Endocrinology, doi:10.1210/en.2004-0081
Endocrinology Vol. 145, No. 8 3626-3629
Copyright © 2004 by The Endocrine Society
Do Human Vascular Endothelial Cells Produce Aldosterone?
Naveed Ahmad,
Damian G. Romero,
Elise P. Gomez-Sanchez and
Celso E. Gomez-Sanchez
Division of Endocrinology and Research Service, G.V. (Sonny) Montgomery Veterans Affairs Medical Center and University of Mississippi Medical Center, Jackson, Mississippi 39216
Address all correspondence and requests for reprints to: Elise P. Gomez-Sanchez, D.V.M., Ph.D., Division of Endocrinology, University of Mississippi Medical Center, 2500 North State Street, Jackson, Mississippi 39216. E-mail: elise.gomezsanchez{at}med.va.gov.
 |
Abstract
|
|---|
Extraadrenal production of aldosterone has been reported in several tissues, including vascular endothelial cells. The implications of local production of aldosterone in certain nonepithelial target tissues in normal and pathological physiology could be very important and merits further investigation. Human vascular endothelial cells have been reported to synthesize aldosterone under the regulation of angiotensin II. However, discrepancies are noted upon close scrutiny, the most important of which are the relative large efficiency of deoxycorticosterone conversion to aldosterone and the rate of aldosterone production in comparison to the adrenal zona glomerulosa cells. We investigated the production of aldosterone in three different human vascular endothelial cell lines, two from human umbilical veins, one from human pulmonary artery endothelial cells using a very sensitive ELISA method. Cells were incubated with the secretagogues angiotensin II, ACTH, and K+, at various physiological concentrations with and without 1 µM deoxycorticosterone as additional substrate. In addition, RT-PCR was used to detect expression of the mRNA for the aldosterone synthase gene using a protocol developed by us that detects very low expression in subregions of the human brain. Our results failed to demonstrate mRNA for the aldosterone synthase gene or aldosterone biosynthesis in human endothelial cells.
 |
Introduction
|
|---|
ALDOSTERONE, THE MOST important mineralocorticoid, acts by binding specific receptors in target epithelia such as that of the kidney tubule, colon, and salivary gland and promoting the vectorial transfer of sodium (1). The mechanisms of action of aldosterone in nonepithelial target organs are not as clearly understood. Excess secretion of aldosterone causes hypertension and cardiac fibrosis and hypertrophy. Aldosterone is also involved in the pathogenesis of sodium retention in patients with congestive heart failure (2, 3). Aldosterone is produced in the zona glomerulosa of the adrenal cortex by a series of enzymatic reactions from cholesterol. The last enzyme in the biosynthetic pathway is the cytochrome P-450 CYP11B2 or aldosterone synthase, which successively hydroxylates deoxycorticosterone into corticosterone, 18-hydroxycorticosterone, and aldosterone (4). This enzyme undergoes transcriptional regulation when the pathway is stimulated by angiotensin II (Ang II), the most important zona glomerulosa secretagogue (5, 6). The biosynthesis of aldosterone was believed to only occur in the zona glomerulosa of the adrenal; however, Takeda and colleagues (7, 8, 9, 10, 11) demonstrated the production of corticosterone and aldosterone in the mesenteric artery, human endothelial cells, and vascular smooth muscle cells in culture. Subsequently, the biosynthesis of aldosterone and corticosterone was demonstrated in perfused rat hearts (12, 13, 14) and in the central nervous system (15, 16). Aldosterone synthase in endothelial cells was reported to convert deoxycorticosterone (DOC) to aldosterone efficiently and to be regulated by Ang II, ACTH, and potassium (K+) in a dose-responsive manner (17).
The apparent similarity in the regulation of aldosterone secretion between the adrenal zona glomerulosa cells and endothelial cells raised the possibility that these cells could be very useful for the study of signal transduction pathways leading to aldosterone secretion. Because there were many unanswered questions, primarily of steroid quantification, in the several reports of aldosterone biosynthesis in human endothelial cells and in the unusually high efficiency of the transformation of DOC to aldosterone, we studied human umbilical vein endothelial cells (HUVECs) and human pulmonary artery endothelial cells (HPAECs) using a protocol and cells similar to that reported (17). Much to our chagrin, our results failed to demonstrate aldosterone biosynthesis in human endothelial cells.
 |
Materials and Methods
|
|---|
Endothelial cell culture
Two sources of HUVECs were used. The initial endothelial cells were kindly provided by Dr. Jian-Wei Gu (Department of Physiology, University of Mississippi Medical Center) and were of an unknown passage. They were grown in six-well plates (Corning Inc., Corning, NY) using a culture media composed of 45% DMEM, 45% Medium 199 (Invitrogen Life Technologies, Grand Island NY) and 10% FBS (fetal bovine serum, Hyclone, Logan, UT). A second source of HUVECs was from Clonetics (Walkersville, MD). These were grown in six-well plates (Corning) using endothelial cell growth media that came with the cells and used from passages 57. We also used HPAECs obtained from ATCC (Manassas, VA) and grown in six-well plates (Corning) in growth media containing F-12 K Media (Kraigns modification of Hams F-12 media; Invitrogen Life Technologies) + 20% FBS (Hyclone). The experiment with these cells was started when they were in their 14th passage.
Production of aldosterone by endothelial cells incubated with Ang II, ACTH, potassium, and deoxycorticosterone
After the cells had reached confluence, they were incubated in triplicate with Ang II (106108 M), ACTH (1081010 M), and K+ (79 mM) in the respective incubation media without FBS (endothelial cell basal media without hydrocortisone in the case of cells from Clonetics) for 24 h. The media were then collected and replaced with incubation media containing 1 µM deoxycorticosterone in addition to new Ang II, ACTH, or K+ as above. After incubating for another 24 h, the incubation media were collected. The wells were then trypsinized and cells counted for use in the calculations.
HUVECs from Clonetics were also cultured in 175-cm2 flasks, and the supernatant was extracted as described below.
Aldosterone measurements
The media were extracted using Bond Elut Extraction Cartridge (Varian, Harbor City, CA) that had been washed with dichloromethane and methanol followed by equilibration with purified water. After passing the media through the cartridge, it was washed with distilled water, and then the steroid was eluted with dichloromethane and collected into silanized tubes (chlorotrimethylsilane; Sigma-Aldrich, St. Louis, MO). The dichloromethane extract was washed with distilled water, evaporated under dry air and reconstituted in 200 µl of ELISA buffer (PBS + 0.5% BSA). The assay was done with 50 µl of the reconstituted extract. The recovery of the steroids by this procedure using tritiated aldosterone was found to be approximately 92%. The ELISA for aldosterone was done using a very specific and sensitive monoclonal antibody and a biotin-avidin peroxidase system as described by us (18, 19). The blank of the system was indistinguishable from zero, the sensitivity of the ELISA was 1 pg/well (2.76 fmol/well), and the interassay variability was approximately 10%. All samples from an experiment were measured in the same assay.
RT-PCR of CYP11B2 RNA from HUVECs and HPAECs
HUVECs were grown in two 175-cm2 tissue culture flasks (Greiner, Longwood, FL) until confluent. The media in the first flask was replaced with serum-free media, and this served as the control. The cells in the second flask were incubated with serum-free media containing Ang II 107 mmol/liter. After 24 h of incubation, the media were removed and cells were lysed for total RNA using Ultraspec-II RNA Isolation System (Biotecx Laboratories, Inc., Houston, TX). HPAECs were grown and incubated similarly, but mRNA was Isolated using MicroPoly (A) Pure mRNA Purification Kit (Ambion, Austin, TX).
First-strand cDNA was synthesized using Superscript II RNase H reverse transcriptase from Invitrogen Life Technologies. The cDNA was used in PCR. The sequence of primers for CYP11B2 was B2-S: TACAGGTTTTCCTCTACTCG, B2-AS: AGATGCAAGACTAGTTAATC, ß- actin-S: GGGAAATCGTGCGTGACATTAAG, ß-actin-AS: TGTGTTGGCGTACAGGTCTTTG. The samples were then subjected to 30 and 50 cycles; only 25 cycles were used for ß-actin. Positive controls included mRNA from tissues with a low abundance of message for the aldosterone synthase, the human corpus callosum and thalamus, and from whole adrenal glands. The negative controls were RT-PCRs done in the absence of RT.
 |
Results
|
|---|
No aldosterone production by HUVECs from either source or the HPAECs was detected after control incubations or stimulation with the various secretagogues. Because HPAECs were reported to not express the cytochrome P450 side chain cleavage enzyme, we incubated both umbilical vein and pulmonary artery endothelial cells with 1 µM DOC in the presence of Ang II, ACTH, or K to stimulate CYP11B2 gene transcription, but again, no aldosterone was produced. These studies were done in six-well plates containing between 400600,000 cells per well. To be certain that the problem was not that of a very low production rate of aldosterone, we also did the studies in 175-cm2 flasks containing approximately 20 million cells per flask, and stimulated with Ang II, but again could not demonstrate the production of aldosterone.
RT-PCR using specific primers with total RNA or mRNA also failed to demonstrate bands corresponding to the aldosterone synthase even after 50 cycles of PCR (Figs. 1
and 2
). As controls, human corpus callosum and thalamus mRNA was used. Although no bands were seen at 30 cycles, strong appropriate bands were obtained at 50 cycles. Whole adrenal mRNA gave strong bands as expected at 30 cycles.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1. RT-PCR for the aldosterone HUVECs previously incubated with and without Ang II (107 M). PCR was done for 30 and 50 cycles. Controls included mRNA obtained from corpus callosum, thalamus, and adrenal. A-II, Ang II.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2. RT-PCR (50 cycles) from mRNA from HPAECs incubated with and without Ang II (107 M). Controls included mRNA obtained from thalamus and adrenal. Negative control included similar incubation of samples prepared without using reverse transcriptase (RT). A-II, Ang II; HPEC, HPAEC.
|
|
 |
Discussion
|
|---|
The combined mass of vascular endothelial cells throughout the body is much greater than that of the adrenal zona glomerulosa. Therefore, the implications of the reports of efficient production of a hormone by this organ are very great and merited further study. We used a very sensitive ELISA for aldosterone to detect the secretion into the culture media by HUVECs from two different sources and by HPAECs but were unable to detect the presence of aldosterone. We were also unable to detect the mRNA for the CYP11B2 enzyme (aldosterone synthase) even after 50 cycles of PCR, whereas we were able to easily detect the CYP11B2 enzyme mRNA from concurrently run samples of human corpus callosum and thalamus, known to express low levels of the CYP11B2, as we have previously reported (20). Furthermore, in our studies stimulation of endothelial cells with Ang II and in the presence of DOC to ensure adequate substrate for the aldosterone synthase enzyme failed to demonstrate the conversion of DOC into aldosterone. These results are in disagreement with those reported by Takeda and colleagues (11, 17), who found significant production of aldosterone in HUVECs and in pulmonary artery endothelial cells, some of which were obtained from the same supplier as those that we used. The latter were used at similar cell passage levels as those reported by these authors. It is possible that the expression of the aldosterone synthase decreases with multiple passages, but unfortunately it is difficult to obtain primary cells in sufficient quantities for this type of study.
To understand the possible reasons for the difference between our findings and those of Takedas group, we have analyzed their results using the information provided in the Materials and Methods section of their paper (17). They report using a commercial RIA for aldosterone with a sensitivity of 5 fmol/tube (1.38 pg aldosterone/tube), HPLC recovery of 7080%, number of cells incubated 2.5 x 105 x 24 h, with results reported as fmol/106 cells x 24 h. Minimal optimal detectable steroid, based on reported data from above, assuming measurements done in duplicate with a recovery as implied (80%) is approximately 50 fmol/well. Using these details provided in Materials and Methods, it is difficult to understand how a time course was performed because the results indicated that aldosterone levels increased to 8 ± 0.3 fmol at 6 h, 18 ± 0.9 fmol at 12 h, and 30 ± 4 fmol at 24 h, well below the level of detection according to the methods section (17). Our ELISA method is more sensitive than the RIA described by Takeda et al. (17). Its sensitivity is 2.76 fmol/ELISA well, with a recovery of 92%, because the method involves only an extraction. About twice the number of cells, approximately 4 x 105 cells/well, were used in our studies. With the cells done in triplicate and each well aliquot representing 25% of the total extract, our sensitivity is approximately 25 fmol/106 cells. We were unable to detect any aldosterone production. Sensitivity was increased by using 175 cm2 flasks containing approximately 2 x 107 cells to approximately 0.5 fmol/106 cells, yet we still were unable to detect any aldosterone.
The conversion rate of [14C] DOC to aldosterone in HUVEC was reported to be extremely high (17), 29 ± 5.8% in cells incubated with 107 M Ang II. Moreover, the sum of the conversion of DOC to labeled aldosterone, corticosterone, and 18-hydroxycorticosterone in this experiment was reported to be 157% of the [14C] DOC substrate, which is unrealistic. By comparison, adrenal glands, which express 1000 times the amount of aldosterone synthase than vascular tissue exhibit conversion rates of 46% (21). For the study of the conversion of [14C]-DOC to aldosterone, they used 0.5 µmol/liter of [14C]-DOC and found a conversion rate of 29% in cells incubated with Ang II (107 M). At this rate, aldosterone production would have been approximately 1160 fmol/106 cells·24 h. We incubated our cells with 1 µmol/liter DOC but failed to demonstrate any conversion.
RT-PCR for the CYP11B2 enzyme mRNA was not detectable after 50 cycles, whereas it was easily detectable using the same primers and RNA from human corpus callosum and thalamus, both low abundance tissues (20).
In conclusion, we have been unable to detect mRNA for the aldosterone synthase gene or aldosterone production by cultured endothelial cells derived from several sources. The explanation for the discrepancy between our results and those of Takeda is not apparent, even after careful analysis of their results using the methods described in the same report.
Furthermore, the undetectable levels of aldosterone in adrenalectomized animals cannot be reconciled with recent reports that the vascular endothelial and smooth muscle cells and heart tissue are sites of abundant aldosterone production because their cumulative mass is certainly several thousand more times than that of the adrenal zona glomerulosa.
Given the experimental and clinical data demonstrating a pathophysiological role for excessive activation of mineralocorticoid receptor in end-stage heart and renal disease and the increasing therapeutic use of mineralocorticoid receptor antagonists in the these conditions (22, 23, 24), continued investigation of the extraepithelial actions, as well as the extraadrenal synthesis of aldosterone and its regulation is very important. There remain enough doubts about the evidence presented so far to question the significance of aldosterone synthesis by endothelial cells. Existing studies need to be reevaluated and new ones performed until the phenomenon is clear.
 |
Footnotes
|
|---|
These studies were supported by Medical Research Funds from the Department of Veterans Affairs and National Institutes of Health Grants HL27255 and HL27737.
Abbreviations: Ang II, Angiotensin II; DOC, deoxycorticosterone; FBS, fetal bovine serum; HPAECs, human pulmonary artery endothelial cells; HUVECs, human umbilical vein endothelial cells.
Received January 23, 2004.
Accepted for publication April 20, 2004.
 |
References
|
|---|
- Bonvalet JP 1998 Regulation of sodium transport by steroid hormones. Kidney Int 65:S49S56
- Gomez-Sanchez CE 1998 Primary aldosteronism and its variants. Cardiovasc Res 37:813[Medline]
- Pitt B 2002 New insights into the role of aldosterone in cardiorenal disease and the clinical implications. Introduction. Am Heart J 144:S1
- Mitani F, Mukai K, Miyamoto H, Suematsu M, Ishimura Y 1999 Development of functional zonation in the rat adrenal cortex. Endocrinology 140:33423353[Abstract/Free Full Text]
- Adler GK, Chen R, Menachery AI, Braley LM, Williams GH 1993 Sodium restriction increases aldosterone biosynthesis by increasing late pathway, but not early pathway, messenger ribonucleic acid levels and enzyme activity in normotensive rats. Endocrinology 133:22352240[Abstract]
- Lehoux JG, Lefebvre A, Ducharme L, Lehoux J, Martel D, Briere N 1996 Some effects of a low sodium intake on the expression of P450 aldosterone synthase in the hamster adrenal cortex: immunoblotting, immunofluorescent and immuno-gold electron microscopic studies. J Endocrinol 149:341349[Abstract/Free Full Text]
- Takeda Y, Miyamori I, Yoneda T, Iki K, Hatakeyama H, Blair IA, Hsieh FY, Takeda R 1994 Synthesis of corticosterone in the vascular wall. Endocrinology 135:22832286[Abstract]
- Takeda R, Hatakeyama H, Takeda Y, Iki K, Miyamori I, Sheng WP, Yamamoto H, Blair IA 1995 Aldosterone biosynthesis and action in vascular cells. Steroids 60:120124[CrossRef][Medline]
- Takeda Y, Miyamori I, Yoneda T, Iki K, Hatakeyama H, Blair IA, Hsieh FY, Takeda R 1995 Production of aldosterone in isolated rat blood vessels. Hypertension 25:170173[Abstract/Free Full Text]
- Hatakeyama H, Miyamori I, Fujita T, Takeda Y, Takeda R, Yamamoto H 1994 Vascular aldosterone. Biosynthesis and a link to angiotensin II-induced hypertrophy of vascular smooth muscle cells. J Biol Chem 269:2431624320[Abstract/Free Full Text]
- Hatakeyama H, Miyamori I, Takeda Y, Yamamoto H, Mabuchi H 1996 The expression of steroidogenic enzyme genes in human vascular cells. Biochem Mol Biol Intern 40:639645[Medline]
- Silvestre JS, Robert V, Heymes C, Aupetit-Faisant B, Mouas C, Moalic JM, Swynghedauw B, Delcayre C 1998 Myocardial production of aldosterone and corticosterone in the rat. Physiological regulation. J Biol Chem 273:48834891[Abstract/Free Full Text]
- Takeda Y, Yoneda T, Demura M, Miyamori I, Mabuchi H 2000 Sodium-induced cardiac aldosterone synthesis causes cardiac hypertrophy. Endocrinology 141:19011994[Abstract/Free Full Text]
- Takeda Y, Yoneda T, Demura M, Miyamori I, Mabuchi H 2000 Cardiac aldosterone production in genetically hypertensive rats. Hypertension 36:495500[Abstract/Free Full Text]
- Gomez-Sanchez CE, Zhou MY, Cozza EN, Morita H, Eddleman FC, Gomez-Sanchez EP 1996 Corticosteroid synthesis in the central nervous system. Endocr Res 22:463470[Medline]
- Gomez-Sanchez CE, Zhou MY, Cozza EN, Morita H, Foecking MF, Gomez-Sanchez EP 1997 Aldosterone biosynthesis in the rat brain. Endocrinology 138:33693373[Abstract/Free Full Text]
- Takeda Y, Miyamori I, Yoneda T, Hatakeyama H, Inaba S, Furukawa K, Mabuchi H, Takeda R 1996 Regulation of aldosterone synthase in human vascular endothelial cells by angiotensin II and adrenocorticotropin. J Clin Endocrinol Metab 81:27972800[Abstract]
- Gomez-Sanchez CE, Foecking MF, Ferris MW, Chavarri MR, Uribe L, Gomez-Sanchez EP 1987 The production of monoclonal antibodies against aldosterone. Steroids 49:581587[CrossRef][Medline]
- Gomez-Sanchez CE, Leon LM, Gomez-Sanchez EP 1992 Biotin-hydrazide derivatives for the development of steroid enzyme-linked immunoassays. J Steroid Biochem Mol Biol 43:523528[CrossRef][Medline]
- Yu L, Romero DG, Gomez-Sanchez CE, Gomez-Sanchez EP 2002 Steroidogenic enzyme gene expression in the human brain. Mol Cell Endocrinol 190:917[CrossRef][Medline]
- Muller J 1971 Regulation of aldosterone biosynthesis. 1st ed. New York: Springer-Verlag
- Pitt B, Zannad F, Cody R, Castaigne APA, Palensky J, Wittes J; Randomized Aldactone Evaluation Study Investigators 1999 The effect of spironolactone on mobidity and mortality in patients with severe heart failure. N Engl J Med 341:709717[Abstract/Free Full Text]
- Pitt B, Remme W, Zannad F, Neaton J, Martinez F, Roniker B, Bittman R, Hurley S, Kleiman J, Gatlin M; Eplerenone Post-Acute Myocardial Infarction Heart Failure Efficacy and Survival Study Investigators 2003 Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med [Erratum (2003) 348:2271] 348:13091321[Abstract/Free Full Text]
- Stier Jr CT, Koenig S, Lee DY, Chawla M, Frishman WH 2003 Aldosterone and aldosterone antagonism in cardiovascular disease: focus on eplerenone (Inspra). Heart Dis 5:102118[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
H. M. Siragy and C. Xue
Local renal aldosterone production induces inflammation and matrix formation in kidneys of diabetic rats
Exp Physiol,
July 1, 2008;
93(7):
817 - 824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Otani, F. Otsuka, K. Inagaki, J. Suzuki, T. Miyoshi, Y. Kano, J. Goto, T. Ogura, and H. Makino
Aldosterone Breakthrough Caused by Chronic Blockage of Angiotensin II Type 1 Receptors in Human Adrenocortical Cells: Possible Involvement of Bone Morphogenetic Protein-6 Actions
Endocrinology,
June 1, 2008;
149(6):
2816 - 2825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies
A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function
Endocr. Rev.,
April 1, 2008;
29(2):
133 - 154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-C. Lam, S.-M. Kuo, M.-J. Chuang, H.-M. Keng, P.-R. Lin, G.-S. Liu, C.-M. Hsu, S.-L. Howng, and M.-H. Tai
Blockade of endothelin-1 release contributes to the anti-angiogenic effect by pro-opiomelanocortin overexpression in endothelial cells.
Experimental Biology and Medicine,
June 1, 2006;
231(6):
782 - 788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Schiffrin
Effects of Aldosterone on the Vasculature
Hypertension,
March 1, 2006;
47(3):
312 - 318.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiyama, T. Yoshimoto, K. Tsuchiya, N. Gochou, Y. Hirono, T. Tateno, N. Fukai, M. Shichiri, and Y. Hirata
Aldosterone Induces Angiotensin Converting Enzyme Gene Expression via a JAK2-Dependent Pathway in Rat Endothelial Cells
Endocrinology,
September 1, 2005;
146(9):
3900 - 3906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Z. Jaffe and M. E. Mendelsohn
Angiotensin II and Aldosterone Regulate Gene Transcription Via Functional Mineralocortocoid Receptors in Human Coronary Artery Smooth Muscle Cells
Circ. Res.,
April 1, 2005;
96(6):
643 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. Gomez-Sanchez, N. Ahmad, D. G. Romero, and C. E. Gomez-Sanchez
Is aldosterone synthesized within the rat brain?
Am J Physiol Endocrinol Metab,
February 1, 2005;
288(2):
E342 - E346.
[Abstract]
[Full Text]
[PDF]
|
 |
|