help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2004-1281
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cifuentes, M.
Right arrow Articles by Rojas, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cifuentes, M.
Right arrow Articles by Rojas, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Endocrinology Vol. 146, No. 5 2176-2179
Copyright © 2005 by The Endocrine Society


BRIEF COMMUNICATION

Calcium-Sensing Receptor Expression in Human Adipocytes

Mariana Cifuentes, Cecilia Albala and Cecilia Rojas

Institute of Nutrition and Food Technology, University of Chile, Casilla 138-11, Santiago, Chile

Address all correspondence and requests for reprints to: Mariana Cifuentes, Institute of Nutrition and Food Technology-Universidad de Chile, El Líbano 5524, Macul, Casilla 138-11, Santiago, Chile. E-mail: mcifuentes{at}inta.cl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The presence of the extracellular calcium-sensing receptor (CaSR) has been demonstrated in numerous cells that are key in the control of serum calcium concentrations, underscoring its relevance in systemic calcium homeostasis. The more recent evidence of its presence in tissues not involved in this function has broadened the spectrum of interest in this protein, now known to regulate diverse cell functions such as proliferation, differentiation, and apoptosis. This study shows the expression of CaSR in human omental adipose tissue, isolated adipocytes, and adipocyte progenitor cells as assessed by RT-PCR and immunoblotting. This is the first report of CaSR being expressed in human adipocytes and adipocyte progenitor cells, opening the possibility to investigate the physiological implications and thus contributing a novel component for adipose tissue biology research.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
THE CALCIUM SENSING receptor (CaSR) is a G protein-coupled receptor with seven-membrane-spanning segments and a large extracellular domain that harbors several glycosylation consensus sites and binds calcium ions. Since its discovery in the mid-1990s, the CaSR has been primarily involved in controlling PTH secretion and calcium reabsorption in the kidney. In accordance, its expression was reported in parathyroid cells and cells from different regions of the kidney. The CaSR is also found in other tissues involved in systemic calcium homeostasis such as small and large intestine and bone (osteoblasts and osteoclasts). The list of cell types that express the CaSR keeps growing (1, 2), suggesting that the CaSR participates in a variety of cellular functions.

The signaling cascades elicited by CaSR involve Gi proteins, phospholipases, phosphodiesterase 3B, adenylate cyclase, and ERK-MAPK proteins, among others. The receptor’s activation causes an increase in cytosolic Ca2+ concentration. Both the signaling molecules mentioned above and cytosolic Ca2+ concentrations are known to play a role in the control of adipogenesis and adipocyte metabolism (3, 4, 5, 6), thus prompting us to investigate the presence of CaSR in human adipose tissue. Here we report expression of the CaSR in both mature adipocytes and adipocyte progenitor cells isolated from omental white adipose tissue. These findings raise the possibility that CaSR participates in regulating physiologically relevant metabolic pathways in adipose cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell preparation and culture
Human omental fat was obtained from subjects undergoing elective abdominal surgery. The protocol was approved by the Institutional Review Board at the Institute of Nutrition and Food Technology, University of Chile, and informed consent was signed by the donors. Adipocytes were isolated using a method based on Rodbell (7). Briefly, fat removed during surgery was immersed in saline solution and transported (refrigerated) to the laboratory to be processed within 1 h. Adipose tissue was washed several times with Hanks’ balanced salt solution, and scissors were used to remove all visible connective tissue, blood clots, and vessels. Adipose tissue was then minced into small pieces (approximately 2–3 mm2) and dissociated with 1 g/liter collagenase type I (Worthington Biochemical Corp., Lakewood, NJ) at 37 C for 60 min with continuous mixing. The cell suspension was filtered through a sterile gauze pad and allowed to stand for a few minutes. As adipocytes spontaneously separate out from the aqueous phase, they were recovered by gently aspirating the floating layer with a plastic pipette and washed twice with 5 volumes of Hanks’ balanced salt solution. Isolated adipocytes were immediately lysed for RNA or protein analysis. Adipocyte progenitor cells were sedimented by centrifugation of the infranatant at 800 x g for 10 min. Cells were seeded on plastic culture dishes (Nunc, Rochester, NY) and grown in a monolayer with DMEM-F12 (1:1) supplemented with 10% fetal bovine serum and antibiotics (penicillin-streptomycin) at 37 C in a controlled atmosphere incubator until lysed for RNA and protein analysis.

Isolation of total RNA, RT-PCR analysis, and DNA sequencing
Adipose tissue or isolated adipocytes were immediately placed in TriZol reagent (Gibco BRL, Life Technologies, Grand Island, NY) for total RNA isolation according to the manufacturer. RNA was treated with RQ1 RNase-free DNase (Promega Corp., Madison, WI), precipitated with isopropyl alcohol, and stored at –80 C until analysis. The AMV reverse transcription system (Promega) was used for cDNA synthesis with an oligo dT15 primer, following the manufacturer’s instructions. An 816-bp fragment of the CaSR cDNA was amplified by PCR performed at a final concentration of 20 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dideoxyribonucleotide, 1 mM of each (forward and reverse) primer, and 0.05 U/µl of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA). Amplification of a 450-bp fragment of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was used as an internal control to normalize for cDNA content in each preparation. PCR primers were designed according to the corresponding cDNA sequences retrieved from public databases (CaSR, GenBank accession no. U20760; GAPDH, GenBank accession no. CR4007671). The sequences of the primers were as follows: TTCCGCAACACACCCATTGTCAAGG (CaSR forward), GGATCCCGTGGAGCCTCCAAGGC (CaSR reverse), CCCACAGTCCATGCCATCAC (GAPDH forward), TCCACCACCCTGTTGCTGTA (GAPDH reverse). The following PCR protocol was used in a PT100 thermal cycler (MJ Research, Waltham, MA): initial 5-min denaturation step at 95 C followed by 40 cycles of amplification (1 min denaturation at 94 C, 1 min annealing at 60 C, and 1 min extension at 72 C). The reaction was completed with a single cycle at 72 C for 10 min to allow completion of extension. PCR products were resolved by electrophoresis in a 1.5% agarose gel in 0.04 M Tris acetate and 0.001 M EDTA buffer and stained with ethidium bromide. Bands of cDNA of the expected size from several independent reactions were excised from the gel, pooled, and recovered using an Ultrafree DA centrifugal filter device (Millipore, Bedford, MA). Sequence analysis was carried out using an ABI DNA sequencer (model 377; Applied Biosystems, Foster City, CA).

Western blot analysis
Whole adipose tissue or isolated adipocytes were homogenized at 4 C in lysis buffer [10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 1 mM EGTA, 0.25 M sucrose, 1% Triton X-100] supplemented with Complete protease inhibitors (Roche, Mannheim, Germany) using a glass-Teflon tissue grinder. Briefly, adipose tissue or adipocytes were mixed with an equal volume of buffer and homogenized. The homogenate was centrifuged at 5000 x g, 4 C for 15 min; the supernatant was extracted with an equal volume of chloroform and the aqueous phase was recovered. Adipocyte progenitor cells were directly lysed on the culture dish and were not subjected to chloroform extraction. Protein concentration was determined by the Lowry method (8). Fifteen to 100 µg of protein were heat denatured in SDS-PAGE loading buffer [125 mM Tris-HCl (pH 6.8), 2% sodium dodecyl sulfate, and 5% glycerol] with or without 0.1 M dithiothreitol (DTT). Proteins were electrophoresed on 8% polyacrylamide gels and electrotransferred to polyvinylidene difluoride membranes using a buffer that contains 24 mM Tris, 194 mM glycine, and 10% methanol. The immunoreaction was achieved by incubation of the membranes, previously blocked with a solution containing 5% nonfat dry milk in Tris-buffered saline with 0.5% Nonidet P-40 (Sigma, St. Louis, MO), with a rabbit antihuman CaSR polyclonal antibody (United States Biological, Swampscott, MA) diluted 1:400 to 1:750 in 2% nonfat milk in Tris-buffered saline supplemented with 0.2% Nonidet P-40. Detection of the immune complexes was performed with a horseradish peroxidase-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) followed by incubation with the enzyme substrates (enhanced chemiluminescence, Amersham Biosciences, Piscataway, NJ) and exposure to chemiluminescent sensitive films.

Subcellular fractionation of adipocytes
Isolated adipocytes were subjected to differential centrifugation to obtain subcellular fractions enriched in plasma membranes, low-density microsomes, and high-density microsomes and cytosol, according to Garvey et al. (9). Briefly, adipocytes were homogenized (10 strokes at 1800 rpm with a Glas-Col homogenizer system; Glas-Col, Terre Haute, IN) using a glass homogenizer equipped with a Teflon pestle, in a buffer containing 20 mM Tris HCl (pH 7.4), 1 mM EDTA, and 250 mM sucrose, supplemented with protease inhibitors Complete (Roche) and pepstatin 1 µM (Calbiochem, San Diego, CA). A postnuclear supernatant was obtained by centrifuging the homogenate at 1000 x g at 4 C for 10 min, and discarding the pellet and fat cake. The 1000 x g supernatant was then centrifuged at 16,000 x g at 4 C for 30 min to obtain a plasma membrane-enriched pellet, which was washed once. The 16,000 x g supernatant was further centrifuged at 100,000 x g at 4 C for 60 min to recover the pellet enriched in high-density microsomes and the supernatant containing low-density microsomes and the cytosolic fraction. The 100,000 x g pellet was resuspended in the same buffer, and the different subfractions were saved for analysis, as described below.

To verify the relative enrichment of the 16,000 x g pellet in plasma membranes, we assessed the activity of the plasma membrane enzyme alkaline phosphatase (ALP) and the presence of the plasma membrane protein caveolin-1 (Cav-1) in the different adipocyte subfractions. Briefly, ALP activity was measured by the release of p-nitrophenol from p-nitrophenylphosphate (Sigma), determining the absorbance at 405 nm on a microplate reader (EL-808, BioTek Instruments Inc., Winooski, VT) after a 30-min incubation at 37 C. The presence of Cav-1 in the different subcellular fractions was assessed by Western blot, as described above, using 15% polyacrylamide gels and a rabbit antihuman Cav-1 polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) diluted 1:1000.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
In the present study, we report the expression of the CaSR in adipocytes and adipocyte progenitor cells isolated from human omental fat, as revealed by RT-PCR analysis and immunodetection. PCR was performed with primers based on the CaSR mRNA that is expressed in the human parathyroid (10). An 816-bp fragment was amplified (Fig. 1Go) from cDNA synthesized from adipose tissue and isolated adipocyte total RNA, which has the same size as the one amplified from human colon adenocarcinoma cells (Fig. 1Go), which are known to express CaSR (11). Sequencing of the cDNA fragment revealed complete identity with the published sequence for the human parathyroid CaSR cDNA (10). To the best of our knowledge, the expression of the CaSR in human adipocytes or any other model for adipose cells has not been documented before.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. Calcium sensing receptor expression in human adipocytes. RT-PCR analysis for CaSR transcripts in total RNA from whole adipose tissue (lane 1), isolated adipocytes (lane 2), and human colon adenocarcinoma cells (lane 3). Amplification of GAPDH sequence, used as an internal control for cDNA synthesis, from adipose tissue and adipocyte RNA (lanes 1' and 2', respectively). A negative control, without cDNA in the PCR is included (lane 4). DNA molecular mass standards (lane 5). Arrowhead indicates the 816-bp band corresponding to the amplified region of the CaSR cDNA.

 
To confirm the expression of CaSR protein in whole adipose tissue and isolated adipocytes, Western blots were performed using a polyclonal CaSR antibody raised against the intracytoplasmic domain of the protein. Figure 2AGo shows the immunodetection of CaSR in crude extracts from whole adipose tissue. Under reducing conditions (samples were heat denatured in SDS-PAGE loading buffer supplemented with 0.1 M DTT), we identified an approximately 118-kDa band. When samples were treated in the absence of DTT, the polypeptide migrated with approximately 158 kDa apparent molecular mass, which is similar to the glycosylated form of the full-length CaSR (160 kDa) reported in human keratinocytes (12), PC3-prostate cancer cells (13), and peripheral blood monocytes (14). This polypeptide was observed in both whole adipose tissue (Fig. 2AGo) and isolated adipocytes as well as adherent adipocyte progenitor cells (Fig. 2BGo). In addition to the band of the size expected for the glycosylated full-length CaSR monomer (~158 kDa), the appearance of strongly immunoreactive polypeptides of approximately 64 kDa (Fig. 2Go) was consistently found in all samples (analyzed under reducing or nonreducing conditions). The presence of small polypeptides has been attributed to degradation of the CaSR (14, 15, 16). The use of reducing agents such as 2-mercaptoethanol or DTT has been associated with increased degradation of the CaSR (14, 16) and reduction of disulfide bonds of CaSR dimers (17). As shown in Fig. 2AGo, treatment with 0.1 M DTT results in altered migration of the larger CaSR polypeptide, which could arise from a change in the protein conformation, dimer dissociation, or proteolytic cleavage by proteases that are activated in reducing conditions. The observed pattern of bands (150–160 and 60–64 kDa), which was consistently detected in adipose tissue samples from all subjects evaluated, which included lean and obese adults of both sexes, is coherent with the results from other studies reporting expression of the CaSR in different tissues.



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 2. Western blot analyses of calcium-sensing receptor in adipose tissue, isolated mature adipocytes, and adipocyte progenitor cells. A, Whole adipose tissue extract denatured under reducing (lane 1) and nonreducing conditions (lane 2) before SDS-PAGE. Arrowheads show polypeptides immunoreactive with CaSR antibody at 158 kDa (open arrowhead) and 118 kDa (solid arrowhead). B, Protein samples from Jurkatt cells (lane 1), adipose tissue in the absence of anti CasR antibody (lane 2), isolated adipocytes from three different subjects (lanes 3–5), and adipocyte progenitor cells (lane 6) analyzed under nonreducing conditions. Arrowheads indicate immunoreactive polypeptides at 158 kDa (solid arrowhead) and 64 kDa (open arrowhead). The position of molecular mass standards is shown on the right.

 
We performed subcellular fractionation of the adipocytes to ascertain whether the CaSR is located in the plasma membrane, in which it would exert its currently known physiological function. Whereas we were consistently able to detect the widely described immunoreactive 160-kDa polypeptide in every subcellular compartment analyzed, it became evident from the Western blot analysis that the subfraction containing plasma membranes was highly enriched in an immunoreactive band of distinctively higher molecular mass (Fig. 3Go). It has been reported (17) that the mature CaSR that resides on the cell surface is mainly in the form of a dimer corresponding to a molecular mass of approximately 280 kDa (or higher, depending on the extent and type of glycosylation). This molecular mass is consistent with the band that we find mainly in the plasma membrane-enriched fraction, suggesting the presence of the mature, physiologically relevant CaSR in human adipocytes. As described by other authors (17, 18), most of the total CaSR immunoreactivity is located intracellularly, which is in agreement with our immunofluorescence analysis showing overall intracellular immunoreactivity for CaSR in adipose cells (data not shown). In agreement with our observations in adipose cells, it has been reported that immunodetection of the CaSR isolated from CaSR-transfected human embryonic kidney and parathyroid cells shows CaSR-specific immunoreactive bands between 120 and 200 kDa and additional bands of higher molecular mass (18). The N-glycosylated 160-kDa species is considered the mature form that reaches the cell surface as a dimer (>300 kDa), likely the active form of the receptor (19). In addition, it has been shown by site-directed mutagenesis that N-glycosylation is essential for cell surface expression of the receptor (20, 21). Therefore, the higher-molecular-mass smear band that we observe in the plasma membrane subcellular fraction is probably the mature dimeric form of the CaSR. It has been suggested that the intracellular forms of the receptor may represent protein undergoing the biosynthetic process or even constitute a functional intracellular form of the receptor (18). It would be interesting to ascertain whether this location of the receptor might be part of a physiological process of the adipocyte, in which the receptor may possibly undergo stimulus-driven intracellular trafficking or translocation, similar to what has been described in insulin-stimulated glucose transporter Glut-4 translocation from intracellular vesicles to the plasma membrane.



View larger version (84K):
[in this window]
[in a new window]
 
FIG. 3. High-molecular-mass species of the CaSR is allocated to plasma membrane-enriched adipocyte fractions. A, Western blot analysis of Cav-1 in the 16,000 x g supernatant (S16, lane 1), 16,000 pellet (P16, lane 2), 100,000 pellet (P100, lane 3), and 100,000 supernatant (S100, lane 4). The plasma membrane protein Cav-1 is preferentially located in the P16 fraction. The arrow shows the 24-kDa band corresponding to Cav-1. ALP-specific activity shows 2- to 6-fold enrichments in the P16 fraction with respect to the P100 fraction in four different samples analyzed (data not shown). B, Western analysis of CaSR in S16, P16, P100, and S100, lanes 1, 2, 3, and 4, respectively. The open arrowhead shows the approximately 160-kDa band present throughout the adipocyte, whereas the solid arrowhead indicates the higher-molecular-mass band (>250 kDa), distinctively more abundant in the plasma membrane-enriched fraction. These results are representative of five samples from different subjects. The position of molecular mass standards is shown on the right.

 
The CaSR was originally thought to be mainly involved in calcium homeostasis, as the primary regulator of PTH secretion in response to changes in circulating Ca2+ (10). The expression of the receptor in the thyroid C cell, in which it mediates calcitonin secretion (22, 23), and kidney cells, regulating Ca2+ excretion (1), supports this concept. However, expression in organs and tissues less likely to participate in calcium homeostasis such as fibroblasts (24), antral gastrin cells (15), pancreatic ß-cells (25), neurons, and oligodendrocytes (26) among others suggests other physiological functions for this receptor.

The findings presented here pose a series of interesting questions regarding the physiological function of the CaSR in adipocytes and adipocyte progenitor cells. Our observation of the presence of the CaSR along with plasma membrane markers in adipocyte subfractions, is consistent with a putative role as a plasma membrane receptor in the adipose cells. It is theoretically plausible to relate CaSR signaling to proliferation, differentiation, and metabolic activity of adipose cells. For example, activation of the receptor in the adipocyte is expected to trigger signaling cascades (27, 28), which have been described in relevant phenomena in adipocyte metabolism such as adipogenesis and lipogenesis. Moreover, an increase in cytosolic Ca2+ as a consequence of CaSR activation, as reported in parathyroid cells (29), human intestinal epithelial cell lines (11), keratinocytes (12), and antral gastrin cells (15), among others, would also influence adipogenesis (3, 4, 5, 6) and triglyceride storage in the adipocyte (30).

In summary, we have shown that the CaSR is expressed in human mature adipocytes as well as adipocyte progenitor cells. Although the results reported here concern only human omental adipose tissue and cannot be extrapolated to other depots, our findings open up a series of questions regarding the physiological role of this receptor in the human white adipose tissue.


    Acknowledgments
 
We thank Dr. Arturo Jirón (San Juan de Dios Hospital) and Dr. Leonardo Rodríguez (Dipreca Hospital) for the invaluable help in obtaining fat tissue and Marisol Blanco for her technical assistance.


    Footnotes
 
This work was supported by a fellowship from the Ellison Medical Foundation and grants from Fundación Andes (C-13960/26, to M.C.), Departamento de Investigación (I-04/01-2, to M.C.), and Fondo Nacional de Desarrollo Cientifico y Tecnológico (1040877, to C.R.).

First Published Online February 17, 2005

Abbreviations: ALP, Alkaline phosphatase; CaSR, calcium-sensing receptor; Cav-1, caveolin-1; DTT, dithiothreitol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Received September 29, 2004.

Accepted for publication February 7, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Brown EM 2000 The extracellular Ca2+-sensing receptor: central mediator of systemic calcium. Annu Rev Nutr 20:507–533[CrossRef][Medline]
  2. Chattopadhyay N, Brown EM 2000 Cellular "sensing" of extracellular calcium (Ca(2+)(o)): emerging roles in regulating diverse physiological functions. Cell Signal 12:361–366[CrossRef][Medline]
  3. Bost F, Caron L, Marchetti I, Dani C, Le Marchand-Brustel Y, Binetruy B 2002 Retinoic acid activation of the ERK pathway is required for embryonic stem cell commitment into the adipocyte lineage. Biochem J 361:621–627[CrossRef][Medline]
  4. Degerman E, Landstrom TR, Wijkander J, Holst LS, Ahmad F, Belfrage P, Manganiello V 1998 Phosphorylation and activation of hormone-sensitive adipocyte phosphodiesterase type 3B. Methods 14:43–53[CrossRef][Medline]
  5. Perez C, Fernandez-Galaz C, Fernandez-Agullo T, Arribas C, Andres A, Ros M, Carrascosa JM 2004 Leptin impairs insulin signaling in rat adipocytes. Diabetes 53:347–353[Abstract/Free Full Text]
  6. Xue B, Moustaid N, Wilkison WO, Zemel MB 1998 The agouti gene product inhibits lipolysis in human adipocytes via a Ca2+-dependent mechanism. FASEB J 12:1391–1396[Abstract/Free Full Text]
  7. Rodbell M 1964 Metabolism of isolated fat cells. I. effects of hormones on glucose metabolism and lipolysis. J Biol Chem 239:375–380[Free Full Text]
  8. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with the Folin phenol reagent. J Biol Chem 193:265[Free Full Text]
  9. Garvey WT, Huecksteadt TP, Matthaei S, Olefsky JM 1988 Role of glucose transporters in the cellular insulin resistance of type II non-insulin-dependent diabetes mellitus. J Clin Invest 81:1528–1536
  10. Garrett JE, Capuano IV, Hammerland LG, Hung BC, Brown EM, Hebert SC, Nemeth EF, Fuller F 1995 Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J Biol Chem 270:12919–12925[Abstract/Free Full Text]
  11. Gama L, Baxendale-Cox LM, Breitwieser GE 1997 Ca2+-sensing receptors in intestinal epithelium. Am J Physiol 273:C1168–C1175
  12. Tu CL, Chang W, Bikle DD 2001 The extracellular calcium-sensing receptor is required for calcium-induced differentiation in human keratinocytes. J Biol Chem 276:41079–41085[Abstract/Free Full Text]
  13. Sanders JL, Chattopadhyay N, Kifor O, Yamaguchi T, Brown EM 2001 Ca(2+)-sensing receptor expression and PTHrP secretion in PC-3 human prostate cancer cells. Am J Physiol Endocrinol Metab 281:E1267–E1274
  14. Yamaguchi T, Olozak I, Chattopadhyay N, Butters RR, Kifor O, Scadden DT, Brown EM 1998 Expression of extracellular calcium (Ca2+o)-sensing receptor in human peripheral blood monocytes. Biochem Biophys Res Commun 246:501–506[CrossRef][Medline]
  15. Ray JM, Squires PE, Curtis SB, Meloche MR, Buchan AM 1997 Expression of the calcium-sensing receptor on human antral gastrin cells in culture. J Clin Invest 99:2328–2333[Medline]
  16. Yamaguchi T, Chattopadhyay N, Kifor O, Ye C, Vassilev PM, Sanders JL, Brown EM 2001 Expression of extracellular calcium-sensing receptor in human osteoblastic MG-63 cell line. Am J Physiol Cell Physiol 280:C382–C393
  17. Bai M, Trivedi S, Brown EM 1998 Dimerization of the extracellular calcium-sensing receptor (CaR) on the cell surface of CaR-transfected HEK293 cells. J Biol Chem 273:23605–23610[Abstract/Free Full Text]
  18. Brown EM, MacLeod RJ 2001 Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81:239–297[Abstract/Free Full Text]
  19. Bai M 2004 Structure-function relationship of the extracellular calcium-sensing receptor. Cell Calcium 35:197–207[CrossRef][Medline]
  20. Fan G, Goldsmith PK, Collins R, Dunn CK, Krapcho KJ, Rogers KV, Spiegel AM 1997 N-linked glycosylation of the human Ca2+ receptor is essential for its expression at the cell surface. Endocrinology 138:1916–1922[Abstract/Free Full Text]
  21. Ray K, Clapp P, Goldsmith PK, Spiegel AM 1998 Identification of the sites of N-linked glycosylation on the human calcium receptor and assessment of their role in cell surface expression and signal transduction. J Biol Chem 273:34558–34567[Abstract/Free Full Text]
  22. Fudge NJ, Kovacs CS 2004 Physiological studies in heterozygous calcium sensing receptor (CaSR) gene-ablated mice confirm that the CaSR regulates calcitonin release in vivo. BMC Physiol 4:5[CrossRef][Medline]
  23. Garrett JE, Tamir H, Kifor O, Simin RT, Rogers KV, Mithal A, Gagel RF, Brown EM 1995b Calcitonin-secreting cells of the thyroid express an extracellular calcium receptor gene. Endocrinology 136:5202–5211
  24. McNeil SE, Hobson SA, Nipper V, Rodland KD 1998 Functional calcium-sensing receptors in rat fibroblasts are required for activation of SRC kinase and mitogen-activated protein kinase in response to extracellular calcium. J Biol Chem 273:1114–1120[Abstract/Free Full Text]
  25. Squires PE, Harris TE, Persaud SJ, Curtis SB, Buchan AM, Jones PM 2000 The extracellular calcium-sensing receptor on human ß-cells negatively modulates insulin secretion. Diabetes 49:409–417[Abstract]
  26. Ferry S, Traiffort E, Stinnakre J, Ruat M 2000 Developmental and adult expression of rat calcium-sensing receptor transcripts in neurons and oligodendrocytes. Eur J Neurosci 12:872–884[CrossRef][Medline]
  27. Hobson SA, Wright J, Lee F, McNeil SE, Bilderback T, Rodland KD 2003 Activation of the MAP kinase cascade by exogenous calcium-sensing receptor. Mol Cell Endocrinol 200:189–198[CrossRef][Medline]
  28. Ward DT, McLarnon SJ, Riccardi D 2002 Aminoglycosides increase intracellular calcium levels and ERK activity in proximal tubular OK cells expressing the extracellular calcium-sensing receptor. J Am Soc Nephrol 13:1481–1489[Abstract/Free Full Text]
  29. Roussanne MC, Lieberherr M, Souberbielle JC, Sarfati E, Drueke T, Bourdeau A 2001 Human parathyroid cell proliferation in response to calcium, NPS R-467, calcitriol and phosphate. Eur J Clin Invest 31:610–616[CrossRef][Medline]
  30. Jones BH, Kim JH, Zemel MB, Woychik RP, Michaud EJ, Wilkison WO, Moustaid N 1996 Up-regulation of adipocyte metabolism by agouti protein: possible paracrine actions in yellow mouse obesity. Am J Physiol 270:E192–E196



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Molostvov, S. James, S. Fletcher, J. Bennett, H. Lehnert, R. Bland, and D. Zehnder
Extracellular calcium-sensing receptor is functionally expressed in human artery
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F946 - F955.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cifuentes, M.
Right arrow Articles by Rojas, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cifuentes, M.
Right arrow Articles by Rojas, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals