help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-1535
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amri, H.
Right arrow Articles by Papadopoulos, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amri, H.
Right arrow Articles by Papadopoulos, V.
Endocrinology Vol. 145, No. 4 1802-1809
Copyright © 2004 by The Endocrine Society

Identification of the Adrenocorticotropin and Ginkgolide B-Regulated 90-Kilodalton Protein (p90) in Adrenocortical Cells as a Serotransferrin Precursor Protein Homolog (Adrenotransferrin)

Hakima Amri, Wenping Li, Katy Drieu and Vassilios Papadopoulos

Departments of Biochemistry and Molecular Biology (W.L.,V.P.) and Physiology and Biophysics (H.A.), Georgetown University Medical Center, Washington, D.C. 20057; and Institut Henri Beaufour-Institut de Produits de Synthèse et d’Extraction Naturelle (K.D.), 75116 Paris, France

Address all correspondence and requests for reprints to: Dr. V. Papadopoulos, Department of Biochemistry and Molecular Biology, Georgetown University Medical Center, Basic Sciences Building, 3900 Reservoir Road, Washington, D.C. 20057. E-mail: papadopv{at}georgetown.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Two-dimensional electrophoresis (2D-PAGE) of metabolically labeled adrenocortical proteins, identified a series of spots at a molecular size of 90 kDa [isoelectric point (pI) 6.8–7.1; p90] that was induced by ACTH, but whose intensity was reduced in cells obtained from animals treated with an extract of Ginkgo biloba (EGb 761) and its purified component ginkgolide B (GKB). We have now identified p90. GKB (2 mg/kg·d, ip) was administered to rats for 8 d. Adrenocortical cells were prepared and stimulated with ACTH for 3 h. Cells obtained from saline-treated rats responded to ACTH by producing high amounts of corticosterone, an effect that was inhibited in cells obtained from GKB-treated animals. Samples were fractionated by 2D-PAGE and matrix-assisted laser desorption ionization mass spectrometry analysis of the p90 spots isolated from the gels revealed sequences sharing identity with the serotransferrin precursor protein. Further PCR screening of a rat adrenal cDNA library identified a sequence with a high degree of homology (79%) to serotransferrin precursor protein, and a lesser degree to rat transferrin (54%) and human melanotransferrin (32.8%). p90, in 2D-PAGE immunoblots, was also recognized by a monoclonal antibody raised against human 97-kDa melanotransferrin. Iron binding assays with rat adrenal cortex extracts further identified a 90-kDa melanotransferrin immunoreactive protein binding iron, suggesting that the identified protein, which we name "adrenotransferrin," may have iron-binding activity. This is the first report describing the presence of a serotransferrin precursor protein homolog belonging to the transferrin family and sharing epitopes with melanotransferrin in the adrenal, its induction by ACTH, and sensitivity to GKB.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
STEROID SYNTHESIS IS under the control of trophic hormones. Ovarian and testicular steroid synthesis is controlled by LH and FSH, whereas adrenal steroid production is regulated by ACTH. The effects of these pituitary hormones can be acute or chronic, depending on the specific function and physiological state of the target endocrine gland or organ that is stimulated. Therefore, changes in estrogen, androgen, or glucocorticoid synthesis can occur within a few seconds and can last for hours. An acute increase in glucocorticoid synthesis is associated with the immediate stress response that enables an organism to cope with daily stressors (1, 2), whereas the excessive synthesis and release of glucocorticoids that occurs in response to chronic stress has been shown to be detrimental (3). Chronic glucocorticoid excess can have adverse effects on the central nervous system, causing irreversible damage to hippocampal neurons, thereby leading to neurotoxicity (3), neuroendangerment (4, 5), impairment of cognitive functions such as learning and memory, and disruption of the physiologic process of brain aging (3, 6). Such events may be associated with various neurological diseases, including depression (7) and Alzheimer’s disease (8). On this basis, we believe that an increased understanding of the molecular mechanisms underlying the regulation of glucocorticoid synthesis might facilitate the design of pharmacologically active molecules that could have therapeutic applications in a variety of neurodegenerative processes.

We have previously identified the peripheral-type benzodiazepine receptor (PBR) as a mitochondrial protein involved in mediating the transport of the substrate cholesterol from the outer to the inner mitochondrial membrane (9), the rate-determining step in steroid biosynthesis (10). PBR is expressed at high levels in steroid-synthesizing tissues, its highest expression level being in the adrenal cortex (11, 12). Studies of the ontogeny of PBR have revealed that its expression is closely correlated with ACTH-inducible steroidogenesis (13). In searching for a pharmacological tool to regulate PBR expression and glucocorticoid synthesis, we found that the standardized Ginkgo biloba extract EGb 761 and its purified components gingkolide A or ginkgolide B (GKB) can regulate glucocorticoid levels by controlling adrenal PBR expression at the transcriptional level (14, 15, 16). While conducting two-dimensional electrophoresis (2D-PAGE) experiments on metabolically labeled adrenal cortical proteins, we observed a series of spots at a molecular size of 90 kDa (protein 6: pI 6.8–7.1) that was induced by ACTH (15). Because the intensity of these spots was markedly reduced in cells obtained from EGb 761- and GKB-treated animals (15), we decided to further examine the nature of this protein. We report herein that this adrenal protein has a significant homology to serotransferrin precursor protein, shares common epitopes with melanotransferrin, and has iron-binding activity.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
GKB (BN 52021), isolated from EGb 761, was provided by the Institut Henri Beaufour-Institut de Produits de Synthèse et d’Extraction Naturelle (Paris, France). [1,2,6–7-N-3H] Corticosterone (SA, 80.00 Ci/mmol) was obtained from DuPont-NEN Life Science Products (Wilmington, DE). Anticorticosterone antiserum was purchased from ICN (Costa Mesa, CA). Collagenase type IA, deoxyribonuclease type III, {alpha}-tocopherol, ascorbic acid, selenium and MEM amino acids and vitamins, ammonium iron (III) sulfate dodecahydrate [NH4Fe(SO4)2·12H2O], human transferrin, 3-(2-pyridyl)-5,6-bis(2-[5-furyl sulfonic acid])-1,2,4-triazinc (Ferene S), and thioglycolic acid were obtained from Sigma Chemical Co. (St. Louis, MO). ACTH 1–24 was obtained from Peninsula Laboratories, Inc. (Belmont, CA). PBS [pH 7.2] and cell culture supplies as well as 4–20% Tris-glycine gel (1.5 mm x 10 well), native Tris-glycine sample buffer, and denaturing nonreducing Tris-glycine SDS-PAGE sample buffer were purchased from Invitrogen Life Technologies (Carlsbad, CA). Horse serum was obtained from BioWhittaker (Walkersville, MD). Penicillin/streptomycin were purchased from Biofluids Inc. (Rockville, MD). DMEM/Ham’s F12 medium was supplied by Irvine Scientific (Santa Ana, CA). Cell culture plasticware was obtained from Corning (Corning, NY). Other electrophoresis reagents and materials were supplied by Bio-Rad (Richmond, CA). All other additional chemicals of analytical quality were obtained from various commercial sources. PCR primers were synthesized by MWG-Biotech (High Point, NC). Preamplified rat adrenal gland cDNA library was obtained from Invitrogen Life Technologies. Rat adrenal cDNA library plasmid pCMV.SPORT 6 was isolated using the QIAGEN (Valencia, CA) plasmid purification kit. The pGEM-T easy vector was purchased from Promega (Madison, WI). PCR kit display TAQ-COMPLETE and DH5{alpha} competent cells were obtained from PGC Scientific (Frederick, MD). ABI PRISM terminator cycle sequencing ready reaction kit was obtained from Applied Biosystems (Foster City, CA).

Animals and experimental design
Male 80-d-old Sprague Dawley rats were obtained from Charles River Breeding Laboratories (Wilmington, MA). Rats were housed at the Georgetown University Research Resources Facility under controlled light and temperature, with free access to rat chow and water. They were housed in groups of three and allowed to acclimatize to their new conditions for 4 d before initiation of treatment. All experimental protocols were reviewed and approved by the Georgetown University Animal Care and Use Committee. Based on our previous findings (14, 15, 16) GKB (2 mg/kg·d) was administered by ip injection for 8 d and the animals were killed 24 h after the last treatment. Control animals received injections of saline solution (0.9% NaCl in double-distilled water). All treatments were administered at 1000 h.

Preparation of adrenocortical cells, sample solubilization and 2D-PAGE
Rat adrenal cells were prepared as we have previously described (15). After incubating the cells for 2 h, ACTH (10 ng/ml) was added to the bathing medium and incubation was continued for an additional 3 h. At the end of the incubation, media were collected for the determination of corticosterone levels and cells were solubilized for measurement of protein levels. In separate experiments, cell extracts were prepared for 2D-PAGE as we have previously described (15). 2D-PAGE was performed by Kendrick Laboratories, Inc. (Madison, WI) according to the method of O’Farrell (17). In brief, 1 µg of an isoelectric focusing internal standard, tropomyosin, was added to the samples. This protein migrates as a doublet at 33-kDa molecular mass and a pI of 5.2. Tube gels were sealed to the top of 10% acrylamide slab gels (0.75 mm thick), and sodium dodecyl sulfate slab gel electrophoresis was carried out for about 4 h at 12.5 mA/gel. The following proteins were used as markers: myosin (220 kDa), phosphorylase A (94 kDa), catalase (60 kDa), actin (43 kDa), carbonic anhydrase (29 kDa), and lysozyme (14 kDa) from Sigma Chemical Co. After slab gel electrophoresis, the gels were transblotted onto polyvinylidene fluoride (PVDF) paper and the blot was stained with Coomassie Brilliant Blue G250 in 50% methanol and dried. In another set of experiments, the gels were submitted to silver staining compatible with mass spectrometry.

Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS)
MALDI-MS was performed by Kendrick Laboratories, Inc. and the Protein Chemistry Core Facility, Howard Hughes Medical Institute, Columbia University (New York, NY). After identifying the specific 90-kDa spots on PVDF blots, the corresponding spots were cut out of silver-stained gels, and in-gel digestion was performed as previously described (18). Briefly, gel spots were placed in pretrypsin digestion tubes, destained with a solution of 30 mM potassium ferricyanide/100 mM sodium thiosulfate (1:1 vol/vol), and then thoroughly washed with water. They were then dehydrated by soaking in acetonitrile for 20 min. After removal of the acetonitrile, the gel spots were completely dried in a Speed-Vac concentrator. Then, 10 µl of digestion buffer (0.025 M Tris, pH 8.5) containing 0.1 µg endoproteinase Lys-C was added to the dried gel spots and the samples were incubated at 32 C for 20 h. After digestion, peptides were extracted by adding 50 µl of 50% acetonitrile/2% trifluoroacetic acid and shaken for 20 min. The extraction was repeated for the pellets, and supernatants were combined and dried on a Speed-Vac concentrator. The dried digest was dissolved in 3 µl matrix/standard solution (10 mg/ml 4-hydroxy-{alpha}-cyanocinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid; angiotensin and bovine insulin were added as standards), and a 0.7-µl aliquot was spotted on the sample plate, dried, washed with water, and dried again. MALDI-MS was performed on the digest using a PerSeptive Voyager DERP mass spectrophotometer in the linear mode (Applied Biosystems).

Immunoblotting
Proteins fractionated by 2D-PAGE were electroblotted onto PVDF membranes. Membranes were washed briefly in methanol and incubated with antimelanotransferrin antibody followed by the horseradish peroxidase-conjugated antimouse secondary antibody. The primary antimelanotransferrin antibody was isolated from mouse hybridoma cells, purchased from ATCC (Manassas, VA; clone no. HB8446), producing antihuman melanotransferrin monoclonal L235 antibody. In brief, cell medium was collected and submitted to protein A column chromatography (Bio-Rad Laboratories, Hercules, CA). The fraction of interest was eluted following the manufacturer’s procedure. Immunoblotting was performed as we have previously described (15). Chemiluminescence using the ECL detection reagent (DuPont-NEN Life Science Products) was used to reveal immunoreactive protein(s).

PCR, subcloning and sequencing
Primers 490L, 4U, and 420L were designed based on the sequence homology of p90 with both bovine and rat transferrins. The 1U primer was based on the p90 sequence homology with serotransferrin precursor protein and the 3' side of rat transferrin. The 4U/420L set of primers was used as a nest primer for 1U/490 (Table 1Go).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Primers used for cloning of adrenotransferrin

 
Rat adrenal gland expression cDNA library pCMV.SPORT 6 (1.9 x 108 colony-forming units) containing an average insert size of at least 1 kb was constructed (Life Technologies, Rockville, MD). The PCR consisted of the following mixture: 1U primer (10 µM) 1 µl, 490L primer (10 µM) 1 µl, template rat adrenal gland cDNA library pCMV.SPORT 6 plasmid (160 ng/µl) 1 µl, 1x display-complete buffer, display TAQ-FL (5 U/µl) 0.5 µl, and H2O 19 µl in a total volume of 25 µl. The Touchdown 1 program was selected and used as follows: 94 C for 4 min; 94 C for 30 sec, 72 C for 30 sec (-1.5 C per cycle), 72 C for 1 min x 10 cycles; 94 C for 30 sec, 55 C for 30 sec, 72 C for 1 min x 40 cycles; 72 C for 8 min; 4 C until use. Only 1 µl of the PCR product described above was used for the nest PCR, for which we used the 4U primer (10 µM) 2 µl, 420L primer (10 µM) 2 µl, 1 x display-complete buffer, display TAQ-FL (5 U/µl) 0.5 µl, and H2O 17 µl, in a total volume of 25 µl. The Touchdown 2 program was used as follows: 94 C for 4 min; 94 C for 30 sec, 72 C for 30 sec (-1.5 C per cycle), 72 C for 2 min x 8 cycles; 94 C for 30 sec, 60 C for 30 sec, 72 C for 2 min x 40 cycles; 72 C for 8 min; and 4 C until use. The final nest PCR product was submitted to agarose gel (1.5%) electrophoresis, which revealed one single band about 800 bp in size. The band was purified and subcloned into PGEM-T easy vector. After transformation using the DH5{alpha} competent cells and plasmid purification using QIAGEN plasmid purification kit, the final product was sequenced.

Because of the high homology of p90 to serotransferrin precursor protein, we based the design of the second set of primers on the serotransferrin precursor protein cDNA sequence. The following primers were based on serotransferrin precursor protein mRNA sequence:

103U: TCCTGCCACACTGCAGTAGACAGAACCG;

788L: GTGCATGCTTCCAGGAGTTTTGAGGTTG.

The PCR was carried out as described above. In brief, 103U primer (10 µM) 2 µl, 788L primer (10 µM) 2 µl, template rat adrenal gland cDNA Library pCMV.SPORT 6 plasmid (160 ng/µl)1 µl, 1x display-complete buffer, display TAQ-FL (5 U/µl) 0.5 µl, and H2O 17 µl were mixed in a total volume of 25 µl. The Touchdown 1 program was used as previously described. A fraction of the PCR product was submitted to 1.5% agarose gel electrophoresis, which revealed a single 700-bp band. The same steps as described above were followed before sequencing.

Corticosterone and protein measurements
Corticosterone levels were measured in the culture media by RIA as previously described (15). Protein levels were quantified by the dye-binding assay of Bradford (19) using {gamma}-globulin as the standard.

Preparation of rat adrenal cortex protein extracts
Rat adrenal cortex was dissected from 80-d-old male Sprague Dawley rats, immediately frozen in liquid nitrogen, and stored at -80 C. Tissue was disrupted in 100 mM potassium phosphate buffer (pH 7.0) containing 1 mM phenylmethylsulfonyl fluoride. After removing the intact cells and cell debris by centrifugation at 15,000 x g for 30 min at 4 C, cell lysates were collected and used for iron staining. Protein levels were quantified as described above.

Iron staining of rat adrenal cortex proteins
To identify iron-binding proteins, NH4Fe(SO4)2·12H2O was added at 1 mM final concentration to both the crude adrenal cortex extract and human transferrin. The incubation was carried out at room temperature for 1 h. The crude adrenal cortex extract and human transferrin were then resolved onto a 4–20% nondenaturing PAGE (native PAGE). The gel was stained with 0.75 mM Ferene S, 15 mM thioglycolic acid in 2% (vol/vol) acetic acid as previously described (20). Using this method, proteins that bind iron are stained blue.

Dot blot immunoassay of iron-binding proteins and molecular weight characterization
After the identification of iron-binding proteins in native PAGE, the bands were cut out and eluted from the gel using elution buffer containing 0.1% sodium dodecyl sulfate, 0.05 M Tris-HCl (pH 7.9 at 25 C), 0.1 mM EDTA, 5 mM dithiothreitol, 0.1 mg/ml BSA, and 0.15 M NaCl. Proteins were allowed to elute for 1 h at 25 C with occasional agitation (21). The mixture was then centrifuged to pellet the crumbled gel, denaturing reducing Tris-glycine SDS-PAGE sample buffer was added to the supernatant, boiled for 3 min, and used either for immunoassay dot blot or proteins were resolved onto a 4–20% denaturing SDS-PAGE. After transfer onto PVDF membranes, using the Bio-Dot apparatus (Bio-Rad, Hercules, CA), the membranes were incubated with the antimelanotransferrin antibody as described above. SDS-PAGE gel was stained with Coomassie Brilliant Blue R solution and destained in acetic acid solution.

Statistics
Statistical analysis was performed with the Student’s t test using the InStat package (GraphPad Inc., San Diego, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
ACTH-induced stimulation of corticosterone synthesis by cultured rat adrenocortical cells
Adrenocortical cells were prepared from rats that had been treated with either saline or GKB. Cells were maintained in culture for 48 h and then stimulated with 10 ng/ml ACTH for 3 h. The cells obtained from saline-treated rats responded to ACTH by producing high amounts of corticosterone. This ACTH-induced increase in corticosterone synthesis was inhibited by about 70% (P < 0.001) in cells obtained from GKB-treated animals (Fig. 1AGo).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. A, Effect of ACTH on corticosterone synthesis by rat adrenocortical cells. Cells were obtained from animals injected ip with GKB (2 mg/kg·d) or saline solution (NaCl 0.9%) for 8 d. Animals were killed on d 9, and adrenals glands were collected. Adrenocortical cells were prepared as described in Materials and Methods. Cells (0.5 x 106 cells/well) were incubated for 3 h in the presence of ACTH (10 ng/ml), and then the medium was collected for measurement of corticosterone production by RIA. Values represent means ± SEM from three independent experiments (n = 8). B, Effect of treatment with GKB or saline on the response of isolated adrenocortical cells to ACTH. Adrenocortical cells were isolated from either GKB or saline-treated animals and were cultured for 2 d as described in Materials and Methods. Cells were then incubated in the presence of a saturating concentration of ACTH (10 ng/ml) for 3 h. 2D-PAGE analysis of the proteins and silver staining were carried out as described in Materials and Methods. Enlarged pictures of the 90-kDa, pI 6.8–7.1 silver-stained protein spots affected by the GKB treatment are shown. C, Immunoblot carried out after separation of proteins (loads normalized to 30 µg) by 2D-PAGE as described in Materials and Methods. The immunoreactive 90-kDa melanotransferrin protein is shown.

 
Inhibition of the p90 expression by GKB
We have based these experiments on our previously published studies, which showed the effect of GKB on newly synthesized [35S]methionine-radiolabeled proteins in the presence or absence of ACTH (15). In the previous study, radiolabeled proteins were visualized by autoradiography (15). In the present experiments, ex vivo cultured cells were submitted to 2D-PAGE followed by silver staining. Figure 1BGo shows the silver-stained ACTH-induced 90-kDa (p90) protein complex (pI 6.8–7.1) and its inhibition by GKB.

Sequence analysis and identification of a serotransferrin precursor homolog
The spots corresponding to p90 were collected and submitted to MALDI-MS sequencing (Fig. 2Go). The analysis revealed that p90 matched well with serotransferrin precursor (siderophilin; ß1-metal binding globulin; bovine transferrin) a protein of theoretical pI 6.50 and average mass 75,829. A number of small peaks were identified, but these did not match transferrin, and when they were used to search the database, there was no match. Fragments matching those identified in Fig. 2Go are shown in Table 2Go.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Mass spectral analysis of p90. MALDI-MS was performed as described in Materials and Methods.

 

View this table:
[in this window]
[in a new window]
  		TABLE 2. MALDI-MS analysis identifies p90 as a member of the transferrin protein family

 
Identification of an immunoreactive melanotransferrin protein
According to its molecular mass, p90 differs from serotransferrin precursor protein by about 14 kDa. Two-dimensional immunoblot analysis of p90 using antitransferrin antisera failed to identify this protein as transferrin. Because of the similar sizes of p90 and the 97-kDa melanotransferrin, we used a human antimelanotransferrin monoclonal antibody to examine whether these two proteins share common epitopes. Figure 1CGo shows that p90 was recognized by the human melanotransferrin monoclonal antibody.

Cloning and sequencing of the adrenotransferrin
The nonmatching fragments detected by MALDI-MS were used to clone the new protein. 1U/490L PCR and 4U/420L nest PCR yielded an 800 bp product that is homologous to rat transferrin (gi:8394438) mRNA sequence 454-1253, and 103U/788L PCR yielded 700-bp products that are homologous to rat transferrin mRNA sequence 1416–2089. Search for the p90 protein sequence through the National Center for Biotechnology Information databases identified putative conserved domains of transferrin. The adrenal p90 shares 54% identity with rat transferrin, 79% identity with bovine serotransferrin precursor protein and 32.8% identity with human melanotransferrin. Based on these findings, we named rat adrenal p90 "adrenotransferrin."

Amino acid sequence alignment among adrenotransferrin, serotransferrin precursor protein, rat transferrin and human melanotransferrin were performed using the ClustalW method. Identical amino acid residues are dark-shaded with reverse typeface and similar residues are blocked in gray (Fig. 3Go). Higher amino acid sequence homology has a higher score. Aligned scores are as follows: adrenotransferrin to serotransferrin precursor protein is 100, adrenotransferrin to rat transferrin is 64, and adrenotransferrin to human melanotransferrin is 40.



View larger version (95K):
[in this window]
[in a new window]
  		FIG. 3. Amino acid sequence alignment among rat adrenotransferrin (AdrenoTf), bovine serotransferrin precursor (Sideropholin) (SeroTf), rat transferrin (R.Tf), and human melanotransferrin (H.MTf). GenBank accession numbers are as follows: bovine serotransferrin precursor (Sideropholin) (Q29443), rat transferrin (NP_058751), and human melanotransferrin (AAA59992). Identical amino acid residues are dark shaded with reverse typeface, and similar residues are blocked in gray. Sequence alignment was performed using the ClustalW method. Aligned scores: AdrenoTf to SeroTf is 100, AdrenoTf to R.Tf is 64, and AdrenoTf to H.MTf is 40.

 
Iron-binding activity of rat adrenal cortex proteins
In search of the function of the identified protein, the iron-binding ability of rat adrenal cortex proteins was examined. Human transferrin was used as the positive control. As shown in Fig. 4AGo, both iron-loaded native human transferrin (lane 1) and iron-loaded adrenal cortex preparations (lanes 2 and 3) were separated on native PAGE and visualized using Ferene S. The characteristic Ferene S-iron staining revealed iron-binding proteins that were visualized as blue bands. Subsequently, three major proteins were identified in rat adrenal cortex and labeled iron-binding proteins 1–3. Iron-binding protein 2 exhibited a molecular size similar to human transferrin used as control, whereas iron-binding proteins 1 and 3 showed higher and lower molecular sizes respectively, than the control. Adrenal cortex extracts incubated without NH4Fe(SO4)2·12H2O showed a very weak staining (data not shown), probably due to endogenous iron bound to the protein, thus demonstrating the specificity of the reaction. These data clearly indicate that the rat adrenal cortex contains iron-binding proteins.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. Adrenotransferrin is an iron-binding protein. A, Iron-loaded protein preparations were electrophoresed on native PAGE (4%–20%) and stained with Ferene S. Lane 1, Human transferrin (100 µg); lanes 2 and 3, crude extract (15 µg) from rat adrenal cortex. Specific iron staining, indicative of the presence of an iron-binding protein, shows a blue band. In adrenal cortex, three major proteins were stained by Ferene S: iron-binding proteins 1–3. B, Dot blot immunoassay of the above mentioned iron-binding proteins. Among the three different iron binding proteins, only iron-binding protein 1 showed increasing immunoreactivity to the antimelanotransferrin antibody. C, Coomassie blue staining of iron-binding protein 1 cut out and eluted from the native gel, incubated in denaturing reducing conditions and run (lane 2) in parallel with molecular weight markers (lane 1; SeeBlue Plus2 prestained standards from Invitrogen) on SDS-PAGE.

 
Identification of an iron-binding immunoreactive melanotransferrin protein
Figure 4BGo shows that iron-binding protein 1 was recognized by the human melanotransferrin monoclonal antibody. Interestingly, iron-binding protein 1 migrated in the native gel at a position higher than the 80-kDa human transferrin control. Serial dilution of iron-binding protein 1 ranging from 0.22 µg, 1.08 µg, 2.17–6.51 µg showed a dose-dependent immunoreactivity, thus demonstrating the specificity of the antibody used. Iron-binding proteins 2 and 3, however, showed either weak or no immunoreactivity to the antimelanotransferrin antibody. For further characterization of the molecular weight of iron-binding protein 1, the protein band was cut out and eluted from the native gel, incubated in denaturing reducing conditions, separated onto SDS-PAGE in parallel with molecular mass markers and stained by Coomassie blue. Figure 4CGo shows that the eluted immunoreactive iron-binding protein 1 has a molecular size of approximately 90 kDa.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Ginkgo biloba extracts have been widely prescribed for their therapeutic actions. Their major clinical use is in central nervous system protection, age-related cognitive decline and deterioration of learning skills and memory (22, 23). Beneficial effects of Ginkgo biloba extracts have also been observed in patients suffering from Alzheimer’s disease (24, 25). In addition to these effects, EGb 761 has been shown to have antistress properties distinct from those of traditional antidepressants and anxiolytics (26, 27). We have demonstrated that EGb 761 and its purified component GKB decrease stress-induced elevations of serum corticosterone without affecting physiological basal levels (14). Thus, the action of the extract appears to be limited to situations involving detrimental chronic stress. Surprisingly, examination of its effect on plasma ACTH levels failed to demonstrate the anticipated increase (in ACTH) that normally occurs secondary to activation of the regulatory negative feedback loop in response to decreased serum corticosterone levels. Instead, the natural extract did not affect ACTH levels (14), indicating that it contains an additional component that can regulate ACTH secretion. This constituted a crucial finding because prolonged adrenal hyperstimulation secondary to chronically elevated ACTH levels would eventually lead to adrenal hyperplasia and tumor formation.

In searching for the mechanism of action of EGb 761 and GKB we used an ex vivo paradigm in which rats were treated with EGb 761 or GKB before harvesting their adrenocortical cells to examine responses to ACTH in relation to steroid formation and protein synthesis (15). One of the proteins affected by the treatment was PBR, in agreement with previous findings which showed that EGb 761 and GKB down-regulate this 18-kDa PBR protein and its ligand binding capacity (14). In addition, we have focused our efforts on characterizing a 90-kDa (pI 6.8–7.1) protein complex (p90) that was induced by ACTH treatment and inhibited by in vivo treatment with GKB (15). Considering our previous finding that ACTH induced the de novo synthesis of p90 in metabolic labeling studies (15), we used unlabeled proteins and followed their expression by silver staining in the present experiments. The p90 spots were isolated from two-dimensional gels, and MALDI-MS analysis revealed sequences with a high degree of homology (79%) to serotransferrin precursor protein, and a lesser degree to rat transferrin (54%) and human melanotransferrin (32.8%). Considering that serotransferrin precursor protein is identical with bovine transferrin, it should be noted that we did not use any materials/chemicals of bovine origin in these experiments and that we also reported that ACTH induced the de novo synthesis of p90, thus excluding the possibility of cross-contamination. Serotransferrin precursor protein has a theoretical pI of 6.50 and average mass of 75.8 kDa, bovine transferrin is a 77-kDa protein with a pI close to 7, whereas the identified adrenal transferrin homolog has a molecular mass of 90 kDa and a pI of 6.8–7.1. Transferrin has been extensively studied in the gonads of various species, where it plays an important role in the regulation of spermatogenesis (28, 29). However, transferrin mRNA expression has not been detected in the adrenal gland (30) and the functional significance of transferrin, if present in the adrenal gland, has not yet been explored.

Interestingly, p90 shared homology and was recognized by a monoclonal antibody raised against human melanotransferrin. Melanotransferrin is a 97-kDa protein that was originally identified, using monoclonal antibodies, as a human tumor-associated antigen expressed at high levels in melanomas (31, 32) but present at low levels in normal tissues (30). Its amino acid sequence shares 40% identity with transferrin, and it binds iron and stimulates iron uptake in the absence of transferrin and the transferrin receptor (33). Its gene is located on chromosome 3, like those of transferrin and the transferrin receptor (33). Melanotransferrin has also been localized in reactive microglial cells associated with senile plaques in Alzheimer’s disease (34, 35), and increased levels of melanotransferrin have been found in cerebrospinal fluid and serum of Alzheimer’s disease patients, indicating that it might be useful as a diagnostic marker of the disease (36, 37, 38).

To the best of our knowledge, this is the first report describing the presence of a serotransferrin precursor protein homolog belonging to the transferrin family of proteins and sharing epitopes with melanotransferrin in the adrenal gland, its induction by ACTH, and its sensitivity to treatment with GKB. We name this protein "adrenotransferrin." Because the role of adrenotransferrin in the adrenal gland remains unknown, its presence in this extremely vascular organ, which is very sensitive to oxidative damage, indicates its possible involvement in iron uptake and oxidative stress. In addition, it could be involved in regulating the activity of cytochrome P450 hemoproteins, the enzymes that catalyze steroidogenesis. To determine the function of adrenotransferrin in the adrenal gland, we used an iron-binding assay followed by immunoblot analysis using the antimelanotransferrin monoclonal antibody. Our data demonstrated the iron-binding capacity of adrenotransferrin, thus confirming its role as iron-binding protein. Adrenotransferrin might be involved in numerous physiological processes in the adrenal physiology and its modulation may have a direct impact on the gland’s function. Unfortunately, despite numerous efforts we were unable to obtain a full-length cDNA-encoding adrenotransferrin, and our efforts in this direction continue.

The regulation of adrenotransferrin expression by EGb 761 and GKB is of interest because of the current use of EGb 761 in treating Alzheimer’s disease (24, 25). Whether the effect of EGb 761 on adrenotransferrin plays a role in the mechanism underlying the tissue-specific regulation of glucocorticoid synthesis by the extract remains to be investigated. In addition, the possibility that EGb 761 may control melanotransferrin expression in Alzheimer’s disease brain, where its expression is dramatically increased (33, 36, 37) and where excessive iron deposition has been reported (38, 39), is also of great interest. Moreover, it should be noted that melanotransferrin may be involved in other functions unrelated to iron transport, such as endothelial cell migration and angiogenesis (40), properties important for the development and function of the highly vascularized adrenal gland. The physiological and pathophysiological significance of adrenotransferrin in adrenal function remains to be determined.


   Footnotes
 
This work was supported by a grant from the Institut Henri Beaufour-Institut de Produits de Synthèse et d’Extraction Naturelle.

Abbreviations: 2D-PAGE, Two-dimensional electrophoresis; EGb 761, an extract of Ginkgo biloba; GKB, ginkgolide B; MALDI-MS, matrix-assisted laser desorption ionization mass spectrometry; PBR, peripheral-type benzodiazepine receptor; pI, isoelectric point; PVDF, polyvinylidene fluoride.

Received November 12, 2003.

Accepted for publication December 19, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chrousos GP, Gold PW 1992 The concepts of stress and stress system disorders. Overview of physical and behavioral homeostasis. JAMA 267:1244–1252[Abstract]
  2. Munck A, Naray-Fejes-Toth A 1994 Glucocorticoids and stress: permissive and suppressive actions. Ann NY Acad Sci 746:115–133[Medline]
  3. Sapolsky RM 1999 Glucocorticoids, stress, and their adverse neurological effects: relevance to aging. Exp Gerontol 34:721–732[CrossRef][Medline]
  4. Sapolsky RM 1994 The physiological relevance of glucocorticoid endangerment of the hippocampus. Ann NY Acad Sci 746:294–304[Medline]
  5. McEwen BS 1994 Corticosteroids and hippocampal plasticity. Ann NY Acad Sci 746:134–142[Medline]
  6. Orrell MW, O’Dwyer A-M 1995 Dementia, ageing, and the stress control system. Lancet 345:666–667[CrossRef][Medline]
  7. Kiraly SJ, Ancill RJ, Dimitrova G 1997 The relationship of endogenous cortisol to psychiatric disorder: a review. Can J Psychiatry 42:415–420[Medline]
  8. O’Brien JT, Ames D, Schweitzer I, Mastwyk M, Colman P 1996 Enhanced adrenal sensitivity to adrenocorticotrophic hormone (ACTH) is evidence of HPA axis hyperactivity in Alzheimer’s disease. Psychol Med 26:7–14[Medline]
  9. Papadopoulos V 1993 Peripheral-type benzodiazepine/diazepam binding inhibitor receptor: biological role in steroidogenic cell function. Endocr Rev 14:222–240[CrossRef][Medline]
  10. Jefcoate C 2002 High-flux mitochondrial cholesterol trafficking, a specialized function of the adrenal cortex. J Clin Invest 110:881–890[CrossRef][Medline]
  11. Anholt RRH, Pedersen PL, DeSouza EB, Snyder SH 1986 The peripheral-type benzodiazepine receptor: localization to the mitochondrial outer membrane. J Biol Chem 261:576–583
  12. Amri H, Li H, Culty M, Gaillard J-L, Teper G, Papadopoulos V 1998 The peripheral-type benzodiazepine receptor and adrenal steroidogenesis. Curr Opin Endocrinol Diab 6:179–184
  13. Zilz A, Li H, Castello R, Papadopoulos V, Widmaier EP 1999 Developmental expression of the peripheral-type benzodiazepine receptor and the advent of steroidogenesis in rat adrenal glands. Endocrinology 140:859–864[Abstract/Free Full Text]
  14. Amri H, Ogwuegbu SO, Boujrad N, Drieu K, Papadopoulos V 1996 In vivo regulation of the peripheral-type benzodiazepine receptor and glucocorticoid synthesis by the Ginkgo biloba extract EGb 761 and isolated ginkgolides. Endocrinology 137:5707–5718[Abstract]
  15. Amri H, Drieu K, Papadopoulos V 1997 Ex vivo regulation of adrenal cortical cell steroid and protein synthesis, in response to adrenocorticotropic hormone stimulation, by the Ginkgo biloba extract EGb 761 and isolated ginkgolides. Endocrinology 138:5415–5426[Abstract/Free Full Text]
  16. Amri H, Drieu K, Papadopoulos V 2003 Transcriptional suppression of the adrenal cortical peripheral-type benzodiazepine receptor gene and inhibition of steroid synthesis by ginkgolide B. Biochem Pharmacol 65:717–729[CrossRef][Medline]
  17. O’Farrell PH 1975 High resolution two-dimensional electrophoresis of proteins. J Biol Chem 250:4007–4021[Abstract/Free Full Text]
  18. Shevchenko A, Willm M, Vorm O, Mann M 1996 Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68:850–858[Medline]
  19. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  20. Chung MC 1985 A specific iron stain for iron-binding proteins in polyacrylamide gels: application to transferrin and lactoferrin. Anal Biochem 148:498–502[CrossRef][Medline]
  21. Hager DA, Burgess RR 1980 Elution of proteins from sodium dodecyl sulfate-polyacrylamide gels, removal of sodium dodecyl sulfate, and renaturation of enzymatic activity: results with sigma subunit of Escherichia coli RNA polymerase, wheat germ DNA topoisomerase, and other enzymes. Anal Biochem 109:76–86[CrossRef][Medline]
  22. DeFeudis FV 1998 Ginkgo biloba Extract (EGb 761): from chemistry to the clinic. Wiesbaden, Germany: Ullstein Medical
  23. Christen Y, Courtois Y, Droy-Lefaix MT (eds) 1995 Effects of Ginkgo biloba extract (EGb 761) on aging and age-related disorders. Paris: Elsevier
  24. Hofferberth B 1994 The efficacy of EGb 761 in patients with senile dementia of the Alzheimer type, a double-blind, placebo-controlled study on different levels of investigation. Hum Psychopharm 9:215–222[CrossRef]
  25. Le Bars PL, Katz MM, Berman N, Itil TM, Freedman AM, Schatzberg AF 1997 A placebo-controlled, double-blind, randomized trial of an extract of Ginkgo biloba for dementia. North American EGb Study Group. JAMA 278:1327–1332[Abstract]
  26. Porsolt RD, Martin P, Lenegre A, Fromage S, Drieu K 1990 Effects of an extract of Ginkgo biloba (EGB 761) on "learned helplessness" and other models of stress in rodents. Pharmacol Biochem Behav 36:963–971[CrossRef][Medline]
  27. Rapin JR, Lamproglou I, Drieu K, DeFeudis FV 1994 Demonstration of the "anti-stress" activity of an extract of Ginkgo biloba (EGb 761) using a discrimination learning task. Gen Pharmacol 25:1009–1016[Medline]
  28. Chaudhary J, Skinner MK 1995 Transcriptional regulation of Sertoli cell differentiation (transferrin promoter activation) during testicular development. Dev Genet 16:114–118[CrossRef][Medline]
  29. Syed V, Hecht NB 1997 Up-regulation and down-regulation of genes expressed in cocultures of rat Sertoli cells and germ cells. Mol Reprod Dev 47:380–338[CrossRef][Medline]
  30. Aldred AR, Dickson PW, Marley PD, Schreiber G 1987 Distribution of transferrin synthesis in brain and other tissues in the rat. J Biol Chem 262:5293–5297[Abstract/Free Full Text]
  31. Brown JP, Woodbury RG, Hart CE, Hellstrom I, Hellstrom KE 1981 Quantitative analysis of melanoma-associated antigen p97 in normal and neoplastic tissues. Proc Natl Acad Sci USA 78:539–543[Abstract/Free Full Text]
  32. Rose TM, Plowman GD, Teplow DB, Dreyer WJ, Hellstrom KE, Brown JP 1986 Primary structure of the human melanoma-associated antigen p97 (melanotransferrin) deduced from the mRNA sequence. Proc Natl Acad Sci USA 83:1261–1265[Abstract/Free Full Text]
  33. Sekyere E, Richardson DR 2000 The membrane-bound transferrin homologue melanotransferrin: roles other than iron transport? FEBS Lett 483:11–16[CrossRef][Medline]
  34. Jeffries WA, Food MR, Gabathuler R, Rothenberger S, Yamada T, Yasuhara O, McGeer PL 1996 Reactive microglia specifically associated with amyloid plaques in Alzheimer’s disease brain tissue express melanotransferrin. Brain Res 712:122–126[CrossRef][Medline]
  35. Yamada T, Tsujioka Y, Taguchi J, Takahashi M, Tsuboi Y, Moroo I, Yang J, Jeffries WA 1999 Melanotransferrin is produced by senile plaque-associated reactive microglia in Alzheimer’s disease. Brain Res 845:1–5[CrossRef][Medline]
  36. Feldman H, Gabathuler R, Kennard M, Nurminen J, Levy D, Foti S, Foti D, Beattie BL, Jefferies WA 2001 Serum p97 levels as an aid to identifying Alzheimer’s disease. J Alzheimers Dis 3:507–516[Medline]
  37. Kim DK, Seo MY, Lim SW, Kim S, Kim JW, Carroll BJ, Kwon DY, Kwon T, Kang SS 2001 Serum melanotransferrin, p97 as a biochemical marker of Alzheimer’s disease. Neuropsychopharmacology 25:84–90[CrossRef][Medline]
  38. Kennard ML, Feldman H, Yamada T, Jeffries WA 1996 Serum levels of the iron binding protein p97 are elevated in Alzheimer’s disease. Nat Med 2:1230–1235[CrossRef][Medline]
  39. Bishop GM, Robinson SR, Liu Q, Perry G, Atwood CS, Smith MA 2002 Iron: a pathological mediator of Alzheimer disease? Dev Neurosci 24:184–187[CrossRef][Medline]
  40. Sala R, Jefferies WA, Walker B, Yang J, Tiong J, Law SK, Carlevaro MF, Di Marco E, Vacca A, Cancedda R, Cancedda FD, Ribatti D 2002 The human melanoma associated protein melanotransferrin promotes endothelial cell migration and angiogenesis in vivo. Eur J Cell Biol 81:599–607[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amri, H.
Right arrow Articles by Papadopoulos, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amri, H.
Right arrow Articles by Papadopoulos, V.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals