help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-1654
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.-S.
Right arrow Articles by Akamizu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.-S.
Right arrow Articles by Akamizu, T.
Endocrinology Vol. 145, No. 5 2524-2530
Copyright © 2004 by The Endocrine Society

Transgenic Mice Producing Major Histocompatibility Complex Class II Molecules on Thyroid Cells Do Not Develop Apparent Autoimmune Thyroid Diseases

Yu-Shu Li, Naotetsu Kanamoto, Yuji Hataya, Kenji Moriyama, Hitomi Hiratani, Kazuwa Nakao and Takashi Akamizu

Department of Medicine and Clinical Science (Y.-S.L., N.K., Y.H., K.M., H.H., K.N., T.A.), Translational Research Center (H.H., T.A.), Kyoto University School of Medicine, Kyoto 606-8507, Japan

Address all correspondence and requests for reprints to: Dr. Takashi Akamizu, Translational Research Center, Kyoto University School of Medicine, 54 Shogoin Kawaharacho Sakyo-ku, Kyoto 606-8507, Japan. E-mail: akamizu{at}kuhp.kyoto-u.ac.jp.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression of major histocompatibility complex (MHC) class II molecules on thyrocytes has been demonstrated in autoimmune thyroid diseases. However, the role of this aberrant MHC class II in disease development is controversial. In particular, it remains unknown whether MHC class II expression on thyrocytes, which are nonprofessional antigenpresenting cells, plays a role in inducing autoimmune processes. To clarify this issue, we have produced transgenic mice harboring an MHC class II gene ligated to the promoter of the rat TSH receptor. We obtained three lines of transgenic mice, and the expression of MHC class II by the thyrocytes was demonstrated by immunofluorescence staining and flow cytometry. Our examination revealed no obvious abnormalities in thyroid histology or in thyroid autoantibody production in these transgenic mice. Although serum-free T4 levels were slightly lower than those of their nontransgenic littermates, no transgenic mouse suffered from clinical hypothyroidism or hyperthyroidism. Furthermore, thyroid lymphocytic infiltration was absent, and MHC class II-expressing thyrocytes obtained from transgenic mice failed to stimulate the proliferation of autologous T cells in vitro. Taken together, these results show that transgenic mice with MHC class II molecules on their thyrocytes do not develop apparent autoimmune thyroid diseases, suggesting that aberrant MHC class II expression alone is not sufficient to induce thyroid autoimmunity.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE AUTOIMMUNE THYROID diseases (AITD), including Graves’ disease (GD) and Hashimoto’s thyroiditis, are commonly characterized by the production of thyroid-specific autoantibodies and lymphocytic infiltration of the thyroid gland. However, the pathological processes that disrupt the immune tolerance to thyroid antigens in AITD remain unknown. Major histocompatibility complex (MHC) class II molecules, which are normally restricted to professional antigen-presenting cells (APC), play a role in presenting antigen to the immune system and thus participate in immune and autoimmune responses (1). Bottazzo et al. (2) demonstrated that thryocytes in AITD cases, but not in normal subjects, show aberrant MHC class II expression, leading to the proposal that this aberrant expression results in the activation of autoreactive lymphocytes and plays a primary role in the initiation and/or exacerbation of AITD (3, 4). This hypothesis was further supported by the pioneering Shimojo model, which was based on the observation that GD could be induced by immunizing mice with fibroblasts expressing both murine MHC class II (I-A{kappa}) molecules and the human TSH receptor (TSHR) but not with those expressing either alone (5). In contrast, several observations have suggested that the MHC class II antigen expression is secondary to lymphocyte infiltration and organ destruction (6, 7, 8, 9). Furthermore, there is controversy regarding the role of MHC class II-expressing thyrocytes, which are nonprofessional APCs, in inducing T-cell reactivity (10, 11, 12, 13, 14) or nonresponsiveness (15, 16, 17, 18, 19). Here, we attempted to produce transgenic mice expressing MHC class II molecules on thyrocytes, driven by the rat TSHR promoter (pTSHR). Then, we examined whether these transgenic mice suffered from AITD and whether MHC class II-expressing thyrocytes obtained from transgenic mice stimulated the proliferation of autologous native T cells in vitro.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Construction of transgenic mice
Rat pTSHR-I-A{kappa}-transgenic mice were produced by microinjecting pTSHR-I-A{kappa} constructs into fertilized eggs from C3H/HeSLc mice and implanting them into pseudopregnant foster mothers. The pTSHR-I-A{kappa} construct was made by reconstructing the Bluescript SK (+/–) vector carrying the second intron, the third exon, and the 3' untranslated region of the rabbit ß-globin gene, and an SV40 poly(A) site (20). This construct was kindly provided by Dr. Masahiro Sato (Tokai University, Isehara, Japan). The 5'-flanking region from –200 bp to –1 bp of the rat TSHR gene (21), kindly provided by Dr. Shoichiro Ikuyama (Kyusyu University, Fukuoka, Japan), was inserted into the Bluescript SK (+/–) vector between BamHI and HindIII restriction enzyme sites. This particular 200-bp fragment has demonstrated the highest pTSHR activity and tissue specificity of any such promoter fragment. The RT4.15HP cell line, expressing the I-A{alpha}k, Aß (ß1{kappa}; ß2, TM, IC{delta}) class II antigen, was a gift of Dr. Ronald N. Germain (National Institute of Allergy and Infections Disease, National Institutes of Health). This shuffled I-A{kappa} molecule is not different from the wild-type I-A{kappa} form in its antigen binding and presentation (22), and this MHC class-II-expressing cell line was also used in the Shimojo model (5). A{alpha} and Aß cDNA fragments were each reverse-transcribed from mRNA purified from RT4.15HP cells and separately inserted into an EcoRI site within the third exon of the ß-globin gene in the pTSHR-BlueScript SK (+/–) constructs described above. Then, the pTSHR-A{alpha} fragment was released by digestion of the vector with XhoI. The pTSHR-Aß vector was linearized at a SalI site for pTSHR-A{alpha} fragment ligation (Fig. 1Go).



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1. pTSHR-I-A{kappa} transgene construction. The construct was made by joining, in tandem, the rat pTSHR, mouse I-Aß (ß1–; ß2, TM, ICd), and I-A{kappa} cDNAs, and part of the rabbit ß-globin gene in the Bluescript SK (+/–) vector. UTR, Untranslated region.

 
Three transgene-positive founders were selected and crossed with C3H/HeSLc (MHC haplotype I-A{kappa}) mice. Mice were screened for transgenic expression by PCR analysis of tail DNA using the following primer pairs: ß-gl-1 sense 5'-CTCCTGGGCAACGTGCTGGT and ß-gl-2 antisense 5'-GTGGTATTTGTGAGCCAGGG, ß-gl-1 sense and I-A{alpha} 3' antisense 5'-GAACACCCGTAGCACCAC, and I-Aß 5' sense GGGAATTCGGTGACTGCCATTACCTGTG and ß-gl-2 antisense. The transgene copy number was determined by Southern blotting of tail genomic DNA with a I-A cDNA probe.

Transgenic mice were bred and maintained in our animal facility under conventional conditions. All animal work was performed in accordance with the ethical guidelines of the animal research committee of Kyoto University.

Transgenic transcript expression and thyroid histology
Mice were killed at various times, and their tissues (thyroid, spleen, heart, liver, and kidney) were fixed and embedded in paraffin for routine hematoxylin-eosin staining or snap-frozen in OCT compound for immunohistologic studies. For immunofluorescence, 5-µm sections were cut with a cryostat, dried, and fixed in acetone. After washing and blocking, the slides were incubated overnight at 4 C with either biotin-conjugated A– mAb (Clone 11–5.2, PharMingen, San Diego, CA), or biotin-conjugated mouse monoclonal Ig (Clone G155–178, PharMingen) as an isotype control. Binding of primary antibody was visualized by streptavidin-conjugated Texas red dye (Jackson ImmunoResearch laboratories, Inc., West Grove, PA). For CD45 (leukocyte common antigen, Ly-5) staining, 5-µm-thick paraffin-embedded thyroid sections were stained with biotin-conjugated rat antimouse CD45 mAb (Clone 30-F11, PharMingen) after antigen unmasking, followed by streptavidin-biotin peroxidase labeling (Nacalai tesque, Kyoto, Japan) using diaminobenzidine (DAB) as the chromogen. Negative control slides were created with no primary antibody. Positive controls consisted of spleen sections subjected to the same treatment. Also, sc fat tissues were homogenized, and RNA was prepared by Trizol reagent (Invitrogen, Carlsbad, CA) extraction. First-strand cDNA was synthesized using a pd(N)6 primer. Expression of transgenic transcripts in the adipose tissue was analyzed by RT-PCR using I-A{alpha}- and I-Aß-specific primers. RNA expression in the thyroid of transgenic mice was used as a positive control.

Thyroid cell preparation and flow cytometry
Mice thyroid cells were prepared from thyroid lobes by collagenase/dispase digestion as described previously (23). Briefly, thyroids were minced and digested by type I collagenase (Sigma, St. Louis, MO) and dispase I (Roche, Indianapolis, IN) in Eagles’ MEM. After two 30-min digestions in a 37 C water bath, thyroid cells were harvested by centrifugation. The pellets were resuspended in 5H medium (24) and passed through a 200-µm nylon mesh. To evaluate transgenic expression, cells were seeded in 6-well culture plates supplied with medium in a 37 C humidified incubator under 5% CO2. The medium was changed every day to remove unattached cells and blood cells. After approximately 64 h of culture, single thyroid cell suspensions were obtained after HEPES-EDTA digestion (25). Cells were stained with R-phycoerythrin-conjugated mouse antimouse I-A{alpha}{kappa} monoclonal antibody (clone 11–5.2, PharMingen). Before antibody staining, the cells were incubated with purified mouse IgG2b protein (Dako, Glostrup, Denmark) to mask nonspecific staining. To distinguish living cells from dead ones, 7-amino-actinomycin D (PharMingen) labeling was performed before the cells were subjected to flow cytometry. I-A{alpha}{kappa} protein expression was analyzed using a FACScan running CellQuest acquisition and analysis software (Becton Dickinson, Franklin Lakes, NJ). The cells were also stained with mouse antihuman TSHR MCA1281 (2C11, Serotec, Raleigh, NC) and rat antimouse CD80-biotin (IM2854, Beckman Coulter, Inc., Marseille, France) to examine the expression of TSHR and B7, respectively.

T cell preparation and coculture experiments
T cells were enriched from spleens of 20- to 32-wk-old transgenic mice and their littermates using a magnetic cell sorting procedure. Briefly, after lysing erythrocytes with hypotonic solution (0.16 M NH4Cl, 0.17 M Tris, pH 7.65), a single-spleen-cell suspension was indirectly labeled using a cocktail of biotin-conjugated antibodies against CD45R (B220), DX5, CD11b (Mac-1), and Ter-119, and antibiotin microBeads. Isolation of pure T cells was achieved by depletion of magnetically labeled cells after retaining them on a MACS Column in the magnetic field of an autoMACS Separator (all of the antibodies and columns, as well as the separator were from Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of enriched T cells was evaluated by flow cytometry by staining with fluorescein isothiocyanate-CD3e mAb (145–2C11, PharMingen). Purified T cells (5 x 105/well) in F-12 culture medium (Life Technologies, Inc., Gaithersburg, MD) were added to the cultured thyrocytes in 96-well culture plates, as described above, for 72 h. For T cell coculture experiments, thyrocytes were seeded in 96-well a-bottomed plates at a concentration of 2 x 104 cells per well. For the T cell proliferation assay, wells were pulsed with bromodeoxyuridine (BrdU) solution (50 µg/ml) for the last 24 h. T cells seeded in the well without thyrocytes were stimulated with 10 µg/ml phytohemagglutinin-P (PHA) as a positive control.

T cell activation and proliferation assay
We used flow cytometry to characterize cells labeled by multicolor immunofluorescence with fluorescein isothiocyanate-conjugated rat antimouse CD25 mAb (Clone 7D4, PharMingen), R-phycoerythrin-conjugated rat antimouse CD4 mAb (Clone RM4–5, PharMingen), and PerCP-CY5.5-conjugated rat antimouse CD8a mAb (Clone 53–6.7, PharMingen). The combined immunofluorescent staining of the T cell surface marker CD4 or CD8 with the staining of incorporated BrdU was used together with flow cytometry to determine the frequency of proliferated cells that contained newly synthesized DNA. Incorporated BrdU staining was performed using the BrdU Flow Kit (PharMingen) according to the manufacturer’s protocol. Cells that had not been treated with BrdU were also stained as a negative control.

Serum-free T4 (FT4), TSH, TSHR antibody (TRAb), thyroglobulin (TG) antibody, and microsome antibody
A serum-free T4 (FT4) assay was performed by a commercial laboratory with an AIA-21 automatic enzyme immunoassay system (Tosoh Corp., Tokyo, Japan). Serum TSH was measured with a rat TSH [125I] assay system (RPA554, Amersham Biosciences Corp., Piscataway, NJ). Serum TRAb was determined using a TSH-binding inhibitor Ig assay with a commercially available solid-phase competitive LUMItest TRAb human RRA kit (Yamasa, Tokyo, Japan). Serum TG antibody was measured by the method described previously (26). Serum microsome antibody was assayed by a kit of gelatin-particle agglutination test (Fujirebio, Tokyo, Japan).

Statistics
Results were analyzed using a two-tailed Student’s t test. P < 0.05 was defined as significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
pTSHR-A–-transgenic mice and transgene expression
Three transgenic mice lines, designated lines 1, 4, and 5, were found to harbor 12, four to five, and three to four copies of the transgene in their respective genomes. Immunofluoresence analysis revealed ectopic I-A{kappa} protein in thyroid follicles only in transgenic mice from lines 1 and 5 but not from line 4 (Fig. 2Go, A–F). I-A{kappa} molecules were not seen in other tissues from transgenic mice, including heart, kidney, and liver, with the exception of spleen of both transgenic and control mice. Fluorescence-activated cell sorting (FACS) analysis also demonstrated I-A{kappa} molecules on the surface of thyrocytes in transgenic mice from line-1 and -5, but not in line-4 transgenic or nontransgenic control mice. The mean fluorescence intensities of line-1, -5, and -4 transgenic and control thyrocytes were 35.51, 30.65, 10.59, and 9.53 arbitrary units, respectively, in one representative experiment (Fig. 2GGo). TSHR expression on thyrocytes of transgenic mice was confirmed by flow cytometry (Fig. 2HGo). Because TSHR is expressed in adipose tissue (27, 28), transgenic MHC class II mRNA expression in fat tissue was also analyzed by RT-PCR. The transcripts were detected in the adipose tissue of both transgenic and wild-type mice (data not shown). Metzger et al. (29) reported previously that adipose tissue of wild-type mice expressed MHC class II transcripts. Indeed, we did not find any significant difference in the expression of MHC class II transcripts between wild-type and line-1 or -5 transgenic mice by RT-PCR.



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 2. Production of MHC class II molecules on thyrocytes. Thyroid slices without the first antigen (A) and spleens from C3H/He mice (B) were stained as negative and positive controls, respectively. The thyroid glands of wild-type control (C), line-1 transgenic (D), line-4 transgenic (E), and line-5 transgenic mice (F) were examined for the presence and localization of MHC class II molecules by immunofluorescence staining. The production of MHC class II molecules on separated thyrocytes from line-1 and -5 transgenic mice was confirmed by FACS analysis (G): a shadowed region represents control staining; dotted, thin solid, and bold solid lines represent the MHC class II staining of thyrocytes from wild-type, line-5 transgenic, and line-1 transgenic mice, respectively. The presence of TSHR on cultured thyrocytes was also investigated by FACS (H): a shadowed part represents the control staining; dotted and solid lines represent TSHR staining of thyrocytes from wild-type and line-1 transgenic mice, respectively.

 
Analysis of pTSHR-I-A{kappa}-transgenic mice
We observed transgenic mice for 2 yr. The mice remained alive and apparently healthy throughout the observation period. No obvious differences were observed in the appearance and movement of transgenic mice compared with their control littermates. Histological examination of thyroids obtained at various time points did not reveal any significant differences between transgenic mice and their sex- and age-matched control littermates. Thyroid lymphocyte infiltration was not observed, even upon immunostaining of CD45 protein. Serum concentration of FT4 in line-1 and -5 transgenic mice were slightly, but significantly, lower than that of their control littermates (P < 0.05). Serum FT4 levels of 8-wk-old line-1, -4, and -5 transgenic mice and wild-type mice were 1.14 ± 0.2, 1.45 ± 0.3, 1.34 ± 0.30, and 1.56 ± 0.34 ng/dl, respectively (Fig. 3AGo). Both transgenic and wild-type mice showed lower serum FT4 levels in aged mice than in young mice. We found that 90-wk-old line-1 transgenic mice had lower FT4 levels than their control littermates (0.61 ± 0.09 ng/dl vs. 0.78 ± 0.12 ng/dl, respectively; P < 0.05). Despite these differences, none of the transgenic mice were deviated from the normal range of FT4 defined by the mean ± 3 SD in control mice and were found to have obvious clinical manifestations of hyperthyroidism or hypothyroidism. TSH concentrations in sera from male mice were significantly higher than those in female mice in all lines. Serum TSH concentrations of line-5 transgenic mice were significantly higher than those of control mice (P < 0.05). Although serum TSH concentrations in line-1 transgenic mice tended to be higher than those in control mice, these differences were not statistically significant (Fig. 3BGo). There were wide, uncorrelated variations in serum FT4 and TSH concentrations in transgenic and control mice. Serum TRAb levels in transgenic mice were similar to those in control mice (Fig. 3CGo). No sera showed TG or microsome antibody activities. B7 expression in thyrocytes from transgenic mice was not detected in flow cytometry.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 3. Serum concentration of FT4, TSH, and TRAb in transgenic (Tg) and wild-type mice. A, FT4 concentrations in sera from 8- to 12-wk-old mice. B, TSH concentrations in sera from 16- to 20-wk-old mice. C, TRAb concentrations in sera from 12- to 20-wk-old mice as determined by TSH-binding inhibitor Ig assay. The normal upper limits are shown by a horizontal dotted line. *, P < 0.05; **, P < 0.01. NTg, Nontransgenic.

 
Analysis of T cell reaction to autologous thyrocytes
Line-5 transgenic mice were used for T cell/thyrocyte coculture experiments. Untouched CD3-positive T lymphocytes were enriched to a purity of 96.06 ± 1.42% (n = 26) by magnetic separation. T cell activation was evaluated by CD25 expression. Incorporation of BrdU in the T cells demonstrated their proliferation. Neither MHC class II-expressing thyrocytes from transgenic mice nor wild-type thyrocytes from control mice could stimulate the autologous T cells after a 3- or 5-d coculture (data not shown). In addition, as shown in Table 1Go, neither T cells from control mice cocultured with transgenic MHC class II-expressing thyrocytes nor T cells from transgenic mice cocultured with wild-type thyrocytes were activated, although PHA markedly stimulated BrdU uptake of T cells.


View this table:
[in this window]
[in a new window]
  		TABLE 1. T cell activation and proliferation by coculture with thyrocytes from transgenic and nontransgenic mice

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We generated transgenic mice that aberrantly produce MHC class II molecules in thyrocytes. The I-A{kappa} transgene used here was the same as that transfected into RT4.15HP cells in the Shimojo model (5), and the ability of its gene products to present antigens effectively had been demonstrated before (30). C3H/HeSLc mice that we used in the present study have been shown to be a lipopolysaccharide responder (31) and are assumed to be similar to C3H/He mice used previously (32). In our study, MHC class II expression on thyrocytes of transgenic mice was driven by the pTSHR. In fact, immunofluorescence staining and flow cytometry demonstrated the presence of MHC class-II molecules on thyrocytes from line-1 and -5 transgenic mice. The expression of TSHR in thyrocytes from these transgenic mice was also confirmed by flow cytometry. Thus, we created a transgenic animal in which thyrocytes produced both MHC class II and TSHR molecules simultaneously under the control of pTSHR.

Line 4 did not express MHC class II molecules, although the mice harbor four to five copies of the transgene in their genomes. The failure might be due to the insertion locus. This notion should also be considered for the negative results in the induction of AITD in other lines, 1 and 5. Thus, insertion locus might influence the function of MHC expressed on thyrocytes, although it will be rare that this simultaneously happens in two lines.

We observed a slightly lower serum FT4 in transgenic mice compared with their wild-type littermates. But, comparing with FT4 assay, less evidence of hypothyroidism was obtained from TSH assay by the commercial rat TSH RIA kit, which has a limited sensitivity for measuring murine TSH (33). Upon closer examination, our transgenic mice, with their aberrant MHC class II expression in thyrocytes, showed histologically intact thyroid glands and no evidence of thyroid inflammation or development of AITD. Although the Shimojo model demonstrated the necessity of simultaneous expression of MHC class II and TSHR on the surface of fibroblasts for the induction of GD by ip immunization, it did not show that aberrant MHC class II expression on thyrocytes was necessary to break immune tolerance in the thyroid (5). In contrast, a recent report by Caturegli et al. (34) showed that transgenic mice expressing the transcription factor class II transactivator under control of the TG promoter do not develop spontaneous thyroiditis. In fact, no transgenic models with MHC class II molecules on islet cells have been shown to develop autoimmune destruction of the islet, which is the main pathologic observation in insulin-dependent diabetes mellitus, another typical organ-specific autoimmune disease (35, 36). Thus, our results suggest that MHC class II expression on thyrocytes is not sufficient to induce thyroid autoimmunity. The decrease of serum FT4 levels in transgenic mice might be due to degenerative or other undetected changes in thyrocytes, analogous to those seen in diabetes models (35, 36).

Several studies have shown that MHC class II-producing thyrocytes from AITD glands stimulate the proliferation of T cell clones and lines derived from AITD thyroid tissues (10, 11, 12). Davies et al. (13) reported that MHC class IIproducing thyrocytes induced by lectin or IL-2 could stimulate T cells in an autologous mixed lymphocyte reaction. To address this issue, we have investigated the ability of MHC class II-producing thyrocytes from transgenic mice to induce a native T cell response by measuring the proliferation and activation of autologous T cells in vitro. MHC class-IIproducing thyrocytes from transgenic mice, however, failed to stimulate T cell proliferation in coculture experiments (Table 1Go). This failure to respond may be due to a number of reasons; one possibility is that the sources of thyrocytes are different. For example, the amount of MHC class II molecules present may not have been optimal for APC activity. Because we used the endogenous pTSHR to drive transgenic expression, the promoter activity may be much weaker than that of the TG promoter or other exogenous promoters. Another possibility is that the full set of genes necessary for APC activity was not expressed in our system. In previous studies, thyrocytes obtained from AITD glands or stimulated by cytokines produced not only MHC class II molecules but also other molecules, such as B7, CD40, ICAM-1, and other costimulatory molecules, which have been demonstrated to be critical for antigen presentation (25, 37, 38, 39, 40, 41). In our study, however, we could not detect expression of costimulatory molecules on thyrocytes from transgenic mice, including B7, one of the most important of these molecules. In fact, in another parenchymal nonprofessional APC, islet ß-cells, T cells were unresponsive to transgenic MHC class II molecules present on ß-cells (42), and double transgenic mice expressing B7 and TNF-{alpha} in their islet ß-cells developed autoimmune diabetes (43). Furthermore, MHC class II- producing hepatocytes with costimulatory B7 molecules on their surfaces could present antigen and activate CD4 T cells (44). Taken together, costimulatory signals appear to be necessary for MHC class II-producing thyrocytes to stimulate T cell responses. Therefore, experiments which provide costimulatory signals necessary for T cell activation should be considered in the future study of the transgenic mice.

In conclusion, the transgenic mice developed here, with aberrant MHC class II-expression on their thyrocytes, did not develop AITD. Thyrocytes from transgenic mice did not show APC activity. These results do not conclusively show, however, that MHC class II-producing thyrocytes would lack the potential for antigen presentation if costimulatory signals or other necessary factors are present. In fact, the present study may lack an appropriate trigger that would induce breakdown of tolerance to develop AITD, although the mice were bred in conventional conditions. As a future study, interventional experiments such as administration of autoantigen (TSHR, TG, thyroid peroxidase), lipopolysaccharide, or cytokines should be considered. Thus, this transgenic model will remain useful for investigating whether and how aberrant MHC class II expression, in combination with other factors that trigger or influence AITD, contributes to APC function, as well as disease susceptibility and perpetuation.


   Footnotes
 
This work was supported, in part, by grants-in-aid from the Ministry of Education, Science, Culture, Sports, and Technology of Japan, and the Ministry of Health, Labor, and Welfare of Japan (to T.A.). Y.-S.L. is the recipient of a postdoctoral fellowship from the Japan Society for the Promotion of Science.

Present address for Y.-S.L.: Department of Endocrinology and Metabolism, The First Clinical College, China Medical University, Shenyang, 110001 China.

Present address for H.H.: Department of Clinical Laboratory Science, School of Allied Health Science, Osaka University, 565-0871 Osaka, Japan.

Abbreviations: AITD, Autoimmune thyroid diseases; APC, antigen-presenting cells; BrdU, bromodeoxyuridine; FACS, fluorescence-activated cell sorting; FT4, serum-free T4; GD, Graves’ disease; MHC, major histocompatibility complex; PHA, phytohemagglutinin-P; pTSHR, TSHR promoter; TG, thyroglobulin; TRAb, TSHR antibody; TSHR, TSH receptor.

Received December 5, 2003.

Accepted for publication January 28, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ting JP, Trowsdale J 2002 Genetic control of MHC class II expression. Cell 109(Suppl):S21–S33
  2. Hanafusa T, Pujol-Borrell R, Chiovato L, Russell RCG, Doniach D, Bottazzo GF 1983 Aberrant expression of HLA-DR antigen on thyrocytes in Greaves’ disease: relevance for autoimmunity. Lancet 2:1111–1115[Medline]
  3. Botazzo GF, Pujol-Borrell R, Hanafusa T, Feldmann M 1983 Role of aberrant HLA-DR expression and antigen presentation in induction of endocrine autoimmunity. Lancet 2:1115–1119[Medline]
  4. Feldmann M, Dayan C, Rapoport B, Londei M 1992 T cell activation and antigen presentation in human thyroid autoimmunity. J Autoimmun 5(Suppl A):115–121
  5. Shimojo N, Kohno Y, Yamaguchi K, Kikuoka S, Hoshioka A, Niimi H, Hirai A, Tamura Y, Saito Y, Kohn LD, Tahara K 1996 Induction of Graves-like disease in mice by immunization with fibroblasts transfected with the thyrotropin receptor and a class II molecule. Proc Natl Acad Sci USA 93:11074–11079[Abstract/Free Full Text]
  6. Khoury EL 1987 Aberrant expression of class II HLA antigens by the target cells: cause or consequence of the autoimmune aggression? Acta Endocrinol (Copenh) 11(Suppl 281):35–41
  7. Aguayo J, Iitaka M, Row VV, Volpe R 1988 Studies of HLA-DR expression on cultured human thyrocytes: effect of antithyroid drugs and other agents on interferon gamma induced HLA-DR expression. J Clin Endocrinol Metab 66:903–908[Abstract]
  8. Hamilton F, Black M, Farquharson MA, Stewart CS, Foulis AK 1991 Spatial correlation between thyroid epithelial cells expressing class II MHC molecules and interferon-{gamma}-containing lymphocytes in human thyroid autoimmune disease. Clin Exp Immunol 83:64–68[Medline]
  9. Margolese H, O’Keefe C, Chung F, Ertug F, Wall JR, Bernard NF 1994 Expression of major histocompatibility complex class II antigen in NOD mouse thyroid. Autoimmunity 17:1–11[Medline]
  10. Londei M, Lamb JR, Bottazzo GF, Feldmann M 1984 Epithelial cells expressing aberrant MHC class II determinants can present antigen to cloned human T cells. Nature 312:639–641[CrossRef][Medline]
  11. Londei M, Bottazzo GF, Feldmann M 1985 Human T cell clones from autoimmune thyroid glands: specific recognition of autologous thyroid cells. Science 228:85–89[Abstract/Free Full Text]
  12. Dayan CM, Londei M, Corcoran AE, Grubeck-Loebenstein B, James RF, Rapoport B, Feldmann M 1991 Autoantigen recognition by thyroid-infiltrating T cells in Graves disease. Proc Natl Acad Sci USA 88:7415–7419[Abstract/Free Full Text]
  13. Davies TF 1985 Cocultures of human thyroid monolayer cells and autologous T cells: impact of HLA class II antigen expression. J Clin Endocrinol Metab 61:418–422[Abstract]
  14. Maile R, Elsegood KA, Harding TC, Uney JB, Stewart CEH, Banting G, Dayan CM 2000 Effective formation of major histocompatibility complex class II-peptide complexes from endogenous antigen by thyroid epithelial cells. Immunology 99:367–374[CrossRef][Medline]
  15. Stein ME, Stadecker MJ 1987 Characterization and antigen-presenting function of a murine thyroid-derived epithelial cell line. J Immunol 139:1786–1791[Abstract]
  16. Ebner SA, Stein ME, Minami M, Dorf ME, Stadecker MJ 1987 Murine thyroid follicular epithelial cells can be induced to express class II (Ia) gene products but fail to present antigen in vitro. Cell Immunol 104:154–168[CrossRef][Medline]
  17. Lombardi G, Arnold K, Uren J, Marelli-Berg F, Hargreaves R, Imami N, Weetman A, Lechler R 1997 Antigen presentation by interferon-{gamma}-treated thyroid follicular cells inhibits interleukin-2 (IL-2) and supports IL-4 production by B7-dependent human T cells. Eur J Immunol 27:62–71[Medline]
  18. Marelli-Berg F, Weetman A, Frasca L, Deacock SJ, Imami N, Lombardi G, Lechler RI 1997 Antigen presentation by epithelial cells induces anergic immunoregulatory CD45RO+ T cells and deletion of CD45RA+ T cells. J Immunol 159:5853–5861[Abstract]
  19. Dayan CM, Elsegood KA, Maile R 1997 FasL expression on epithelial cells: the Bottazzo-Feldmann hypothesis revisited. Immunol Today 18:203[CrossRef][Medline]
  20. Moriyama K, Hashimoto R, Hanai A, Yoshizaki N, Yonezawa S, Otani H 1996 Occurrence of craniofacial anomalies and liver tumor in transgenic mice expressing osteoblast-specific factor-1 (OSF-1) gene. Transgenics 2:69–78
  21. Ikuyama S, Niller HH, Shimura H, Akamizu T, Kohn LD 1992 Characterization of the 5'-flanking region of the rat thyrotropin receptor gene. Mol Endocrinol 6:793–804[Abstract]
  22. Germain RN, Ashwell JD, Lechler RI, Margulies DH, Nickerson KM, Suzuki K, Tou JYL 1985 "Exon-shuffling" maps control of antibody- and T-cell-recognition sites to the NH2-terminal domain of the class II major histocompatibility polypeptide A. Proc Natl Acad Sci USA 82:2940–2944[Abstract/Free Full Text]
  23. Jeker LT, Hejazi M, Burek CL, Rose NR, Caturegli P 1999 Mouse thyroid primary culture. Biochem Biophys Res Commun 257:511–515[CrossRef][Medline]
  24. Kohn LD, Valente WA, Grollman EF, Aloj SM, Vitti P 1986 Clinical determination and/or quantification of thyrotropin and a variety of thyroid stimulatory or inhibitory factors performed in vitro with an improved thyroid cell line FRTL-5. US Patent no. 4, 609, 622
  25. Metcalfe RA, McIntosh RS, Marelli-Berg F, Lombardi G, Lechler R, Weetman AP 1998 Detection of CD40 on human thyroid follicular cells: analysis of expression and function. J Clin Endocrinol Metab 83:1268–1274[Abstract/Free Full Text]
  26. Hutchings PR, Parish NM, Cooke A 1997 Experimental models of autoimmune thyroiditis. In: Lefkovits I, Adorini L, eds. The immunology methods manual. London: Academic Press Ltd; 1775–1785
  27. Roselll-Rehfuss L, Robbins LS, Cone RD 1992 Thyrotropin receptor messenger ribonucleic acid is expressed in most brown and white adipose tissues in the guinea pig. Endocrinology 130:1857–1861[Abstract]
  28. Endo T, Ohta K, Haraguchi K, Onaya T 1995 Cloning and functional expression of a thyrotropin receptor cDNA from rat fat cells. J Biol Chem 270:10833–10837[Abstract/Free Full Text]
  29. Metzger R, Mempel T, Joppich I, Till H 2000 Organ-specific distribution of major histocompatibility antigens in rats. Pediatr Surg Int 16:285–292[CrossRef][Medline]
  30. Norcross MA, Bentley DM, Margulies DH, Germain RN 1984 Membrane Ia expression and antigen-presenting accessory cell function of L cells transfected with class II major histocompatibility complex genes. J Exp Med 160:1316–1337[Abstract/Free Full Text]
  31. Teshima S, Rokutan K, Takahashi M, Nikawa T, Kishi K 1996 Induction of heat shock proteins and their possible roles in macrophages during activation by macrophage colony-stimulating factor. Biochem J 315:497–504
  32. Yamaguchi K, Shimojo N, Kikuoka S, Hoshioka A, Hirai A, Tahara K, Kohn LD, Kohno Y, Niimi H 1997 Genetic control of anti-thyrotropin receptor antibody generation in H-2K mice immunized with thyrotropin receptor-transfected fibroblasts. J Clin Endocrinol Metab 82:4266–4269[Abstract/Free Full Text]
  33. Pohlenz J, Maqueem A, Cua K, Weiss RE, Sande JV, Refetoff S 1999 Improved radioimmunoassay for measurement of mouse thyrotropin in serum: strain differences in thyrotropin concentration and thyrotroph sensitivity to thyroid hormone. Thyroid 9:1265–1271[Medline]
  34. Kimura H, Kimura M, Suzuki K, Caturegli P, Transgenic models of autoimmune thyroiditis. Proc 9th International Symposium on Molecular Thyroidology, Yonago, Japan, 2002, p 17 (Abstract)
  35. Sarvetnick N, Liggitt D, Pitts SL, Hansen SE, Stewart TA 1988 Insulin-dependent diabetes mellitus induced in transgenic mice by ectopic expression of class II MHC and interferon-gamma. Cell 52:773–782[CrossRef][Medline]
  36. Bohme J, Haskins K, Stecha P, Ewijk W, LeMeur M, Gerlinger P, Benoist C, Mathis D 1989 Transgenic mice with I-A on islet cells are normoglycemic but immunologically intolerant. Science 244:1179–1183[Abstract/Free Full Text]
  37. Armengol MP, Cardoso-Schmidt CB, Fernandez M, Ferrer X, Pujol-Borrell R, Juan M 2003 Chemokines determine local lymphoneogenesis and a reduction of circulating CXCR4(+) T and CCR7 B and T lymphocytes in thyroid autoimmune diseases. J Immunol 170:6320–6328[Abstract/Free Full Text]
  38. Kemp EH, Metcalfe RA, Smith KA, Woodroofe MN, Watson PF, Weetman AP 2003 Detection and localization of chemokine gene expression in autoimmune thyroid disease. Clin Endocrinol (Oxf) 59:207–213[CrossRef][Medline]
  39. Tandon N, Metcalfe RA, Barnett D, Weetman AP 1994 Expression of the costimulatory molecule B7/BB1 in autoimmune thyroid disease. Q J Med 87:231–236
  40. Faure GC, Bensoussan-Lejzerowicz D, Bene MC, Aubert V, Leclere J 1997 Coexpression of CD40 and class II antigen HLA-DR in Graves’ disease thyroid epithelial cells. Clin Immunol Immunopathol 84:212–215[CrossRef][Medline]
  41. Zheng RQ, Abney ER, Grubeck-Loebenstein B, Dayan C, Maini RN, Feldmann M 1990 Expression of intercellular adhesion molecule-1 and lymphocyte function-associated antigen-3 on human thyroid epithelial cells in Graves’ and Hashimoto’s diseases. J Autoimmun 3:727–736[CrossRef][Medline]
  42. Pilstrom B, Bohme J 1997 T cells are unresponsive to transgenic MHC class II molecules expressed on pancreatic ß cells. Scand J Immunol 45:361–365[CrossRef][Medline]
  43. Guerder S, Picarella DE, Linsley PS, Flavell RA 1994 Costimulator B7-1 confers antigen-presenting-cell function to parenchymal tissue and in conjunction with tumor necrosis factor and leads to autoimmunity in transgenic mice. Proc Natl Acad Sci USA 91:5138–5142[Abstract/Free Full Text]
  44. Herkel J, Jagemann B, Wiegard C, Lazaro JFG, Lueth S, Kanzler S, Blessing M, Schmitt E, Lohse AW 2003 MHC class II-expressing hepatocytes function as antigen-presenting cells and activate specific CD4 T lymphocytes. Hepatology 37:1079–1085[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
P. N. Pichurin, C.-R. Chen, G. D. Chazenbalk, H. Aliesky, N. Pham, B. Rapoport, and S. M. McLachlan
Targeted Expression of the Human Thyrotropin Receptor A-Subunit to the Mouse Thyroid: Insight into Overcoming the Lack of Response to A-Subunit Adenovirus Immunization
J. Immunol., January 1, 2006; 176(1): 668 - 676.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
S. M. McLachlan, Y. Nagayama, and B. Rapoport
Insight into Graves' Hyperthyroidism from Animal Models
Endocr. Rev., October 1, 2005; 26(6): 800 - 832.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. Kimura, M. Kimura, S.-C. Tzou, Y.-C. Chen, K. Suzuki, N. R. Rose, and P. Caturegli
Expression of Class II Major Histocompatibility Complex Molecules on Thyrocytes Does Not Cause Spontaneous Thyroiditis but Mildly Increases Its Severity after Immunization
Endocrinology, March 1, 2005; 146(3): 1154 - 1162.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.-S.
Right arrow Articles by Akamizu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.-S.
Right arrow Articles by Akamizu, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals