Endocrinology, doi:10.1210/en.2005-0430
Endocrinology Vol. 146, No. 10 4179-4188
Copyright © 2005 by The Endocrine Society
Dopamine, Dopamine D2 Receptor Short Isoform, Transforming Growth Factor (TGF)-ß1, and TGF-ß Type II Receptor Interact to Inhibit the Growth of Pituitary Lactotropes
D. K. Sarkar,
K. Chaturvedi,
S. Oomizu,
N. I. Boyadjieva and
C. P. Chen
Endocrinology Program, Biomedical Division of the Center of Alcohol Studies and Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, New Jersey 08901
Address all correspondence and requests for reprints to: D. K. Sarkar, Endocrinology Program, Biomedical Division of the Center of Alcohol Studies and Department of Animal Sciences, Rutgers, The State University of New Jersey, 84 Lipman Drive, New Brunswick, New Jersey 08901. E-mail: sarkar{at}aesop.rutgers.edu.
 |
Abstract
|
|---|
The neurotransmitter dopamine is known to inhibit prolactin secretion and the proliferation of lactotropes in the pituitary gland. In this study, we determined whether dopamine and TGFß1 interact to regulate lactotropic cell proliferation. We found that dopamine and the dopamine agonist bromocriptine stimulated TGFß1 secretion and TGFß1 mRNA expression but inhibited lactotropic cell proliferation both in vivo and in vitro. The dopamines inhibitory action on lactotropic cell proliferation was blocked by a TGFß1-neutralizing antibody. We also found that PR1 cells, which express low amounts of the dopamine D2 receptor, demonstrated reduced expression of TGFß1 type II receptor and TGFß1 mRNA levels and had undetectable levels of TGFß1 protein. These cells showed a reduced TGFß1 growth-inhibitory response. Constitutive expression of the D2 receptor short isoform, but not the D2 receptor long isoform, induced TGFß1 and TGFß1 type II receptor gene expression and recovered dopamine- and TGFß1-induced growth inhibition in PR1 cells. The constitutive expression of D2 receptor short isoform also reduced the tumor cell growth rate. These data suggest that a TGFß1 system may mediate, in part, the growth-inhibitory action of dopamine on lactotropes.
 |
Introduction
|
|---|
HYPERPROLACTINEMIA IS A CONDITION in which plasma prolactin (PRL) levels are elevated above normal, which results in amenorrhea, galactorrhea, and infertility in women and gynecomastia and reproductive dysfunction in men (1). Hyperprolactinemia is often associated with pituitary lactotrope adenomas, which are known as prolactinomas. Treatment with dopamine agonists in some patients reverses hyperprolactinemia (2). This reversal supports the notion, developed from experimental models, that prolactinoma formation results from a disruption in dopamine function (3, 4). How dopamine regulates lactotropic cell proliferation and tumor promotion is not well understood.
Dopamine has long been known as a physiological inhibitor of PRL secretion from lactotropes (5). Dopamine binds to D2 receptors that are coupled to pertussis toxin-sensitive Gi/Go proteins (6). The dopamine D2 receptor exists as two alternatively spliced isoforms, short (D2S) and long (D2L), both of which are expressed in lactotropes. The activation of Gi and Go heteromeric proteins causes activation of an inward rectifier potassium channel that leads to the inactivation of voltage-gated calcium channels, reduction in intracellular free calcium, and inhibition of PRL release (7). The activation of Gi/Go also leads to reduced activity of adenylyl cyclase and decreased production of cAMP (8), which activate cAMP response element-binding protein to induce PRL gene transcription (9, 10).
It has been shown that D2 receptor knockout mice develop prolactinomas with age (11, 12); dopamine transporter gene knockout mice show arrested lactotrope development (13), and D2S transgenic mice show lactotropic hypoplasia (14). Estradiol, which increases lactotropic cell proliferation and reduces dopamine receptor function (6), has recently been shown to decrease the release and synthesis of TGFß1 and its type II receptor (TßRII) in lactotropes (15, 16, 17). We have reported that rat lactotropic tumor-derived GH3 cells with low D2 receptor expression have reduced TGFß1 production and response (17). Additionally, it has been shown recently that developing prolactinomas in D2 receptor-deficient mice have altered expression of the TGFß1-related family of peptide bone morphogenic protein and noggin that transduce signals, like TGFß1, through phosphorylated mothers against decapentaplegic (Smad) (18). These results raise the possibility of an interaction between TGFß1 signaling and dopamine signaling because the peptide growth factor is known to inhibit hormone secretion and proliferation in lactotropes by an autocrine/paracrine mechanism (19) and because a loss of TßRII has been shown to increase the incidence of prolactinomas (20). Here we provide experimental evidence of a signaling cascade for lactotrope growth control involving dopamine, D2S receptor, TGFß1, and TßRII receptor.
 |
Materials and Methods
|
|---|
Animals
Female Fischer344 rats with a body weight of 160200 g, obtained from Simonsen Laboratories (Gilroy, CA), were housed in a controlled environment (temperature 22 C; lights on 05001900 h) and provided rodent chow meal and water ad libitum. Animals were ovariectomized bilaterally and sc implanted with a 1-cm estradiol-17ß (Sigma, St. Louis, MO)-filled 1-cm SILASTIC capsule (Dow Corning Corp., Midland, MI) using sodium pentobarbital anesthesia (4050 mg/kg, ip). Some of these animals were given daily sc injections of bromocriptine (4 mg/kg) or saline (0.1 ml) for 7 d. Animal surgery and care were performed in accordance with institutional guidelines and complied with National Institutes of Health policy. The animal protocol was approved by the Rutgers Animal Care and Facilities Committee.
Primary cultures of anterior pituitary cells
Anterior pituitaries from estradiol-treated ovariectomized Fisher 344 rats were dissociated and maintained in primary cultures as described by us previously (21). In one study, enriched lactotropic cells were prepared and maintained in cultures as previously described (22). Cells were maintained at 37 C in 7.5% CO2 for 72 h in fetal bovine serum (FBS) containing phenol red-free DMEM (Sigma) and then for 24 h in serum-free DMEM containing human transferrin (100 µM), insulin (5 µM), putrescence (1 µM), and sodium selenite (30 nM) before treatment with the tested agents. For the TGFß1 release studies, cultures were then treated with dopamine or bromocriptine for various time periods in the presence or absence of 10 nM of estradiol-17ß. For detection of TGFß1 levels, media were changed every 24 h. Media samples were collected and used for determination of TGFß1 levels. For cell proliferation studies, cultures were maintained for 96 h (media changed every 48 h) with 10 nM of estradiol-17ß in DMEM containing human transferrin (100 µM), insulin (5 µM), putrescence (1 µM), and sodium selenite (30 nM). Lactotropic cells in primary cultures do not proliferate without estradiol; therefore, a cell growth-response study could not be conducted in the absence of the steroid. Because lactotropic cells in primary cultures grow at a slow rate, it necessitated the use of a long-lasting dopaminergic agent, in this case bromocriptine, to determine the effect of dopamine on cell proliferation. Some of these cultures were used to determine the effect of immunoneutralization of TGFß1 using neutralizing antibody for TGFß1 (R&D Systems, Minneapolis, MN). A dose of 10 µg/ml of the TGFß1 antibody was employed because this dose of the antibody was previously used for a immunoneutralization study (22). The control group for the immunoneutralization study received 10 µg/ml of antirabbit
-globulin (Calbiochem, La Jolla, CA).
Transfected PR1 cell lines
The PR1 cell line was derived from a pituitary tumor of a Fischer-344 ovariectomized rat treated with estrogen for 3 months (17). PR1 cells were stably transfected with an expression vector, pcDNA 3.1 (Invitrogen, Carlsbad, CA), containing cDNA encoding the D2L (accession no. X17458) or the D2S (accession no. M36831) receptors for using the Lipofectamine reagent kit (Invitrogen). The transfection was performed following the manufacturers directions. Transfectants of PR1 cells containing the D2L or D2S receptors or the vector only were maintained in a 1:1 mixture of DMEM and Hams F-12 medium (DMEM/F-12; Sigma) containing 10% FBS and 800 µg/ml G-418 sulfate (Promega, Madison, WI) for selection of the transfected cells.
Cell proliferation response
Primary cultures of pituitary cells were mixed cells and required identification of cell proliferation in PRL-secreting cells. Hence, lactotropic cell proliferation was determined by identifying cells that displayed both bromodeoxyuridine (BrdU) and PRL immunoreactivities as described by us previously (21). BrdU is a marker of DNA synthesis; therefore, double-stained cells were considered proliferating lactotropes. Four hours before fixation with 99% ethanol, cultures were treated with 0.1 mM BrdU. Cells were incubated at 4 C overnight with BrdU monoclonal mouse IgG (1:200; Becton Dickinson Immunocytochemistry Systems, San Jose, CA) and stained using the Vectastain ABC kit (Vector Inc., Burlingame, CA) with diaminobenzadine as the chromagen. The cells were then incubated with PRL antibody [1:100,100 PRL-S9; National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)] at 4 C overnight and stained using the Vectastain ABC-AP kit (Vector). Negative controls were conducted by exposing cells to 3% normal serum from the host species rather than the primary antibody and also by preabsorbing the antibody with 100-fold excess antigen. Two investigators independently performed cell counts that involved counting five separate areas in each coverslip with approximately 500 total cells/area. Data were calculated as the percentage of total cells that were proliferating and are presented (see Figs. 2A
, 4A
, and 5
, A and C).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2. Stimulatory effects of the long-acting dopaminergic agent bromocriptine on the TGFß1 system in pituitary cells in primary cultures. A, Cells were treated with 0.1 µM bromocriptine or vehicle for 96 h, and proliferating lactotropes were determined using the BrdUrd assay (n = 6/group. *, P < 0.05, compared with vehicle-treated group. B and C, Primary cultures of pituitary cells were treated with 0.1 µM bromocriptine or vehicle for 96 h and assayed for TGFß1 mRNA (B) and TßRII mRNA (C) using the real-time RT-PCR (n = 45/group). *, P < 0.05, compared with vehicle.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4. TGFß1s mediation of bromocriptine inhibition of lactotropic cell proliferation in primary cultures. Cultures were treated with vehicle alone, 10 µg/ml TGFß1-neutralizing antibody (anti-TGFß1), 1 µM bromocriptine, 1 µM bromocriptine + 10 µg/ml antirabbit globulin (ARGG), or 1 µM bromocriptine + 10 µg/ml anti-TGFß1 for a period of 96 h to study cell proliferation (n = 69/group). *, P < 0.01, compared with the rest of the groups.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5. Reduced dopamine and TGFß1 response of PR1 cells. A, Comparison of the cell growth response of primary cultures of pituitary (PIT) cells and PR1 cells to various concentrations of bromocriptine treated for 96 h in the presence and/or absence of 10 ng/ml of estradiol-17ß (E2; n = 6/group). *, P < 0.05, compared with the 0 µM dose. **, P < 0.05, compared with other groups. B, Comparison of the cell growth response of PIT cells and PR1 cells to various doses of TGFß1 treated for 96 h in the presence and/or absence of 10 ng/ml of estradiol-17ß (E2) (n = 6/group). *, P < 0.05, compared with the 0 µM dose. **, P < 0.05, compared with other groups.
|
|
PR1 cells were all lactotrope-derived cells and did not require identification using PRL immunostaining. Therefore, in experiments in which only PR1 cells were used, proliferation of these cells was determined using [3H]thymidine incorporation methods (see Fig. 8
). Previously we have shown that both the BrdU and [3H]thymidine incorporation methods essentially identified similar changes of cell growth in lactotropes (23). The tritiated thymidine assay was conducted as we have previously described (23). In brief, PR1 cells containing vector only (V), D2S, and D2L cells (100,000/well) were grown in 96-well plates in 10% dextran-coated charcoal extracted FBS containing DMEM F12 medium. After 24 h of plating, the cells were treated with various concentrations of bromocriptine (0.011 µM) and incubated for 96 h. The cells were pulsed with 0.5 µCi [methyl-3H]thymidine (specific activity 82.2 C/mM; Amersham Corp., Arlington Heights, IL) per well during the last 1012 h. Cells were harvested using a cell harvester (Packard Bioscience, Meriden, CT) and counted in a liquid scintillation counter. Each experiment was conducted in duplicate or triplicate and repeated three times. The mean counts per minute ± SEM value (n = 6) of control cultures were 40096 ± 201 for V cells, 37083 ± 379 for D2S cells, and 40509 ± 324 for D2L cells.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 8. Recovery of dopamines and TGFß1s growth-inhibitory responses in PR1 cells stably transfected with the D2S receptor. PR1 cells were stably transfected with the native vector pcDNA 3.1 (V) or a vector containing a sequence that encodes the D2S or D2L dopamine receptor. The PR1 cells were maintained in serum-free defined medium at a cell density of 5 x 105 for 24 h before experimentation. A, Effect of different doses of bromocriptine treatment for 96 h on growth of V, D2L, and D2S cell lines. Data are mean ± SEM values of six cultures. *, P < 0.05, significantly different from the vehicle-treated D2S group; **, P < 0.05, significantly different from the 0.01 and 0.1 bromocriptine-treated D2S group. B, Effects of different doses of TGFß1 treatment for 96 h on growth of V, D2L, and D2S cell lines. Data are mean ± SEM values obtained from six cultures. *, P < 0.05, significantly different from the vehicle-treated D2S group.
|
|
Assays of PRL, TGFß1, and tissue total proteins
PRL levels in plasma were measured by RIA using NIDDK RIA kits, and the protocols have been previously described (17). The standard used was rPRL-RP-3. TGFß1 release from primary anterior pituitary cells and transfected PR1 cells was determined after incubating these cells in media containing serum supplement with or without a dopaminergic substance. The levels of TGFß1 protein in the pituitary tissue extracts or in the cell culture media were determined using a Quantakine ELISA kit (R&D Systems). The pituitary tissue samples were extracted with 4 mM HCl, 50 µg/ml bacitracin, 1 KU/ml trysalol, and 1% BSA before assay. The media samples were directly used in the assay. Total protein concentrations in cell lysates and pituitary extracts were determined using the Bio-Rad assay (Bio-Rad Laboratories, Hercules, CA) to calculate expression of total protein per microgram and used to normalize hormone values in the pituitary and culture samples. In some experiments, cell extracts were used for DNA estimation (23), and the values were used to normalize hormone secretion from the cells in cultures.
Detection of TGFß1, TGFß3, D2S, and D2L mRNA expression
The gene expression patterns of TGFß1, TGFß3, and D2 receptor mRNA were initially screened using the RT-PCR method. cDNA was prepared using random hexamer primers and the Superscript reverse transcriptase kit (Invitrogen) and using the methods described by the manufacturers. The sequence of the 5' forward primer of D2 receptor was TTCGAGCCAACCTGAAGACACCA, and the sequence of the 3' reverse primer was GCTTTCTGCCGCTCATCGTCTTAA. The sequence of the 5' forward primer of TGFß1 was GAATACAGGGCTTTCGCTTCA, and the sequence of the 3' reverse primer was CAGGAAGGGTCGGTTCATGT. The sequence of the 5' forward primer of TGFß3 was CACAGCACACAGTCCGCTACTT, and the sequence of the 3' reverse primer was CAGGCGTCCTCCCCAGAT. Measurement of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression as an internal standard for calibration was performed using a control reagent (PerkinElmer Applied Biosystems, Foster City, CA). The amplification conditions for PCR were described by us previously (21).
Measurement of TGFß1 and TßRII mRNA expression
Expression levels of TGFß1 and TßRII in cultured transfected cells were measured using quantitative real-time RT-PCR on an ABI PRISM 7700 sequence detector (PerkinElmer Applied Biosystems) with the florigenic 5' nuclease assay. This particular assay is based on the 5' nuclease activity of Taq DNA polymerase for fragmentation of a dual-labeled fluoro genic hybridization probe (24) and has been described by us previously (25). Total RNA (1 µg) was reverse transcribed into cDNA using the Superscript first-strand synthesis system for RT-PCR (Invitrogen) and then subjected to real-time PCR. The sequences of gene-specific primers were used as follows: 5'-FAM (carboxyfluorescein)-TCAGTCCCAAACGTCGAGGTGACCTG-TAMRA as a TaqMan probe for TGFß1, GAATACAGGGCTTTCGCTTCA as a 5' forward primer for TGFß1, and CAGGAAGGGTCGGTTCATGT as a 3' reverse primer for TGFß1; 5'-FAM-CAACCACAATACGGAACTGCTGCCC-TAMRA (carboxytetramethylrhodamine) as a TaqMan probe for TßRII, CTCTACGTGCGCCAACAACA as a 5' forward primer for TßRII receptor, and CTGCTTCAGCTTGGCCTTGTA as a 3' reverse primer for TßRII receptor. Relative quantification of mRNA samples was performed using the standard curve method as described by the manufacturer (PerkinElmer Applied Biosystems). The standard curves were prepared by a 5-fold serial dilution of the cDNA templates (250.008 ng total RNA). The threshold cycles were plotted against the log of the initial amount of the templates, which generated the linear standard curve. PCR were performed in a total volume of 25 µl with 1x TaqMan universal PCR mix, 0.2 µM each primer and probe, and 2 µl (5 ng) of the cDNA template. The reaction conditions were one cycle of a sequential incubation at 50 C for 2 min and 95 C for 10 min with 60 subsequent cycles of a consecutive incubation at 95 C for 15 sec and 60 C for 1 min. For the pituitary cells and pituitary tissues, the quantity of each sample was normalized to its GAPDH mRNA level, and for the PR1 cells, each was normalized to 18S ribosomal. Both were measured using the TaqMan control reagents (PerkinElmer Applied Biosystems).
Dopamine receptor binding
Cell membranes were prepared from enriched lactotropes (23) or PR1 cells stably transfected with pcDNA (vector only) or pcDNA containing D2L or D2S plasmids. Briefly, cell membranes were prepared by harvesting cells in 50 mM Tris-HCl (pH 7.5) and then homogenizing the cells using glass-glass homogenizer. Homogenate was centrifuged for 20 min at 4 C at 39,000 x g, and membrane pellets were resuspended in binding buffer [Tris-HCl (pH 7.5)]. Dopamine receptor binding assays were performed in duplicate using various concentrations of 3H-Spiperone (specific binding 118 Ci/mmol; Amersham Biosciences, Piscataway, NJ) as a radioligand and 1 µM butaclamol to define nonspecific binding. After a 1-h incubation at room temperature, reaction was terminated using rapid filtration through GF/C filters using a cell harvester (Packard Bioscience). The filters were air dried and counted in a ß-counter. Receptor binding data were analyzed by nonlinear regression using Prism 4.0 software (GraphPad, San Diego, CA).
Statistical analysis
The data shown in the figures and text are mean ± SEM. Comparisons between two groups were made using t tests. Data comparisons between multiple groups were made using one-way ANOVA. Student-Newmann-Keuls test was used as a post hoc test. A value of P < 0.05 was considered significant.
 |
Results
|
|---|
Dopamine and bromocriptine increase the release of TGFß1 in pituitary cells in primary cultures
We determined the effect of various concentrations of dopamine on TGFß1 release from pituitary cells in primary cultures. Treatment with dopamine at concentrations range of 0.05 and 5 µM (which is within the physiological dose range) (26, 27) for a period of 24 h dose-dependently increased TGFß1 release (Fig. 1A
). Dopamine also increased TGFß1 release after 48 h of treatment, although the TGFß1 response to the highest dose of dopamine was lower than that after 24 h of treatment. The catecholamine also increased TGFß1 release during a 2-h treatment period but with less potency (TGFß1, ng/ml; n = 56; control, 0.76 ± 0.08; 0.5 µM dopamine, 0.58 ± 0.1; 5.0 µM dopamine, 1.3 ± 0.01; P < 0.05, control vs. 5.0 µM dopamine). The long-lasting dopaminergic agent bromocriptine also increased TGFß1 release from the pituitary cells in a concentration-dependent manner between 24 and 96 h after the treatment (Fig. 1B
). Estradiol, which is known to reduce dopamine receptor function (25) and TGFß1 production in lactotropes (23), reduced the bromocriptines ability to increase TGFß1 release. These results suggest that dopaminergic agents are potent stimulators of TGFß1 release from the lactotropes.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1. Dopamine and bromocriptine effects on TGFß1 release from pituitary cells in primary cultures. A, Pituitary cells in primary cultures were treated with different doses of dopamine (050 µM) for 24 or 48 h. Media samples were collected at 24-h intervals, and media levels of TGFß1 were determined by ELISA (n = 4/group). *, P < 0.05, compared with the 0 µM dose. **, P < 0.05, compared with other groups. B, Pituitary cells in cultures were treated with various concentrations of bromocriptine (010 µM) with or without estradiol (E2, 10 nM) for 24, 48, or 96 h. Media samples were collected at 24-h intervals and used for measurements of TGFß1 (n = 4/group). *, P < 0.05, compared with the 0 µM dose. **, P < 0.05, compared with the group treated with a 0.01 µM concentration. a, P < 0.01, compared with the respective dose of bromocriptine alone.
|
|
Dopaminergic agent bromocriptines inhibition of lactotropic cell proliferation is associated with increased expression of TGFß1 in pituitary cells in primary cultures
Whether dopamine and TGFß1 interact to regulate lactotropic cell growth was studied in vitro using primary cultures of pituitary cells. Using a bromocriptine concentration of 0.1 µM, known to reduce estradiols cell proliferation action on lactotropes (28) and increase TGFß1 secretion from pituitary cells in primary cultures (Fig. 1B
), we found that treatment with this concentration of bromocriptine for a period of 96 h reduced the number of proliferating lactotropes (Fig. 2A
). We also measured the changes in mRNA levels of TGFß1 and TßRII after bromocriptine treatment in pituitary cells in primary cultures using real-time RT-PCR assay. Using this assay, we found that bromocriptine increased mRNA levels of both TGFß1 (Fig. 2B
) and its receptor TßRII in pituitary cells (Fig. 2C
). These data suggest that dopamine may interact with the TGFß1 system to control lactotropic cell proliferation.
Bromocriptines inhibition of lactotropic cell growth is associated with increased levels of TGFß1 and TßRII in the anterior pituitary
We further investigated TGFß1 and dopamine interaction on lactotropes in vivo, using a previously established animal model in which bromocriptine has been shown to inhibit the estradiol-induced increase in pituitary weight and plasma PRL (both of these are indirect measures of the pituitary lactotrope growth) in Fischer-344 rats (29). Consistent with these findings, we demonstrated that bromocriptine treatment reduced the plasma levels of PRL (control, 195 ± 48 ng/ml; bromocriptine, 22 ± 3 ng/ml; P < 0.001) and lowered the weights of the pituitaries in estradiol-treated rats (Fig. 3A
). Bromocriptine treatment also increased the pituitary levels of TGFß1 (Fig. 3B
) and TGFß1 mRNA (Fig. 3C
) and TßRII mRNA (Fig. 3D
). These in vivo data also suggest the possibility of involvement of TGFß1 in dopamine-regulated lactotropic cell growth.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3. Bromocriptines stimulatory effects on the pituitary TGFß1 system in vivo. Ovariectomized and estradiol-treated rats were given daily sc injections of bromocriptine (4 mg/kg) or saline (0.1 ml) for 7 d. Pituitary weight (A) and anterior pituitary levels of TGFß1 protein (B), TGFß1 mRNA (C), and TßR-II mRNA (D) were determined using the real-time RT-PCR assay (n = 46 rats/group). *, P < 0.05, compared with vehicle.
|
|
Antiproliferative effect of bromocriptine on lactotropic cells is prevented by the TGFß1-neutralizing antibody in primary cultures.
To determine whether TGFß1 mediates dopamines antiproliferative action on lactotropes, we determined the effect of a TGFß1 neutralizing antibody on bromocriptines action on cell growth in vitro. As shown in Fig. 4A
, treatment with 0.1 µM of bromocriptine reduced the percentage of proliferating lactotropes. A polyclonal antibody that neutralizes TGFß1 did not affect the basal cell proliferation but did prevent bromocriptines antiproliferative effect on lactotropes. Control cultures treated with antirabbit
globulin did not significantly affect the bromocriptine-inhibitory action on the growth of lactotrope. These data suggest that TGFß1 may mediate dopamines antiproliferative effect on lactotropes.
Antiproliferative effects of dopamine and TGFß1 are lost in TGFß1-deficient PR1 cells
To further determine dopamine-TGFß1 interaction in lactotropes, the actions of the dopaminergic agent bromocriptine on PRL release and on cell proliferation were determined in TGFß1-deficient PR1 cells. These cells are PRL secreting but express very low or undetectable quantity of TGFß1 protein and TGFß1 mRNA (17) and reduced amounts of TßRII mRNA and protein (21). The cell growth-reducing responses to bromocriptine and TGFß1 in PR1 and pituitary cells were compared. As expected, bromocriptine concentration-dependently inhibited the estradiol-induced cell growth of lactotropes in pituitary cells in primary cultures (Fig. 5A
). However, the same doses of bromocriptine that inhibited cell growth in primary pituitary cells failed to alter PR1 cell growth in the presence or absence of estradiol. The estradiol-induced growth of lactotropes was dose-dependently inhibited by TGFß1 in primary cultures of pituitary cells (Fig. 5B
). However, TGFß1 failed to inhibit the growth of PR1 cells in the presence or absence of estradiol. The parallel loss of the dopamine response and the TGFß1 response on cell growth in PR1 cells is consistent with the dopamine and TGFß1 interaction in the regulation of lactotropic cell proliferation.
Reduced TGFß1 and TßRII expression is associated with low expression of dopamine receptors in PR1 cells
Previously we have shown that TGFß1 is produced in lactotropes and acts to inhibit the growth of these cells via TßRII receptors (17, 21). However, PR1 cells do not produce TGFß1, and they show low levels of the TßRII receptor (21). Whether the reduced expression of TGFß1 and its receptors is associated with altered expression of dopamine D2 receptors was studied. The dopamine D2 receptor exists as two alternatively spliced isoforms, D2S and D2L, both of which are expressed in lactotropes (30). Determination of D2S and D2L mRNA transcript expression using RT-PCR indicated that primary pituitary cells express significant levels of both D2S and D2L transcripts, whereas PR1 cells show low or undetectable expression of these dopamine D2 receptor transcripts (Fig. 6A
). The maximal binding capacity (Bmax) and dissociation constant (Kd) values for dopamine D2 receptors in PR1 cells with a control vector were 38.4 ± 4 fmol/mg protein (n = 3) and 0.04 ± 0.02 nM (n = 3), and for enriched lactotropes they were 356 ± 29 (fmol/mg; n = 2) and 0.5 ± 0.1 (nM; n = 2), suggesting that the PR1 cells have very low amounts of D2 receptors.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6. Low expression of dopamine D2 receptor isoforms in PR1 cells. A, Representative gel figure showing low or undetected levels of D2S and D2L mRNA in PR1 cells as detected by RT-PCR. For comparison, the expression of D2S and D2L in pituitary cells (PIT) and PR1 cells stably transfected with the vector pcDNA 3.1 (V) or vectors containing a sequence that encodes the dopamine D2S or D2L are shown. For the loading controls, the levels of GAPDH mRNA were measured in the same cell samples and are shown in the bottom gel figure. The transcripts for D2L, D2S, and GAPDH are indicated on the right. The molecular-weight marker in base pairs is shown on the left of each gel. B, Saturation curves showing the 3H-Spiperone binding to the dopamine receptor in V, D2L, and D2S cells. Membrane preparation from V, D2L, and D2S cells was used for saturation binding of 3H-Spiperone. Data points are average of three separate experiments. Nonlinear regression analysis of curves yielded Kd and Bmax values presented in Table 1 .
|
|
Ligand-independent TGFß1 production was observed in PR1 cells stably transfected with D2S receptor
Studies were conducted to determine the role of D2 isoforms in dopamine-induced TGFß1 production by stably transfecting PR1 cells with an expression vector containing D2S or D2L. After selection by G418, two stable cell lines, PR1-D2S and PR1-D2L, were established. Transfected cells expressed the gene that had been introduced (Fig. 6A
). The D2 receptor levels in PR1 cells with control V or D2S or D2L gene were compared. D2S and D2L cells expressed 7- to 8-fold higher levels of D2 receptors than the control V cells (Fig. 6B
and Table 1
), suggesting that these cells were expressing D2 receptors.
The expressions of mRNA transcripts of two TGFß isoforms, TGFß1 and TGFß3, which are known to express in lactotropes (22), were screened using RT-PCR in V, D2S, and D2L cells. The mRNA transcripts for TGFß1 and TGFß3 were very low in PR1 cells transfected with the control vector or the D2L gene (Fig. 7A
). The mRNA transcript levels of TGFß1 but not TGFß3 were elevated in PR1 cells expressing D2S. Quantitation of TGFß1 mRNA levels using realtime-RT-PCR also showed significantly elevated expression of this gene in PR1 cells expressing D2S (Fig. 7B
). TGFß1 levels were measured in the culture media of each transfected cell, and only D2S-transfected PR1 cells secreted TGFß1 (Fig. 7C
). The TßRII gene expression in D2S-transfected cells was higher than in control V-transfected cells and D2L-transfected cells (Fig. 7D
). D2S-transfected cells also had higher basal TGFß1 mRNA levels than did D2L and vector-transfected cells (Fig. 7D
). Bromocriptine significantly increased TGFß1 gene expression and TGFß1 secretion in D2S-transfected cells but not D2L-transfected or control V-transfected cells.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 7. Ligand-independent TGFß1 production in PR1 cells stably transfected with the D2S receptor. TGFß1-deficient PR1 cells were stably transfected with the vector pcDNA 3.1 (V) or vectors containing a sequence that encodes the dopamine D2S or D2L. These cells were maintained in serum-free defined medium at a cell density of 5 x 105 for 24 h before experimentation. Cultures were then fed fresh medium and maintained for an additional 24 h in the presence or absence of 1 µM of bromocriptine to determine TGFß1 and TßRII mRNA expression and protein secretion. Whether D2 receptor expression alters other isoforms of TGFß was also tested by determining the mRNA levels of TGFß3 in D2 receptor or vector gene-transfected PR1 cells. A, Representative gel figure showing the levels of TGFß1 mRNA (top), TGFß3 mRNA (middle), and GAPDH (bottom) in the same sample of PR1 cells containing V, D2S, or D2L as detected by RT-PCR. B, Detection of TGFß1 mRNA levels using quantitative real-time PCR in V, D2S, and D2L cells with or without 1 µM of bromocriptine for 24 h (n = 6). *, P < 0.05, significantly different from the rest of the groups; **, P < 0.05, significantly different from the vehicle-treated D2S group. C, Detection of TGFß1 levels using ELISA in the media collected from V, D2S, and D2L cells treated with or without 1 µM of bromocriptine for 24 h. The level of TGFß1 was detectable only in D2S cells. *, P < 0.05, significantly different from the vehicle-treated D2S group. D, Measurement of TßRII mRNA levels using quantitative real-time PCR in V, D2S, and D2L cells. *, P < 0.05, significantly different from V cells; **, P < 0.05, significantly different from D2L cells.
|
|
Recovery of TGFß1s growth-inhibitory responses in PR1 cells stably transfected with D2S receptor
The aforementioned study using a TGFß1 neutralizing antibody suggested the possibility of TGFß1 mediation of dopamines action on lactotropic cell proliferation. Additional evidence resulted from the above demonstrations that PR1 cells with reduced D2 receptors also had abnormal functioning of the TGFß1 system and a decrease in TGFß1s and dopamines growth-inhibitory responses. Hence, we tested whether the recovery of the TGFß1 and TßRII gene expression after D2S transfection results in recovery of the dopamine and TGFß1 actions on cell growth. The D2S-transfected cells, but not the control and D2L-transfected cells, showed negative growth responses to bromocriptine (Fig. 8A
) and to TGFß1 (Fig. 8B
). Additionally, D2S-transfected cells showed lower cell growth rates (Fig. 9
). Together these data suggest that D2S receptor activation leads to increased production and action of TGFß1, and possibly decreased cell growth rate in PR1 cells.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 9. Reduced cell growth rate in PR1 cells stably transfected with the D2S receptor. Comparison of the cell growth rates of V, D2S, and D2L cell lines. *, P < 0.05, significantly different from the V and D2L groups on the same day. Data are mean ± SEM values of six cultures.
|
|
 |
Discussion
|
|---|
Dopamine plays a key role in maintaining the normal function of lactotropes in the pituitary gland. Abnormalities in dopamine receptors and dopamine transporter function lead to lactotropes hyperplasia and tumors (11, 12, 13, 14). The cellular mechanism by which dopamine controls lactotropic cell proliferation is of interest because prolactinomas frequently occur in humans. Data presented in this study show, for the first time, that dopamine and the dopamine agonist bromocriptine stimulated TGFß1 expression and secretion in vivo and in vitro. We have also shown that dopamines inhibitory action on lactotropic cell growth was blocked by a TGFß1-neutralizing antibody and was lost in transformed lactotropes (PR1 cells) in which TGFß1 and its receptor expressions were repressed. Additionally, data are presented to show that constitutive expression of the dopamine D2S receptor up-regulated TGFß1 expression and action. It also caused a reduction in the cell proliferation rate in transformed lactotropes. These data suggest that dopamines inhibitory action on lactotropic cell growth may be mediated partly by TGFß1 in lactotropes.
Dopamine and the dopaminergic agent bromocriptine produced dose-response release of TGFß1 from pituitary cells. The TGFß1-inducing response of the high dose of dopamine in pituitary cells was reduced after continuous exposure of the neurotransmitter for a period of 48 h. This reduction in the TGFß1-inducing response of the high dose of dopamine may not be due to decrease in dopamines half-life, which is more than 48 h (31). TGFß1-inducing response of bromocriptine from pituitary cells was also reduced after 96 h of exposure. Hence, the reduced TGFß1-releasing response of dopaminergic agents after long-term treatment might be related to desensitization of D2 receptors on lactotropes (32).
Data presented here show that dopaminergic agent inhibition of lactotropic cell growth is reduced by a TGFß1-neutralizing antibody. These data are in agreement with those showing that combined administration of maximal doses of TGFß1, and dopamine in rat anterior pituitary cells does not lead to greater suppression of lactotropic hormone secretion when compared with doses of dopamine alone (33). This suggests the possibility that both dopamines and TGFß1s inhibitory actions on lactotropes share a common mechanism.
Our study with stably transfected PR1 cells with D2S and D2L cDNA identified D2S receptor-specific TGFß1 signaling. D2S-transfected cells also had higher basal TGFß1 mRNA levels. As described by an extended allosteric ternary complex model of G protein-coupled receptor activation, receptors spontaneously isomerize between active and inactive conformations, so receptors can modulate signaling pathways in the absence of an agonist. In addition, significant constitutive activity of recombinant D2S receptors expressed in mammalian cells has been described previously (34). These data suggest that ligand-independent TGFß1 production was due to constitutively activated D2S receptors in transfected cells. PR1 cells that lacked functional D2 receptors and had a dysfunctional TGFß1 system also showed significant recovery of the TGFß1 function after D2S transfection. The D2L-transfected cells showed either partial or no recovery of TGFß1 function. These data support a preference of D2S over D2L in TGFß1 activation.
It is well known that estradiol inhibits dopamine release from the hypothalamus and down-regulates dopamine receptor activity in lactotropes (4, 6, 25). Data presented in this report indicate that TGFß1 levels were elevated by dopamine. Also, TGFß1 and TßRII levels decreased after estradiol treatment (16, 17). Thus, by inhibiting dopamine secretion and thereby inhibiting D2 receptor activation, estradiol could inhibit TGFß1 expression and action. Interestingly, estradiol increases the D2L to D2S ratio in lactotropes and the lactotrope-derived MMQ cell line (24, 35). Similarly, ethanol treatment increases lactotropic cell proliferation, increases the D2L to D2S ratio and decreases TGFß1 expression (24). This reported evidence is in agreement with our present data that D2S overexpression enhances TGFß1 production and release and also increases TßRII receptor expression.
Dopamine D2 receptor activation in lactotropes leads to the alteration of G protein coupling, inhibition of adenylyl cyclase, and reduction of intercellular cAMP (36, 37). Although the sequence of the TGFß1 promoter contains no element similar to the cAMP-responsive element core sequence, the TGFß1 promoter contains several activator protein-2-like sequence elements that could potentially mediate the cAMP response (38). Additionally, cAMP analogs inhibit TGFß1 gene transcription in the pituitary (39). Hence, it is possible that cAMP-dependent mechanisms may be involved in dopamine regulation of TGFß1. Studies involving the cAMP and its analogs actions on TGFß1 and D2 receptors may provide further understanding of dopamines regulation of TGFß1 release.
In addition to inhibition of the cAMP system, dopamine receptors have been shown to regulate other transduction pathways that lead to alteration of intracellular calcium, protein kinase C, and the MAPK pathway (6, 14, 36, 37, 40). The data presented here identify a role of D2S receptor-specific action on the TGFß1 system and the cell growth cycle in lactotropes. It has recently been shown that transgenic mice, overexpressing D2S but not D2L, show pituitary hypoplasia; the D2S-overexpressing mice also showed increased phosphorylated MAPK (14). The MAPK system has also shown to be involved in TGFß1-activated signaling in various cell types (41, 42). Hence, the possibility that the MAPK pathway is involved in dopamine-TGFß1 interaction mechanisms needs to be investigated.
Estrogen is known to reduce both the levels of dopamine and dopamine D2 receptor activity in lactotropes (4, 25, 43, 44). Thus, by inhibiting dopamine, estrogen could inhibit TGFß1 and its receptor expression. Indeed, this association has been observed in our previous study with long-term estrogen treatment (17). In addition, we have observed that GH3 cells that have reduced functional dopamine D2 receptors have a low TGFß1 response and low TGFß1 and TßRII production (17). In the present study, PR1 cells, which did not respond to TGFß1 and did not express detectable TGFß1 or TßRII, showed a lack of dopamine response and dopamine receptor binding. Hence, we propose that during sustained exposure, estrogen cancels the inhibitory effect of dopamine and thereby down-regulates TGFß1s inhibitory effect on cell proliferation. This may cause an alteration in the balance between positive and negative regulators of cell growth, resulting in abnormal lactotropic cell proliferation.
In summary, this report provides the first direct evidence for the involvement of TGFß1 and its receptor TßRII in dopamines growth-suppressing action on lactotropes. This report also shows for the first time that the dopamine D2 receptors splice variant D2S activates TGFß1-TßRII signaling to inhibit lactotropic cell proliferation (Fig. 10
). Although the mechanism by which D2S receptor activation increases TGFß1 production and TßRII receptor activation is not determined, the literature suggests a possible involvement of a negatively coupled cAMP system in this process. The identification of TGFß1 mediation of dopamine action provides a novel possibility to consider the TGFß1-TßRII signaling as a molecular target for treating prolactinomas.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 10. A diagram summarizing the postulated role of TGFß1 signaling in mediation of dopamine action on lactotropic cell proliferation. It is hypothesized that dopamine activates dopamine D2 receptors splice variant D2S to increase the production of TGFß1 and the production and activation of TßRII. Activated TßRII by dimerizing with TGFß receptor type I (TßRI) induces cell signaling to inhibit cell cycle progression and lactotropic cell proliferation.
|
|
 |
Acknowledgments
|
|---|
The authors thank Tanya Howard for her technical help, Dr. Deepthi Reddy for her assistance in molecular biology and cell culture work, Alok De for his assistance in animal work, and the NIDDK for providing PRL RIA kits and the PRL antibody for immunocytochemistry.
 |
Footnotes
|
|---|
This work was supported by National Institutes of Health Grants AA 11591 and CA 77550.
First Published Online June 16, 2005
Abbreviations: Bmax, Binding capacity; BrdU, bromodeoxyuridine; D2L, D2 receptor long isoform; D2S, D2 receptor short isoform; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Kd, dissociation constant; PRL, prolactin; TßRII, TGFß type II receptor; V, PR1 cells containing vector only.
Received April 13, 2005.
Accepted for publication June 6, 2005.
 |
References
|
|---|
- MacLeod RM, Scapagnini U, Thorner MO 1980 Pituitary microadenomas. New York: Academic Press; 683855
- Tonner D, Schlechte J 1993 Contemporary therapy of prolactin-secreting adenomas. Am J Med Sci. 306:395397
- Colao A, Annunziato L, Lombardi G 1998 Treatment of prolactinomas. Ann Med. 30:452459
- Sarkar DK, Gottschall PE, Meites J 1982 Damage to hypothalamic dopaminergic neurons is associated with development of prolactin-secreting pituitary tumors. Science 218:684686[Abstract/Free Full Text]
- Asa SL, Kelly MA, Grandy DK, Low ML 1999 Pituitary lactotroph adenomas develop after prolonged lactotroph hyperplasia in dopamine D2 receptor-deficient mice. Endocrinology 140:53485355[Abstract/Free Full Text]
- Ben-Jonathan N, Hnasko R 2001 Dopamine as a prolactin (PRL) inhibitor. Endocr Rev. 22:724763
- Enjalbert A, Musset F, Chenard C, Priam M, Kordon C, Heisler S 1988 Dopamine inhibits prolactin secretion stimulated by the calcium channel agonist Bay-K-8644 through a pertussis toxin-sensitive G protein in anterior pituitary cells. Endocrinology 123:406412[Abstract]
- Gregerson KA, Flagg TP, ONeill TJ, Anderson M, Lauring O, Horel JS, Welling PA 2001 Identification of G protein-coupled, inward rectifier potassium channel gene products from the rat anterior pituitary gland. Endocrinology 142:28202832[Abstract/Free Full Text]
- Taussig R, Gilman AG 1995 Mammalian membrane-bound adenylyl cyclases. J Biol Chem. 270:14
- Yan G, Chen X, Bancroft C 1994 A constitutively active form of CREB can activate expression of the rat prolactin promoter in non-pituitary cells. Mol Cell Endocrinol. 101:R25R30
- Kelly MA, Rubinstein M, Asa SL, Zhang G, Saez C, Bunzow JR, Allen RG, Hnasko R, Ben-Jonathan N, Grandy DK, Low MJ 1997 Pituitary lactotroph hyperplasia and chronic hyperprolactinemia in dopamine D2 receptor-deficient mice. Neuron. 19:103113
- Saiardi A, Bozzi Y, Baik JH, Borrelli E 1997 Antiproliferative role of dopamine: loss of D2 receptors causes hormonal dysfunction and pituitary hyperplasia. Neuron. 19:115126
- Bosse R, Fumagalli F, Jaber M, Giros B, Gainetdinov RR, Wetsel WC, Missale C, Caron MG 1997 Anterior pituitary hypoplasia and dwarfism in mice lacking the dopamine transporter. Neuron. 19:127138
- Laccarino C, Samad TK, Mathis C, Kercret H, Picetti R, Borrelli E 2002 Control of lactotrope proliferation by dopamine: essential role of signaling through D2 receptors ERKs. Proc Soc Nat Acad Sci USA. 99:1453014535
- Sarkar DK, Kim KH, Minami S 1992 Transforming growth factor-ß1 mRNA and protein expression in the pituitary gland: its action on prolactin secretion and lactotropic growth. Mol Endocrinol. 6:18251833
- De A, Morgan TE, Speth RC, Boyadjieva N, Pastorcic M, Sarkar DK 1996 Pituitary lactotrope expresses TGFß type II receptor mRNA and protein and contains [125]TGFß1-binding sites. J Endocrinol. 149:1927
- Pastorcic M, De A, Boyadjieva N, Vale W, Sarkar DK 1995 Reduction in the expression and action of transforming growth factor ß1 on lactotropes during estrogen-induced tumorigenesis in the anterior pituitary. Cancer Res. 55:48924898
- Páez-Pereda M, Giacomini D, Refojo D, Nagashima AC, Hopfner U, Grübler Y, Chervin A, Goldberg V, Goya R, Hentges S, Low M, Holsboer F, Stalla GK, Artz E 2003 Involvement of bone morphogenetic protein 4 (BMP-4) in pituitary prolactinoma pathogenesis through a Smad/estrogen receptor crosstalk. Proc Soc Natl Acad Sci USA. 100:10341039
- Hentges S, Sarkar DK 2001 Transforming growth factor-ß regulation of estradiol-induced prolactinomas. Front Neuroendocrinol. 22:340363
- Shida N, Ikeda H, Yoshimoto T, Oshima M, Taketo MM, Miyoshi I 1998 Estrogen-induced tumorigenesis in the pituitary gland of TGFß(+/) knockout mice. Biochim Biophys Acta. 1407:7983
- Sarkar DK, Pastorcic M, De A, Engel M, Moses H, Ghasemzadeh MB 1998 Role of TGFß type I and TGFß type II receptors in the TGFß1-regulated gene expression in pituitary prolactin-secreting lactotropes. Endocrinology. 138:36203628
- Hentges S, Pastorcic M, De A, Boyadjieva N, Sarkar DK 2000 Opposing actions of two transforming growth factor-ß isoforms on pituitary lactotropic cell proliferation. Endocrinology 141:15281535[Abstract/Free Full Text]
- Hentges S, Boyadjieva N, Sarkar DK 2000 Transforming growth factor-ß3 stimulates lactotrope cell growth by increasing basic fibroblast growth factor from folliculo-stellate cells. Endocrinology 141:859867[Abstract/Free Full Text]
- Heid CA, Stevens J, Livak KJ, Williams PM 1996 Real time quantitative PCR. Genome Res. 6:986994
- Oomizu S, Boyadjieva N, Sarkar DK 2003 Ethanol and estradiol modulate alternative splicing of dopamine D2 receptor mRNA and abolish the inhibitory action of bromocriptine on prolactin release from the pituitary gland. Alcohol Clin Exp Res. 27:975980
- Plotsky PM, Gibbs DM, Neill JD 1978 Liquid chromatographic-electrochemical measurement of dopamine in hypophysial stalk blood of rats. Endocrinology. 102:18871894
- Close FT, Freeman ME 1997 Effects of ovarian steroid hormones on dopamine-controlled prolactin secretory response in vitro. Neuroendocrinology. 65:430435
- Johansen PW, Haug E, Gautvik KM 1985 Effects of bromocriptine on hormone production and cell growth in cultures rat pituitary cells. Acta Endocrinol (Copenh). 110:200206
- Gruszka A, Pawlikowski M, Kunert-Radek J 2001 Anti-tumoral action of octreotide and bromocriptine on the experimental rat prolactinoma: anti-proliferative and pro-apoptotic effects. Neuroendocrinol Lett. 22:343348
- Missale C, Nash SR, Robinson SW, Jaber M, Caron MG 1998 Dopamine receptors: from structure to function. Physiol Rev. 78:189225
- Coya R, Alvarez CV, Perez F, Gianzo C, Dieguez C 1999 Effects of TGFß1 on prolactin synthesis and secretion: an in vitro study. J Neuroendocrinol. 11:351360
- Geyer SJ, Schanberg SM 1982 Dopamine ß-hydroxylase: determination of half-life and appearance in lymph fluid after IV injection of 125 I-DBH into rats. Life Sci. 30:10871100
- Barton AC, Black LE, Sibley DR 1991 Agonist-induced desensitization of D2 dopamine receptors in human Y-79 retinoblastoma cells. Mol Pharmacol. 39:650658
- Wiens BL, Nelson CS, Neve KA 1998 Contribution of serine residues to constitutive and agonist-induced signaling via the D2S dopamine receptor: evidence for multiple, agonist-specific active conformations. Mol Pharmacol. 54:435444
- Guivarch D, Vincent JD, Vernier P 1998 Alternative splicing of the D2 dopamine receptor messenger ribonucleic acid is modulated by activated sex steroid receptors in the MMQ prolactin cell line. Endocrinology. 139:42134221
- Enjalbert A, Bockaert J 1983 Pharmacological characterization of the D2 dopamine receptor negatively coupled with adenylate cyclase in rat anterior pituitary. Mol Pharmacol. 23:576584
- Martinez de la Escalera G, Guthrie J, Weiner RI 1988 Transient removal of dopamine potentiates the stimulation of prolactin release by TRH but not VIP: stimulation via Ca2+/protein kinase C pathway. Neuroendocrinology. 47:3845
- Geiser AG, Kim SJ, Roberts AB, Sporn MB 1991 Characterization of the mouse transforming growth factor-ß1 promoter and activation by the Ha-ras oncogene. Mol Cell Biol. 11:8492
- Pastorcic M, Sarkar DK 1997 Down-regulation of TGFß1 gene expression in anterior pituitary cells treated with forskolin. Cytokine. 9:106111
- Takeuchi Y, Miyamoto E, Fukunaga K 2002 Activation of the rat dopamine D2 receptor promoter by mitogen-activated protein kinase and Ca2+/calmodulin-dependent protein kinase II pathways. J Neurochem. 83:784796
- Chaturvedi K, Sarkar DK 2004 Involvement of PKC dependent p44/42 MAP kinase signaling pathway for cross-talk between estradiol and TGFß3 in increasing bFGF in folliculostellate cells. Endocrinology 145:706715[Abstract/Free Full Text]
- Nagineni CN, Samuel W, Nagineni S, Pardhasaradhi K, Wiggert B, Detrick B, Hooks JJ 2003 Transforming growth factor-ß induces expression of vascular endothelial growth factor in human retinal pigment epithelial cells: involvement of mitogen-activated protein kinases. J Cell Physiol. 197:453462
- Labrie F, Beaulieu M, Caron MG, Raymond V 1978 The adenohypophyseal dopamine receptor: specificity and modulation by estradiol. In: Robin C, Harter M, eds. Progress in prolactin physiology and pathology. Amsterdam: Elsevier/North-Holland; 121132
- Raymond V, Beaulieu M, Labrie F 1978 Potent antidopaminergic activity of estradiol at the pituitary level on prolactin release. Science 200:11731175[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. C. Zatelli, M. R. Ambrosio, M. Bondanelli, and E. C d. Uberti
Control of pituitary adenoma cell proliferation by somatostatin analogs, dopamine agonists and novel chimeric compounds
Eur. J. Endocrinol.,
April 1, 2007;
156(suppl_1):
S29 - S35.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ben-Jonathan
Dopamine and Transforming Growth Factor-{beta}1: An Odd Couple in Growth Inhibition of the Lactotrophs
Endocrinology,
October 1, 2005;
146(10):
4177 - 4178.
[Full Text]
[PDF]
|
 |
|