3B2, CYP17, or SULT2A1 (1 µg/well). Cells were cotransfected with expression plasmids containing the coding sequence of ERR{alpha} or VP16-ERR{alpha} at a concentration of 0.1 µg/well. At 24 h after transfection, the cells were lysed and assayed for luciferase. Data were normalized to cotransfected ß-galactosidase expression vector, and results are expressed as fold increase over basal activity. Results are presented as mean ± SEM of data from at least three independent experiments performed in triplicate. *, ERR{alpha} or VP16-ERR{alpha} activation of the SULT2A1 promoter construct significant at P ≤ 0.001. hERR{alpha}, Human ERR{alpha}.

 
ERR{alpha} was then cotransfected into CV-1 cells with the SULT2A1 reporter construct and increasing concentrations of expression vectors encoding ERR{alpha} or VP16-ERR{alpha} (Fig. 5Go). The SULT2A1 promoter was activated by ERR{alpha} and VP16-ERR{alpha} in a concentration-dependent manner with activity increasing to 10.2- and 223.4-fold above basal levels, respectively, when cells were cotransfected with 1.0 µg/well of expression plasmid.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 5. Concentration-dependent effects of ERR{alpha} and VP16-ERR{alpha} on SULT2A1 reporter gene activity. CV-1 cells were transfected with luciferase reporter constructs containing the SULT2A1 promoter construct at a concentration of 1 µg/well. Cells were cotransfected with the indicated amount of ERR{alpha} or VP16-ERR{alpha} expression plasmid or the empty expression plasmid pCMX. Cells were lysed and assayed for luciferase activity after 24 h. Data were normalized to cotransfected ß-galactosidase expression vector, and results are expressed as fold increase over basal activity. Results represent the mean ± SEM of data from at least three independent experiments each performed in triplicate. All values are significantly higher than basal (P ≤ 0.001).

 
Identification of ERREs by deletion and mutation analyses
The SULT2A1 5'-flanking DNA contains several putative nuclear receptor half-sites (Fig. 6AGo) that match or closely resemble the consensus binding site TCAAGGTCA for ERR{alpha}. To determine whether these nuclear receptor half-sites were potential ERREs, a series of deletion constructs were created containing progressively shorter fragments of SULT2A1 5'-flanking DNA. These deletion constructs were cotransfected into CV-1 cells with empty pCMX expression plasmid or pCMX containing the ERR{alpha} (Fig. 6BGo) or VP16-ERR{alpha} (Fig. 6CGo) coding sequences. VP16-ERR{alpha} responsiveness was reduced by approximately 50% of that seen with the wild-type promoter when the –1063 promoter deletion construct was cotransfected. Reporter activity further decreased after transfection with the –50 deletion fragment of the SULT2A1 to a level similar to that observed with pGL3basic vector. The pattern of effects of the various SULT2A1 promoter deletions on reporter activity was similar for both wild-type ERR{alpha} and VP16-ERR{alpha}. The combination of sequence and deletion analyses indicates three potential ERR{alpha} cis-elements: –1191, –85, and –65.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6. The roles of ERR{alpha} binding cis-elements in the regulation of SULT2A1 transcription. A, Schematic representation of SULT2A1 promoter with potential ERR{alpha} binding sites. Gray boxes represent potential cis-binding sites and the numbers below represent the base pair at which the site begins based on the translational start site. B and C, CV-1 cells were transfected with ERR{alpha} (B) or VP16-ERR{alpha} (C) expression plasmids (0.3 µg/well) and pGL3basic reporter constructs containing progressively smaller amounts of SULT2A1 5'-flanking DNA (1 µg/well) as indicated. Cells were lysed and assayed for luciferase 24 h after transfection. Data were normalized to cotransfected ß-galactosidase activity, and fold induction was calculated relative to the basal promoter control. Results represent the mean ± SEM of data from at least three independent experiments performed in triplicate. *, ERR{alpha} or VP16-ERR{alpha} activation of the SULT2A1 promoter construct significantly lower than the next largest promoter deletion construct at P ≤ 0.018. hERR{alpha}, Human ERR{alpha}.

 
To determine the relative importance of each putative ERR{alpha} cis-element, all three sites were individually mutated in the context of the full-length (–1259 bp) SULT2A1 gene promoter (Fig. 7AGo). Reporter activity of the wild-type and mutated reporter constructs were examined when cotransfected with either ERR{alpha} (Fig. 7BGo) or VP16-ERR{alpha} (Fig. 7CGo) expression vectors. Mutation of the –1191 site lowered VP16-ERR{alpha} responsiveness to approximately 40% of wild type. After mutation of the –85 site, VP16-ERR{alpha} responsiveness is lowered to 5% of wild type. Finally, VP16-ERR{alpha} responsiveness of the SULT2A1 gene promoter is lowered to 16% of wild type after mutation of the possible ERRE at –65. The effect of mutation of these cis-elements was similar for both wild-type ERR{alpha} and VP16-ERR{alpha} with regard to the fold induction of reporter activity.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 7. Mutation of putative ERR{alpha} binding sites in the SULT2A1 promoter. A, Schematic representation of SULT2A1 promoter with potential ERR{alpha} binding sites indicated by gray boxes. B and C, CV-1 cells were transfected with ERR{alpha} (B) or VP16-ERR{alpha} (C) expression plasmids (0.3 µg/well) and pGL3basic reporter constructs containing the variations of the SULT2A1 promoter containing site-specific mutations (1 µg/well) as indicated. Cells were lysed and assayed for luciferase 24 h after transfection. Data were normalized to cotransfected ß-galactosidase activity, and fold induction was calculated relative to the basal promoter control. Results represent the mean ± SEM of data from at least three independent experiments performed in triplicate *, ERR{alpha} or VP16-ERR{alpha} activation of the SULT2A1 promoter construct significantly lower than that of the nonmutated (–1259) SULT2A1 clone at P < 0.001. hERR{alpha}, Human ERR{alpha}.

 
ERR{alpha} binding to putative ERR{alpha} cis-elements of the SULT2A1 promoter
To determine whether ERR{alpha} interacts directly with either the –85 or –65 cis-element of the SULT2A1 promoter, 32P-labeled oligonucleotides containing sequence to correspond with these specific elements were prepared and used in EMSA analysis (Fig. 8Go). Both elements bound proteins in nuclear extracts from adult adrenal tissue, although the –85 site bound with greater efficiency than the –65 site. Binding could be completely blocked by addition of unlabeled oligonucleotide (data not shown). Complex formation was partially retarded causing a shift when antibody targeting the amino terminus of ERR{alpha} was added to the reaction mixture in a dose-dependent fashion.



View larger version (74K):
[in this window]
[in a new window]
  		FIG. 8. EMSA of ERR{alpha} –85 and –65 cis-elements. EMSA was performed using 32P-labeled oligonucleotide probes containing the –85 or –65 consensus sequences of SULT2A1. Radiolabeled probe alone corresponds to free probe (FP), and H295R adrenocortical cell nuclear extract (NE) corresponds to H295R NE. Bands corresponding to probe/ERR{alpha} (as well as SF1) complexes are indicated. The remaining lanes correspond to H295R NE incubated with increasing levels of antibody targeted to the amino terminus of the ERR{alpha} protein. Supershift bands corresponding to probe/ERR{alpha}/ antibody (Ab) complexes are indicated.

 
Effects of SF1 on the regulation of the SULT2A1 gene promoter by ERR{alpha}
It is known that SF1 enhances transcription of the genes encoding steroid-metabolizing enzymes through its action at nuclear receptor half-sites, and we have previously shown that SF1 regulates SULT2A1 (32, 37). Our current data suggest that ERR{alpha} also enhances transcription of a steroid-metabolizing enzyme gene, SULT2A1, via binding of nuclear receptor half-sites. Therefore, we next examined the combined effects of SF1 and ERR{alpha} on the SULT2A1 reporter construct.

CV-1 cells were cotransfected with the luciferase reporter construct for SULT2A1 and expression plasmids containing the coding sequences for ERR{alpha}, SF1, or a combination of both ERR{alpha} and SF1 (Fig. 9Go). The level of SF1 (0.1 µg/well) used in the transfection was optimized before testing and enhanced transcription of the SULT2A1 promoter approximately 4-fold over basal, whereas ERR{alpha} (0.3 µg/well) enhanced transcription 5.1-fold over basal. When SF1 and ERR{alpha} were cotransfected, SULT2A1 transcription was enhanced 4.4-fold over basal, indicating that these factors likely exert their effects on SULT2A1 transcription independently, perhaps using the same cis-elements.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 9. Comparison of ERR{alpha} and SF1 enhanced SULT2A1 transcription and the effects of DAX1. CV-1 cells were transfected with luciferase reporter constructs for SULT2A1 (1 µg/well). Cells were cotransfected with expression plasmids containing the coding sequences for ERR{alpha} or SF1 alone or in combination with the expression plasmid for DAX1 at concentrations of 0.1 µg/well. After 24 h, the cells were lysed and assayed for luciferase activity. Data were normalized to cotransfected ß-galactosidase expression vector, and results are expressed as a fold induction over the basal reporter activity. Results represent the mean ± SEM of data from at least three independent experiments each performed in triplicate.

 
Effects of DAX1 on ERR{alpha} activation of SULT2A1 transcription
DAX1 (NR0B1) is another orphan nuclear receptor that is a known inhibitor of SF1 activity. Because SF1 and ERR{alpha} use some of the same nuclear receptor half-sites, the question arises whether DAX1 can also inhibit the effects of ERR{alpha} on the SULT2A1 promoter. CV-1 cells were cotransfected with the luciferase reporter constructs for SULT2A1 and expression plasmids containing the coding sequences for ERR{alpha}, SF1, or both in combination with the expression plasmid for DAX1 (Fig. 9Go). Transfection of both ERR{alpha} and SF1 enhances SULT2A1 reporter gene transcriptional activation more than 4.4-fold over basal activity. Addition of DAX1 completely ablated the ability of both ERR{alpha} and SF1 to enhance SULT2A1 transcription, reducing activity to that observed with pGL3basic vector.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The production of DHEAS within the adrenal cortex relies on three steroid-metabolizing enzymes. CYP11A and CYP17 are involved in the conversion of cholesterol to DHEA, whereas the steroid sulfotransferase SULT2A1 catalyzes the sulfonation of DHEA to DHEA sulfate (DHEAS) (38). This sulfonation of the DHEA molecule results in an increase in relative stability, thereby allowing DHEA to circulate for longer periods of time after being released by the adrenal gland and results in DHEAS being quantitatively the most abundant circulating hormone secreted by the human adrenal gland (39, 40, 41). This high level of circulating DHEAS is used in peripheral tissues that have sterol sulfatase, which is capable of reversing the sulfonation reaction and providing DHEA as a precursor for local steroid hormone production (42, 43, 44). Previous reports suggest that a significant amount of androgens in men and in postmenopausal women are derived from this peripheral conversion of DHEAS (45). The adrenal enzyme SULT2A1 plays a critical role in maintaining the high levels of circulating DHEAS and thus providing the needed precursors for estrogen and androgen production in specific peripheral tissues.

In the past, the production of DHEAS from the zona reticularis, unlike the products of the zona glomerulosa and zona fasciculata, has received relatively little attention mostly because of its existence only in humans and a few other primates. The primate-specific production of these adrenal steroids has limited model-system access for laboratory research. Also, the fact that DHEAS lacks direct androgen activity and that a definitive receptor has not been defined has slowed research into its function in steroid-mediated biological processes (46, 47). Although the enzymatic activity of SULT2A1 has been studied in some detail, the mechanisms controlling transcriptional regulation of the SULT2A1 gene are still largely unknown.

In recent years, the roles of nuclear hormone receptors in the regulation of physiological processes have been studied widely and with steady progress. Various nuclear hormone receptors are involved in a wide range of functions including development, cell growth, and differentiation (48, 49, 50, 51, 52). The functional roles maintained by nuclear hormone receptors are sometimes mediated by nuclear hormone receptor ligands. However, ligands have not been identified for all of the known nuclear hormone receptor families and thus, these nuclear receptors with no known ligand have been given the name orphan receptors. Identified because of their similarity to the classic ER{alpha}, the ERR were among the first orphan nuclear receptors ever described (1). These orphan receptors, along with the estrogen receptors, belong to group III of the nuclear receptor superfamily, which also includes the glucocorticoid, mineralocorticoid, progesterone, and androgen receptors.

The number of target genes for the ERR family of nuclear transcription factors is rapidly growing, whereas the prospect of finding endogenous activating ligands for each family member appears to be decreasing. It is possible that no activating ERR ligands exist and that regulation of ERR activity might reside in the regulation of its expression. ERR{alpha} in particular has been attributed with various functional roles involving multiple target genes. ERR{alpha} is known as a transcriptional repressor of the simian virus 40 promoter (19), as a repressor of retinoic acid induction of the medium-chain acyl coenzyme A dehydrogenase (MCAD) gene (8), and as a repressor of the aromatase promoter (53) as well as an activator of the thyroid receptor {alpha} gene promoter (15) and the osteopontin gene (10). ERR{alpha} is widely expressed in adult tissues and exhibits a broad range of target genes, and previous reports have shown expression in the mouse adrenal gland (1). Herein we demonstrated that ERR{alpha} is present in the human adrenal and that it is able to regulate transcription of steroidogenic enzymes. Both real-time RT-PCR and Western blot analysis confirm the presence of ERR{alpha} in the human adrenal, whereas immunohistochemical staining localizes ERR{alpha} to the nuclei of the adrenocortical cells. Transfection analyses indicate that steroid sulfotransferase, encoded by the SULT2A1 gene, was the steroid-metabolizing gene most responsive to cotransfection with ERR{alpha}, whereas CYP17 also showed a moderate response.

The consensus extended half-site, 5'TnAAGGTCA-3', also known as the ERRE (8) was first identified in the human lactoferrin gene promoter (16). Subsequent studies have shown that ERR{alpha} is capable of binding the ERRE as a monomer (13) or as a homodimer (15). However, ERR{alpha} is not the only transcription factor that is known to bind this particular DNA element. This binding site is also recognized by the monomeric orphan nuclear receptor SF1, which is a well known regulator of steroid biosynthesis in the adrenal cortex (54, 55, 56). This SF1 response element, which is identical to the ERRE, has previously been identified within the SULT2A1 gene promoter (32), and SF1 was found to use two such sites (-85 and –65). Thus, ERR{alpha} may also act via these cis-elements, as well as other possible SF1 response elements previously identified, further adding to the complexity of regulation of SULT2A1 gene expression within the human adrenal cortex.

Analysis of the SULT2A1 5'-flanking region revealed six possible nuclear receptor half-sites for ERR{alpha} action (–1191, –895, –499, –302, –85, and –65 sites). However, deletion analysis of the flanking region indicated that when interacting with the ERR{alpha} construct, the –85 and –65 sites played significant roles in the activation of the SULT2A1 gene transcription. Use of the VP16-ERR{alpha} chimera further indicated that the –1191 site on the SULT2A1 promoter was significantly involved in gene transcription. Mutational manipulation of the individual cis-elements confirmed that maximal ERR{alpha} enhancement of SULT2A1 reporter gene activity relied on all three sites but particularly the –85 and –65 sites. Further investigation via EMSA confirmed a direct interaction of the ERR{alpha} protein with the –85 and –65 sites in vitro. Because most of the ERR{alpha}-related enhancement of SULT2A1 gene activity could be localized to the –85 and –65 sites of the gene promoter, and SF1 has previously been shown to act at the same sites, the question arises as to whether SF1 and ERR{alpha} act collectively at these sites or in competition with each other. We have shown that the two nuclear receptors likely compete for the –85 and –65 sites to produce similar levels of gene transcriptional activation.

Because ERR{alpha} is expressed throughout the adrenal cortex, this suggests that it may play additional roles in the regulation of adrenal hormone production that are yet to be elucidated. The suggestion that ERR{alpha} competes with SF1 for certain of its nuclear receptor half-sites infers a parallel purpose of the two nuclear hormone receptors. In that regard, both SF1 and ERR{alpha} are inhibited by DAX1, a nuclear hormone receptor previously shown to interact with SF1 and block its transcriptional activity through the recruitment of corepressors (57). Despite the ability of these factors to compete for certain cis-elements, our results (Fig. 1Go) demonstrate that the effects of ERR{alpha} are not the same as is seen for SF1, suggesting that the role of these two transcription factors in the adrenal is distinct (26, 37). The ability of SF1 to transactivate all genes encoding adrenal steroidogenic enzymes (except aldosterone synthase) suggests a much broader role for SF1 in the regulation of steroidogenic enzymes. Our data would suggest that both SF1 and ERR{alpha} share the ability to enhance SULT2A1 and CYP17 transcription. Intriguingly, both of these enzymes are needed for the production of DHEAS.

The adrenal zona reticularis is known for its production of DHEA and DHEAS, and previous studies have shown the presence of SULT2A1 in the cytosol of the cells composing the reticularis (33, 36, 58). However, little is known about the mechanisms involved in the production of DHEA or DHEAS from this cortical zone. The role of orphan nuclear receptors as regulators of transcription has been the key to understanding the mechanisms controlling regulation of the SULT2A1 gene in the absence of appropriate animal models. The results presented here demonstrate a tissue-specific regulation of the SULT2A1 gene by the orphan nuclear receptor ERR{alpha} and thus shed more light on the processes involved in adrenal DHEAS production.


   Footnotes
 
Support for this study was provided by National Institutes of Health Grants T32-HD07190 (to B.R.C.), HD11149 (to W.E.R.), DK069950 (to W.E.R.), and DK43140 (to W.E.R.). Support was also provided by an operating grant from the Canadian Institutes for Health Research (to V.G.) and a U.S. Army Breast Cancer Research Program Predoctoral Traineeship Award (to J.L.), and we give special thanks also to the University of Texas Southwestern Medical Student Research Program Fellowship (to J.S.).

First Published Online May 5, 2005

Abbreviations: DAX, Dosage-sensitive sex reversal, adrenal hypoplasia congenital, critical region on the X chromosome, gene 1; DHEA, dehydroepiandrosterone; DHEAS, DHEA sulfate; ER, estrogen receptor; ERR, estrogen-related receptors; ERRE, ERR response elements; SF1, steroidogenic factor 1; StAR, steroidogenic acute regulatory protein.

Received December 16, 2004.

Accepted for publication April 27, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Giguere V, Yang N, Segui P, Evans RM 1988 Identification of a new class of steroid hormone receptors. Nature 331:91–94[CrossRef][Medline]
  2. Hong H, Yang L, Stallcup MR 1999 Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274:22618–22626[Abstract/Free Full Text]
  3. Tremblay GB, Bergeron D, Giguere V 2001 4-Hydroxytamoxifen is an isoform-specific inhibitor of orphan estrogen-receptor-related (ERR) nuclear receptors ß and {gamma}. Endocrinology 142:4572–4575[Abstract/Free Full Text]
  4. Tremblay GB, Kunath T, Bergeron D, Lapointe L, Champigny C, Bader JA, Rossant J, Giguere V 2001 Diethylstilbestrol regulates trophoblast stem cell differentiation as a ligand of orphan nuclear receptor ERR ß. Genes Dev 15:833–838[Abstract/Free Full Text]
  5. Coward P, Lee D, Hull MV, Lehmann JM 2001 4-Hydroxytamoxifen binds to and deactivates the estrogen-related receptor {gamma}. Proc Natl Acad Sci USA 98:8880–8884[Abstract/Free Full Text]
  6. Willy PJ, Murray IR, Qian J, Busch BB, Stevens Jr WC, Martin R, Mohan R, Zhou S, Ordentlich P, Wei P, Sapp DW, Horlick RA, Heyman RA, Schulman IG 2004 Regulation of PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha}) signaling by an estrogen-related receptor {alpha} (ERR{alpha}) ligand. Proc Natl Acad Sci USA 101:8912–8917[Abstract/Free Full Text]
  7. Greschik H, Wurtz JM, Sanglier S, Bourguet W, van Dorsselaer A, Moras D, Renaud JP 2002 Structural and functional evidence for ligand-independent transcriptional activation by the estrogen-related receptor 3. Mol Cell 9:303–313[CrossRef][Medline]
  8. Sladek R, Bader JA, Giguere V 1997 The orphan nuclear receptor estrogen-related receptor {alpha} is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17:5400–5409[Abstract]
  9. Bonnelye E, Vanacker JM, Dittmar T, Begue A, Desbiens X, Denhardt DT, Aubin JE, Laudet V, Fournier B 1997 The ERR-1 orphan receptor is a transcriptional activator expressed during bone development. Mol Endocrinol 11:905–916[Abstract/Free Full Text]
  10. Bonnelye E, Vanacker JM, Spruyt N, Alric S, Fournier B, Desbiens X, Laudet V 1997 Expression of the estrogen-related receptor 1 (ERR-1) orphan receptor during mouse development. Mech Dev 65:71–85[CrossRef][Medline]
  11. Shi H, Shigeta H, Yang N, Fu K, O’Brian G, Teng CT 1997 Human estrogen receptor-like 1 (ESRL1) gene: genomic organization, chromosomal localization, and promoter characterization. Genomics 44:52–60[CrossRef][Medline]
  12. Shigeta H, Zuo W, Yang N, DiAugustine R, Teng CT 1997 The mouse estrogen receptor-related orphan receptor {alpha}1: molecular cloning and estrogen responsiveness. J Mol Endocrinol 19:299–309[Abstract/Free Full Text]
  13. Johnston SD, Liu X, Zuo F, Eisenbraun TL, Wiley SR, Kraus RJ, Mertz JE 1997 Estrogen-related receptor {alpha}1 functionally binds as a monomer to extended half-site sequences including ones contained within estrogen-response elements. Mol Endocrinol 11:342–352[Abstract/Free Full Text]
  14. Lu D, Kiriyama Y, Lee KY, Giguere V 2001 Transcriptional regulation of the estrogen-inducible pS2 breast cancer marker gene by the ERR family of orphan nuclear receptors. Cancer Res 61:6755–6761[Abstract/Free Full Text]
  15. Vanacker JM, Bonnelye E, Chopin-Delannoy S, Delmarre C, Cavailles V, Laudet V 1999 Transcriptional activities of the orphan nuclear receptor ERR {alpha} (estrogen receptor-related receptor-{alpha}). Mol Endocrinol 13:764–773[Abstract/Free Full Text]
  16. Yang N, Shigeta H, Shi H, Teng CT 1996 Estrogen-related receptor, herr1, modulates estrogen receptor-mediated response of human lactoferrin gene promoter. J Biol Chem 271:5795–5804[Abstract/Free Full Text]
  17. Trapp T, Holsboer F 1996 Nuclear orphan receptor as a repressor of glucocorticoid receptor transcriptional activity. J Biol Chem 271:9879–9882[Abstract/Free Full Text]
  18. Vanacker JM, Bonnelye E, Delmarre C, Laudet V 1998 Activation of the thyroid hormone receptor {alpha} gene promoter by the orphan nuclear receptor ERR {alpha}. Oncogene 17:2429–2435[CrossRef][Medline]
  19. Wiley SR, Kraus RJ, Zuo F, Murray EE, Loritz K, Mertz JE 1993 SV40 early-to-late switch involves titration of cellular transcriptional repressors. Genes Dev 7:2206–2219[Abstract/Free Full Text]
  20. Xie W, Hong H, Yang NN, Lin RJ, Simon CM, Stallcup MR, Evans RM 1999 Constitutive activation of transcription and binding of coactivator by estrogen-related receptors 1 and 2. Mol Endocrinol 13:2151–2162[Abstract/Free Full Text]
  21. Yang C, Chen S 1999 Two organochlorine pesticides, toxaphene and chlordane, are antagonists for estrogen-related receptor {alpha}-1 orphan receptor. Cancer Res 59:4519–4524[Abstract/Free Full Text]
  22. Zhang Z, Teng CT 2000 Estrogen receptor-related receptor {alpha}1 interacts with coactivator and constitutively activates the estrogen response elements of the human lactoferrin gene. J Biol Chem 275:20837–20846[Abstract/Free Full Text]
  23. Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  24. Sadovsky Y, Crawford PA, Woodson KG, Polish JA, Clements MA, Tourtellotte LM, Simburger K, Milbrandt J 1995 Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express p450 side-chain-cleavage enzyme in the placenta and have normal embryonic serum levels of corticosteroids. Proc Natl Acad Sci USA92:10939–10943
  25. Bassett MH, Zhang Y, Clyne C, White PC, Rainey WE 2002 Differential regulation of aldosterone synthase and 11ß-hydroxylase transcription by steroidogenic factor-1. J Mol Endocrinol 28:125–135[Abstract]
  26. Hanley NA, Rainey WE, Wilson DI, Ball SG, Parker KL 2001 Expression profiles of SF-1, DAX1, and CYP17 in the human fetal adrenal gland: potential interactions in gene regulation. Mol Endocrinol 15:57–68[Abstract/Free Full Text]
  27. Leers-Sucheta S, Morohashi K, Mason JI, Melner MH 1997 Synergistic activation of the human type II 3ß-hydroxysteroid dehydrogenase/{Delta}5-{Delta}4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 272:7960–7967[Abstract/Free Full Text]
  28. Sugawara T, Holt JA, Kiriakidou M, Strauss 3rd JF 1996 Steroidogenic factor 1-dependent promoter activity of the human steroidogenic acute regulatory protein (StAR) gene. Biochemistry 35:9052–9059[CrossRef][Medline]
  29. Freije WA, Pezzi V, Arici A, Carr BR, Rainey WE 1997 Expression of 11ß-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2) in the human fetal adrenal. J Soc Gynecol Invest 4:305–309[CrossRef][Medline]
  30. Wang XL, Bassett M, Zhang Y, Yin S, Clyne C, White PC, Rainey WE 2000 Transcriptional regulation of human 11ß-hydroxylase (hCYP11B1). Endocrinology 141:3587–3594[Abstract/Free Full Text]
  31. Jensen FC, Girardi AJ, Gilden RV, Koprowski H 1964 Infection of human and simian tissue cultures with rous sarcoma virus. Proc Natl Acad Sci USA 52:53–59[Free Full Text]
  32. Saner KJ, Suzuki T, Sasano H, Pizzey J, Ho C, Strauss III JF, Carr BR, Rainey WE 2005 Steroid sulfotransferase (SULT2A1) gene transcription is regulated by steroidogenic factor 1 (SF1) and GATA-6 in the human adrenal. Mol Endocrinol 19:184–197[Abstract/Free Full Text]
  33. Sasano H, Sato F, Shizawa S, Nagura H, Coughtrie MW 1995 Immunolocalization of dehydroepiandrosterone sulfotransferase in normal and pathologic human adrenal gland. Mod Pathol 8:891–896[Medline]
  34. Sasano H, Shizawa S, Suzuki T, Takayama K, Fukaya T, Morohashi K, Nagura H 1995 Ad4BP in the human adrenal cortex and its disorders. J Clin Endocrinol Metab 80:2378–2380[Abstract]
  35. Suzuki T, Miki Y, Moriya T, Shimada N, Ishida T, Hirakawa H, Ohuchi N, Sasano H 2004 Estrogen-related receptor {alpha} in human breast carcinoma as a potent prognostic factor. Cancer Res 64:4670–4676[Abstract/Free Full Text]
  36. Kennerson AR, McDonald DA, Adams JB 1983 Dehydroepiandrosterone sulfotransferase localization in human adrenal glands: a light and electron microscopic study. J Clin Endocrinol Metab 56:786–790[Abstract]
  37. Jimenez P, Saner K, Mayhew B, Rainey WE 2003 GATA-6 is expressed in the human adrenal and regulates transcription of genes required for adrenal androgen biosynthesis. Endocrinology 144:4285–4288[Abstract/Free Full Text]
  38. Rainey WE, Carr BR, Sasano H, Suzuki T, Mason JI 2002 Dissecting human adrenal androgen production. Trends Endocrinol Metab 13:234–239[CrossRef][Medline]
  39. Carr BR, Simpson ER 1981 Lipoprotein utilization and cholesterol synthesis by the human fetal adrenal gland. Endocr Rev 2:306–326[CrossRef][Medline]
  40. Ryan KJ 1959 Biological aromatization of steroids. J Biol Chem 234:268[Free Full Text]
  41. Zbella EA, Ilekis J, Scommegna A, Benveniste R 1986 Competitive studies with dehydroepiandrosterone sulfate and 16 {alpha}-hydroxydehydroepiandrosterone sulfate in cultured human choriocarcinoma JEG-3 cells: effect on estrone, 17ß-estradiol, and estriol secretion. J Clin Endocrinol Metab 63:751–757[Abstract]
  42. Bradshaw KD, Carr BR 1986 Placental sulfatase deficiency: maternal and fetal expression of steroid sulfatase deficiency and X-linked ichthyosis. Obstet Gynecol Surv 41:401–413[Medline]
  43. de Peretti E, Mappus E 1983 Pattern of plasma pregnenolone sulfate levels in humans from birth to adulthood. J Clin Endocrinol Metab 57:550–556[Abstract]
  44. Laatikainen T, Apter D, Wahlstrom T 1980 Steroids in spermatic and peripheral vein blood in testicular feminization. Fertil Steril 34:461–464[Medline]
  45. Yen SS 2001 Dehydroepiandrosterone sulfate and longevity: new clues for an old friend. Proc Natl Acad Sci USA 98:8167–8169[Free Full Text]
  46. Widstrom RL, Dillon JS 2004 Is there a receptor for dehydroepiandrosterone or dehydroepiandrosterone sulfate? Semin Reprod Med 22:289–298[CrossRef][Medline]
  47. Parker LN, Odell WD 1980 Control of adrenal androgen secretion. Endocr Rev 1:392–410[CrossRef][Medline]
  48. Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, Wong M, Bakke M, Zhao L, Frigeri C, Hanley NA, Stallings N, Schimmer BP 2002 Steroidogenic factor 1: an essential mediator of endocrine development. Recent Prog Horm Res 57:19–36[Abstract/Free Full Text]
  49. Ozisik G, Achermann JC, Meeks JJ, Jameson JL 2003 SF1 in the development of the adrenal gland and gonads. Horm Res 59(Suppl 1):94–98
  50. Maggiolini M, Donze O, Jeannin E, Ando S, Picard D 1999 Adrenal androgens stimulate the proliferation of breast cancer cells as direct activators of estrogen receptor {alpha}. Cancer Res 59:4864–4869[Abstract/Free Full Text]
  51. Zhang Y, Dufau ML 2004 Gene silencing by nuclear orphan receptors. Vitam Horm 68:1–48[Medline]
  52. Lalli E, Sassone-Corsi P 2003 DAX-1, an unusual orphan receptor at the crossroads of steroidogenic function and sexual differentiation. Mol Endocrinol 17:1445–1453[Abstract/Free Full Text]
  53. Yang C, Zhou D, Chen S 1998 Modulation of aromatase expression in the breast tissue by ERR {alpha}-1 orphan receptor. Cancer Res 58:5695–5700[Abstract/Free Full Text]
  54. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor 1, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor 1. Mol Endocrinol 6:1249–1258[Abstract]
  55. Luo X, Ikeda Y, Schlosser DA, Parker KL 1995 Steroidogenic factor 1 is the essential transcript of the mouse ftz-f1 gene. Mol Endocrinol 9:1233–1239[Abstract]
  56. Wilson TE, Fahrner TJ, Milbrandt J 1993 The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13:5794–5804[Abstract/Free Full Text]
  57. Crawford PA, Dorn C, Sadovsky Y, Milbrandt J 1998 Nuclear receptor DAX-1 recruits nuclear receptor corepressor N-CoR to steroidogenic factor 1. Mol Cell Biol 18:2949–2956[Abstract/Free Full Text]
  58. Wang W, Yang L, Suwa T, Casson PR, Hornsby PJ 2001 Differentially expressed genes in zona reticularis cells of the human adrenal cortex. Mol Cell Endocrinol 173:127–134[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
P. Hu, H. K. Kinyamu, L. Wang, J. Martin, T. K. Archer, and C. Teng
Estrogen Induces Estrogen-related Receptor {alpha} Gene Expression and Chromatin Structural Changes in Estrogen Receptor (ER)-positive and ER-negative Breast Cancer Cells
J. Biol. Chem., March 14, 2008; 283(11): 6752 - 6763.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
E. A. Ariazi, R. J. Kraus, M. L. Farrell, V. C. Jordan, and J. E. Mertz
Estrogen-Related Receptor {alpha}1 Transcriptional Activities Are Regulated in Part via the ErbB2/HER2 Signaling Pathway
Mol. Cancer Res., January 1, 2007; 5(1): 71 - 85.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
R A Stein and D P McDonnell
Estrogen-related receptor {alpha} as a therapeutic target in cancer
Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S25 - S32.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
A M Tarrant, S R Greytak, G V Callard, and M E Hahn
Estrogen receptor-related receptors in the killifish Fundulus heteroclitus: diversity, expression, and estrogen responsiveness.
J. Mol. Endocrinol., August 1, 2006; 37(1): 105 - 120.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
Y.-H. Huang, C.-Y. Lee, P.-J. Tai, C.-C. Yen, C.-Y. Liao, W.-J. Chen, C.-J. Liao, W.-L. Cheng, R.-N. Chen, S.-M. Wu, et al.
Indirect Regulation of Human Dehydroepiandrosterone Sulfotransferase Family 1A Member 2 by Thyroid Hormones
Endocrinology, May 1, 2006; 147(5): 2481 - 2489.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
C. S. Song, I. Echchgadda, Y.-K. Seo, T. Oh, S. Kim, S.-A Kim, S. Cho, L. Shi, and B. Chatterjee
An Essential Role of the CAAT/Enhancer Binding Protein-{alpha} in the Vitamin D-Induced Expression of the Human Steroid/Bile Acid-Sulfotransferase (SULT2A1)
Mol. Endocrinol., April 1, 2006; 20(4): 795 - 808.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)