help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2004-0144
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, W.
Right arrow Articles by Riccardi, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, W.
Right arrow Articles by Riccardi, D.
Endocrinology Vol. 145, No. 12 5786-5797
Copyright © 2004 by The Endocrine Society

Coexpression of Corticotropin-Releasing Hormone and Urotensin I Precursor Genes in the Caudal Neurosecretory System of the Euryhaline Flounder (Platichthys flesus): A Possible Shared Role in Peripheral Regulation

Weiqun Lu, Louise Dow, Sarah Gumusgoz, Matthew J. Brierley, Justin M. Warne, Catherine R. McCrohan, Richard J. Balment and Daniela Riccardi

School of Biological Sciences, University of Manchester, Oxford Road M13 9PT, United Kingdom

Address all correspondence and requests for reprints to: Daniela Riccardi, Ph.D., Cardiff School of Biosciences, P.O. Box 911, Cardiff CF11 3US, Wales, United Kingdom. E-mail: RiccardiD{at}cardiff.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRH and urotensin I (UI) are neuroendocrine peptides that belong to the superfamily of corticotropin-releasing factors. In mammals, these peptides regulate the stress response and other central nervous system functions, whereas in fish an involvement for UI in osmoregulation has also been suggested. We have identified, characterized, and localized the genes encoding these peptides in a unique fish neuroendocrine organ, the caudal neurosecretory system (CNSS). The CRH and UI precursors, isolated from a European flounder CNSS library, consist of 168 and 147 amino acid residues, respectively, with an overall homology of approximately 50%. Both precursors contain a signal peptide, a divergent cryptic region and a 41-amino acid mature peptide with cleavage and amidation sites. Genomic organization showed that whole CRH and UI coding sequences are contained in a single exon. Northern blot analysis and quantitative PCR of a range of tissues confirmed the CNSS as a major site of expression of both CRH and UI and thus serves as a likely source of circulating peptides. In situ hybridization demonstrated that CRH and UI colocalize to the same cells of the CNSS. Our findings suggest that, in euryhaline fish, the CNSS is a major site of production of CRH and probably contributes to the high circulating levels observed in response to specific environmental challenges. Furthermore, the localization of CRH and UI within the same cell population suggests an early, possibly shared role for these peptides in controlling stress-mediated adaptive plasticity.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CRH IS A 41-AMINO ACID polypeptide originally isolated from ovine hypothalamus (1). Two CRH-like peptides, the 40-amino acid amphibian peptide sauvagine (2) and the 41-amino acid fish urotensin I (UI) (3, 4) were originally considered to be CRH homologs in fish and amphibians. CRH- and UI-related peptides are found throughout vertebrate species from fish to man (5, 6, 7, 8). In mammals, CRH is the primary hypothalamic factor mediating stress-induced ACTH secretion from the anterior pituitary and under normal conditions, circulating CRH levels in human are low (9, 10, 11). Circulating CRH in mammals is derived largely from hypothalamic secretion into hypothalamic pituitary portal system. In contrast fish, which have high circulating levels of CRH in association with specific stresses (12), lack such a hypothalamic vascular link and the existence of sites of CRH production outside the central nervous system has not been investigated.

Although UI is present in specific brain regions in both fish and mammals, a major source of UI in the circulation of fish is thought to be the caudal neurosecretory system (CNSS). This neuroendocrine structure, unique to fish, is located in the terminal vertebral segments, and comprises many large, peptide-synthesizing neurones, the Dahlgren cells. These combine to form nonmyelinated axonal tracts terminating in a discrete neurohemal organ (13), which functionally is reminiscent of that of the anterior neurohypophysis. Here the secretory products, UI and urotensin II (UII), are concentrated within axonal enlargements, the site of storage and subsequent secretion into the general circulation (14). CNSS peptides have been implied in osmoregulation, reproductive biology, and perhaps nutritional behavior (15). We have previously shown that UI stimulates cortisol secretion from the interrenal tissue (16) and proposed that the CNSS may afford stress specific activation of interrenal cortisol secretion, independently of the hypothalamic-pituitary (CRH/ACTH) pathway (13). It is therefore possible that, at the evolutionary level of fish, the separation of CRH (stress axis activation) and UI (nutrition, ionoregulation, and cardiovascular) functions, apparent in mammals, is less complete. Indeed, in view of the recent observation of high circulating CRH levels in tilapia in response to stress (12), which are unlikely to be of hypothalamic origin, in the current study we have examined whether the CNSS could be a potential neuroendocrine source of CRH. Accordingly, initial characterization of UI and CRH gene structures is essential to investigate the potential separate expression of these closely related peptides in the CNSS.

Here, we report the isolation and characterization of the cDNAs encoding CRH and UI, derived from the cluster of perikarya comprising the CNSS in the euryhaline European flounder. Gene analysis by genomic sequencing and Southern blotting is also reported. In addition, the tissue distribution and size of the CRH and UI transcripts is assessed by Northern blot analysis, together with quantitative RT-PCR (qPCR). Finally, the CNSS distributions for CRH and UI mRNAs have been characterized by in situ hybridization, and CRH and UI peptide localization throughout the CNSS is confirmed by immunocytochemistry.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Adult flounders (Platichthys flesus) were obtained from Morecambe Bay (Cumbria, UK) and maintained at the University of Manchester in recirculating, filtered seawater tanks at 10–12 C under a 12-h light, 12-h dark photoperiod.

RNA preparation
Fish were killed using a standard protocol detailed under UK home office license procedures. Fish tissues from 20 animals (optic nerve, brain, spinal cord, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad) were rapidly dissected out, including the caudal 8 segments of the spinal cord and separate urophysis (CNSS). The brain was further dissected into five regions (forebrain, midbrain, hindbrain, hypothalamus, and pituitary). Tissues were homogenized in 4 M guanidium thiocyanate buffer (pH 7.5) containing 1% ß-mercaptoethanol. Total RNA was extracted by ultracentrifugation at 27,000 x g for 20 h on a bed of 5.7 M cesium trifluoroacetate (Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK). Before RT, RNA for both RT-PCR and library construction was treated with deoxyribonuclease (DNase) (Roche, East Sussex, UK), according to manufacturer’s instructions. mRNA was purified from 20 CNSS using a Dynabeads mRNA Direct kit (Dynal, Wirral, UK).

cDNA library construction
A full-length CNSS cDNA library was constructed into the phage vector {lambda}-TriplEx2 using SMART cDNA library construction kit (CLONTECH, Oxford, UK) and gigapack III gold packaging kit (Stratagene, Amsterdam, The Netherlands), following the protocols provided. The primary library contained two million plaque-forming units.

Cloning of the CRH and UI cDNAs
Partial cloning of the coding region.
From the conserved amino acid sequences of alignment of a range of vertebrate CRH, two degenerate primers were designed for use in PCR. The upstream sense primer sequence (ps-1) was: 5'-SARGGNAARGTNGGNAAYAT-3' and encoded for the peptide W/QGKVGN(I). The downstream antisense primer (pas-1) sequence was: 5'-TTNSWNTGNGCYTGYTGNGC-3', and encoded the peptide AQQAQ/HN/S(N). The CRH primers amplified the nucleotide (nt) region 493–674 of the flounder CRH sequence (Fig. 1AGo).



View larger version (72K):
[in this window]
[in a new window]
  		FIG. 1. Nucleotide and deduced amino acid sequences of flounder preproCRH (A) and preproUI cDNA (B). Deduced amino acid sequence (single capital letters) begins at nt 199 for CRH and 67 for UI. The signal peptide is indicated in bold italics, the prepeptide (cryptic region) in normal letters, and the mature peptide in bold letters. The stop codon is indicated by an asterisk. The polyadenylation signals (AATAAA) are in bold letters. The exon-intron-exon boundaries are underlined in bold letters. cDNA-specific PCR primers are underlined.

 
From the known amino acid sequences of UI of P. flesus (17), two degenerate primers were designed for use in PCR. An upstream sense primer, ps-1 (5'-GARGAYCCNCCNATGWSNATHG-3') encoded the peptide EDPPMSI(D). Pas-1 (5'-CKRTTDATYTGNGCYTGYTC-3'), encoded the peptide EQAQIN(R). The UI primers amplified the region between nt 382–482 of the flounder UI sequence (Fig. 1BGo).

Using mRNA equivalent to one CNSS, the first-strand cDNA synthesis and PCR were performed as described in the SuperScript II cDNA kit (Invitrogen Life Technologies, Paisley, Scotland, UK) using oligo deoxythymidine (dT)12–18. The reaction mixture was stored at –20 C (oligo dT-cDNA). Thirty-five cycles of PCR were performed using ps-1 and pas-1 degenerate primers with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, and 72 C for 2 min, using the step-cycle program on an ABI (Warrington, UK) 9700 DNA Thermal Cycler in 100 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 2 µl oligo dT-cDNA and 100 pmol each primer. After gel purification, approximately 20 ng of the PCR product were subcloned into pGEM T easy vector (Promega, Southampton, UK). Three clones were isolated, sequenced and found to be identical, containing an 182-bp fragment with an open reading frame (ORF) of 61 amino acids corresponding to CRH peptide and an 102-bp fragment with an ORF of 34 amino acids corresponding to UI peptide.

Cloning of full-length cDNAs
The full-length cDNA of CRH and UI were isolated by screening a CNSS cDNA library. A total of 1.0 x 105 plaques from the amplified library were plated out and transferred onto duplicate nitrocellulose membranes (PALL Life Sciences, Hampshire, UK). The membranes were hybridized at high stringency (described in colony and plaque hybridizations protocol, PALL Life Sciences) using specific CRH and UI probes obtained from degenerate RT-PCR. Positive plaques were isolated and two further rounds of screening were used to identify single positive plaques. The pTriplEx2 plasmid containing the positive insert was excised and circularized from the recombinant phage. Three isolates for each gene were sequenced.

Genomic organization
Southern blot analysis.
High molecular weight genomic DNA was isolated from muscle tissue of an individual flounder using established protocols (18). Ten-microgram samples of DNA were digested to completion with BamHI, HindIII, PvuII, or PstI, and the digested DNAs electrophoresed on a 0.7% agarose gel. The gel samples were partially hydrolyzed by acid depurination with 0.2 M HCl for 10 min, then denatured by soaking in 500 ml of 0.5 M NaOH, 1.5 M NaCl for 45 min at room temperature and neutralized in 500 ml of 1.0 M Tris-HCl (pH 7.4) containing 1.5 M NaCl for 45 min. The DNAs were then transferred to a Hybond N nylon membrane using 10x standard saline citrate (SSC) and cross-linked using UV radiation. Prehybridization was performed with QuickHyb solution (Stratagene) for 15 min at 68 C and hybridized with P. flesus CRH or UI cDNA probes at 68 C for 1 h. After hybridization, the blots were washed twice in 2x SSC, 0.1% sodium dodecyl sulfate (SDS) for 15 min at room temperature and then once in 0.1x SSC, 0.1% SDS at 55 C for 30 min. Autoradiographs were exposed at –70 C for 24 h.

Genomic DNA amplification
Twenty-five PCR cycles were performed using gene specific primers (CRHf21-CRHr518; CRHf509-CRHr959; CRHf866-CRHr1168; UIf2-UIr425; UIf258-UIr732; UIf711-UIr1168; UIf1150-UIr1585; for sequence, see Table 1Go) with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, and 72 C for 2 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 50 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 100 ng genomic DNA and 10 pmol each primer. After gel purification, approximately 20–50 ng of the PCR products were subcloned into pGEM T easy vector (Promega) for sequencing purposes. Three isolates were sequenced.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Gene-specific primers for CRH and UI

 
DNA sequencing and analysis
Double-stranded DNA sequencing was carried out using the Bigdye version 1.0 DNA sequencing kit (ABI). DNA and deduced protein sequences were aligned and compared using basic local alignment and search tool software and the EMBL/GenBank databases. The presence and location of signal peptide cleavage sites in amino acid sequences were predicted by using SignalP version 2.0 [Centre for Biological Sequence Analysis, Technical University of Denmark DTU (http://www.cbs.dtu.dk/services/SignalP)]. The sequence alignment and homology analysis was performed using DNAMAN (Lynnon, Canada) version 4.15 software.

Distribution of CRH and UI mRNA
Northern blot analysis.
Ten micrograms of total RNA from 15 flounder tissues (optic nerve, brain, spinal cord, CNSS, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad) were electrophoresed on a 1% agarose gel for 2.5 h at 150 V. The RNA was transferred onto Hybond N nylon membrane (Amersham Pharmacia Biotech), using 20x SSC prepared with diethylpyrocarbonate-treated water, and cross-linked to the membrane using UV radiation. The CRH and UI cDNA probes obtained from degenerate RT-PCR were prepared by random labeling with [32P]dCTP (Amersham Pharmacia Biotech). Hybridization was carried out in QuickHyb solution (Stratagene) at 68 C for 1 h. The blot was washed twice with 2x SSC containing 0.1% (wt/vol) SDS at room temperature for 15 min and once with 0.1x SSC containing 0.1% (wt/vol) SDS at 55 C for 30 min. Autoradiographs were exposed at –70 C overnight (longer exposure for a week was also applied for CRH and UI).

RT-PCR
Using 1 µg total RNA from the 15 fish tissues and five brain regions described above, the first strand cDNA was synthesized and PCR performed as described in the SuperScript II cDNA kit (Invitrogen Life Technologies) using oligo d(T)12–18. The reaction mixture (oligo dT-cDNA) was stored at –20 C. Forty cycles of PCR were performed using cDNA-specific primers (CRHf21-CRHr241; UIf41-UIr124; ActinF-ActinR; for sequence, see Table 1Go) with the following temperature profile: 95 C for 15 sec, 55 C for 15 sec, and 72 C for 1 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 25 µl of 50 mM KCl, 10 mM Tris/HCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each 5'-nucleotide triphosphate, containing 1 µl oligo dT-cDNA and 10 pmol each primer.

In situ hybridization
Preparation of CNSS sections.
The terminal region of the spinal cord, approximately the final eight vertebrae, with the urophysis attached, was dissected and fixed in 4% paraformaldehyde. Tissues were dehydrated through graded concentrations of ethanol and embedded in paraffin wax. Longitudinal 4 µm-thick sections were cut, mounted on positively charged slides, and incubated at 60 C for 5 d.

Labeling of the probes
Gene expression in tissue sections was detected by in situ hybridization using 35S-labeled RNA probes. cDNA clones that contained 204 bp CRH (680–883) and 278 bp UI (174–451) were digested with single restriction enzyme NcoI or SpeI. In the presence of the T7 or SP6 RNA polymerase (Promega) and 35S-UTP and unlabeled nucleotides, single-stranded RNA probes (riboprobes) were synthesized; the coding (sense) probe was used as a negative control. Plasmid DNA template was removed with an ribonuclease (RNase)-free DNase (Promega) digestion.

Hybridization procedure
After dewaxing in three changes of xylene, the sections were rehydrated through a series of ethanols and finally into water. All samples were then permeabilized in 0.2 M HCl for 20 min at room temperature. The samples were then incubated for 1 h in 2.5 g/ml proteinase K at 37 C. All samples were then postfixed in 4% paraformaldehyde. After prehybridization in 50% formamide and 0.6 M NaCl at 50 C for 1 h, each sample was then hybridized in 50% formamide and 0.6 M NaCl at 50 C overnight. Approximately 1.0 x 105 counts of riboprobe were added to each sample.

After overnight hybridization, the samples were washed twice at room temperature for 5min in 2x SSC and 10 mM dithiothreitol, then transferred to fresh 2x SSC for 1 h and subsequently for 4 h in wash buffer (50% formamide, 0.3 M NaCl, 20 mM Tris-HCl, 0.1 mM EDTA, and 10 mM dithiothreitol) at 50 C. The slides were then washed once in NTE buffer (0.5 M NaCl, 10 mM Tris-HCl, 0.1 mM EDTA) for 5 min, followed by RNase treatment (RNase A 20 µg/ml and RNase T1 100 U/ml) in NTE for 30 min at 37 C. The slides were then washed in NTE for 30 min at 37 C, overnight in wash buffer at 50 C, 30 min in 2x SSC and finally 30 min at room temperature in 0.1x SSC. Slides were then dehydrated in 90% ethanol and air-dried. Autoradiography was performed with Ilford (Cheshire, UK) K5 emulsion diluted 1:1 with distilled water. The slides were exposed for 7 d at 4 C, then developed in Ilford phenisol developer for 5 min, rinsed, fixed for 5 min, and counterstained with hematoxylin and eosin.

Western blotting
A CRH peptide was synthesized commercially from the deduced amino acid sequence of flounder C terminus 22–37 CRH, where CRH and UI show most difference. The peptide was used to raise antibodies in rabbits (Eurogentec, Seraing, Belgium). Partial UI peptide (flounder C terminus 24–41aa UI) was synthesized commercially and used to raise antibodies in rabbits (Biocarta, San Diego, CA). The antisera were purified by affigel affinity purification (Bio-Rad, Hertfordshire, UK). Initial experiments were carried out to demonstrate the specificity of the two antibodies by western blotting and immunocytochemistry.

The CRH and UI antibody specificity were tested by Western blotting on pure peptides and on urophysial protein samples. The standard commercial synthesized CRH and UI peptides were dissolved in dimethylsulfoxide and run under reducing conditions on a 15% SDS gel.

The urophysial samples were prepared by using a glass-to-glass homogenizer in 1% SDS with cocktail proteinase inhibitor. The homogenate was centrifuged at 12,000 x g for 5 min, and the supernatant electrophoresed under reducing conditions on a 15% SDS gel. After the run, the gel was blotted onto a polyvinylidene difluoride membrane and blocked with 5% milk. CRH and UI immunoreactive species were detected using rabbit antiflounder CRH (Eurogentec) and UI (Biocarta) antisera at a 1:100 and 1:300 dilution, respectively, applied overnight. As a secondary antibody we used a swine antirabbit Ig-horseradish peroxidase (1:1000, 1 h; DakoCytomation, Cambridgeshire, UK). The antigen-antibody complex was detected by chemiluminescence (Amersham Pharmacia Biotech) and visualized using the hyperfilm (Amersham Pharmacia Biotech). As negative control experiments we performed Western blotting with omission of the primary antibody and preabsorption of the antibody with the antigenic peptide.

Immunocytochemistry
Immunocytochemistry was carried out based on the method of Santos (19) using swine antirabbit antiserum (DakoCytomation) as the linking reagent and diaminobenzidine as the chromogen. Control experiments were carried out by omitting the primary antibody.

After dewaxing and rehydration, samples were blocked with 4% normal swine serum in PBS (containing 1% BSA and 0.1% NaN3) for 30 min at room temperature. The samples were then incubated with 1:600 CRH or UI antibodies (primary) in PBS/BSA at 4 C overnight. The samples were then washed three times at room temperature in PBS, and then incubated with 1:100 swine antirabbit secondary IgG (DakoCytomation) in PBS/Triton X-100 for 30 min. The slides were then covered with 1:200 rabbit PAP serum (DakoCytomation) in PBS for 30 min, washed twice in PBS for 10 min, incubated in DAB for 5 min and washed twice in PBS for 10 min. The slides were then counterstained with hematoxylin.

Net restraint
We used an acute (30 min) net restraint model to study the CRH and UI responses in stressed fish. Fish (n = 4) were housed in identical tanks. On the day of the experiment, they were restrained for 30 min and sampled 3 h and 24 h later, together with control (i.e. not restrained) fish. Blood was collected by puncture of the caudal vessels using a heparinized needle. The fish was then humanely killed using a standard protocol detailed under UK home office license procedures, and CNSS, hypothalamus, and urophysis were removed for quantitative RT-PCR.

Plasma cortisol determination
Plasma hormone determination was performed following exactly the protocol described by Huising et al. (20). Briefly, the blood was collected in heparinized tubes and plasma cortisol levels were measured by RIA using a commercial antiserum (Bioclinical Services, Ltd., Cardiff, UK)

Quantitative RT-PCR
RNA from CNSS and hypothalamic samples from net-restrained fish was extracted as described above. The qPCR on was carried out in 96-well qPCR plates on ABI PRISM 7000 detector (Applied Biosystems, Foster City, CA). The primers and Taqman probe set were designed using Primer Express software (Applied Biosystems) and were synthesized commercially (Eurogentec). The primer sequences were as follows:

Flounder CRH (126 bp product)

Sense: CRH-163F

Sequence: CCTCTAAAGACTGAAGATTCCTGTTGA

Antisense: CRH-288R

Sequence: ACCGCCAGGGCTGTCA

TaqMan probe:CRH-216T

Sequence: TGGTACCACCGTGATTCTGCTTGTTGC

Flounder UI (75-bp product)

Sense: UI-50F

Sequence: CTGGACGGAACATCGACATG

Antisense: UI-124R

Sequence: GGAGGTGTGATGAGAGGAGGAC

TaqMan probe: UI-73T

Sequence: CCGGCCTCCTTGCTCCTGCTC

Flounder ß-actin (103-bp product)

Sense: actin-352F

Sequence: AAGATGACCCAGATCATGTTCGA

Antisense: actin-454R

Sequence: CGATACCAGTGGTACGACCAGA

TaqMan probe: actin-382T

Sequence: AACACCCCCGCCATGTACGTTGC

The total RNA was extracted from fish CNSS and hypothalamus tissues of stress experiment by Trizol (Invitrogen Life Technologies). One microgram of total RNA of each sample was treated with DNase I (Invitrogen Life Technologies) and the first-strand cDNA was synthesized as described in the SuperScript II cDNA kit (Invitrogen Life Technologies). The real-time PCR was performed in a final volume of 25 µl consisting of: 12.5–50 ng of reverse-transcribed cDNA mixed with optimal concentration of primers (300 nM), Taqman probe (100 nM), and qPCR Master mix plus kit (Eurogentec). A standard amplification profile was used (2 min at 50 C, 10 min at 95 C and then 40 cycles of the following: 15 sec at 95 C and 1 min at 60 C).

Flounder ß-actin was used as reference gene. Relative quantitation values were expressed using the 2 – [(CTsample UI or CRH – CTsample Actin) – (CTcontrol UI or CRH – CTcontrol Actin)] (2-{Delta}{Delta}Ct) method as fold changes in the target gene normalized to the reference gene and related to the expression of control.

Statistical analysis
Results from measurements of plasma cortisol levels and of the cortisol receptor, CRH and UI relative mRNA levels are expressed as means ± SE. Differences between groups were analyzed by ANOVA. Significance levels were set at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Isolation and characterization of CRH and UI cDNAs
Screening of a CNSS cDNA library with a probe for the coding region of a partial preproCRH cDNA yielded three positive clones. Two clones contained identical sequences, one clone was 170 bp shorter at the 3'-end. Sequence analysis confirmed the identity of the clones as a preproCRH cDNA because the deduced protein sequence contains CRH at the C terminus. The 1303-bp sequence of flounder preproCRH cDNA (EMBL accession no. AJ555623) and the deduced amino acid sequence are shown in Fig. 1AGo. The cDNA contains a 198-bp 5'-untranslated region (UTR), 507 bp of ORF, and a 658-bp 3'-UTR, which contains three polyadenylation signals (AATAAA) upstream of the poly(A) tail. The ORF encodes the 168 amino acid preproCRH, which consists of a 24-amino acid putative signal peptide, a cryptic region and the carboxyl terminus 41-amino acid sequence of CRH. The flounder CRH is flanked by the potential proteolytic processing and cleavage signals Arg-Gly-Arg-Arg at the N terminus and by Gly-Lys at C terminus. The presence of Gly adjacent to the C terminus indicates carboxy-terminal amidation.

Screening of the CNSS cDNA library using a partial preproUI cDNA probe identified three positive clones. Two clones (674 bp and 868 bp; EMBL accession no. AJ517171) contained identical sequences except that one of them was 194 bp shorter at 3'-end. Another clone (1648 bp; EMBL accession no. AJ517172, Fig. 1BGo) contained an identical first 674-bp sequence and a different 3'-UTR. An ATG triplet at nt position 67 of preproUI cDNA corresponds to the predicted initiation codon. Both the UI-1 and -2 cDNA sequences contain a 444-bp ORF encoding a putative protein of 147 amino acids, a 357 bp that contains only modified (ATTAAA) polyadenylation signal and 1138 bp 3'-UTR, which contains both a common (AATAAA) and a modified (ATTAAA) polyadenylation signal upstream the poly(A) tail, respectively. The translation of the cDNA sequence showed the ORF to encode a 24-amino acid putative signal peptide, propeptide, and the 41 amino acid mature peptide sequences. The residues Lys-Arg adjacent to the N terminus UI indicate a potential enzymatic cleavage site. The Gly-Lys residues following the C terminus of UI are indicative of a proteolytic processing site and of C-terminal amidation.

Alignment of CRH and UI sequences and database searches
The deduced mature peptide sequence of flounder CRH precursor is closely related to that of catfish and tilapia CRH (Fig. 2Go), with more variation compared with orthologous vertebrate and other teleost CRHs (flounder, tilapia, and catfish) CRH peptides differ by two Lys-Ala and Met-Leu substitutions at amino acid positions 24 and 27 (Fig. 2AGo). The predicted flounder UI peptide shares a higher degree of sequence identity with other teleost UI than with the orthologous vertebrate urocortin peptides (Fig. 2BGo). Overall, a multiple amino acid sequence alignment between flounder and other vertebrate CRH-related precursors and peptides revealed that flounder preproCRH and its mature peptide exhibit higher identities with CRH sequences than with other CRH-related peptides. Similarly, flounder UI precursor and peptide show a higher degree of identity with other UI sequences than with CRH. The deduced amino acid sequences of CRF and UI peptides from flounder exhibit a sequence identity of 51.2%.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 2. Comparison of mature peptides of CRH family members. A, Direct alignment of amino acid sequences of mature peptides from flounder CRH (accession no. AJ555623), tilapia CRH (accession no. AJ011835), catfish CRH (accession no. AAP21785), trout CRH1&2 (accession no. AF296672 and AY156929), carp CRH1&2 (accession no. AJ317955 and AJ576243), goldfish CRH1&2 (accession no. AF098629 and AY142110), white sucker CRH1&2 (accession no. J04116 and x58784), human CRH (accession no. V00571), rat CRH (accession no. AAA40965), pig CRH (accession no. CAA75424.), ovine CRH (accession no. AAA31513), cow CRH (accession no. AAK83231), frog CRH (accession no. AAB24277), flounder UI (accession no. AJ517172), white sucker UI (UOCC1M), trout UI (accession no. AJ005264), carp UI (accession no. M11671), goldfish UI (AF129115), rat urocortin (accession no. NM019150), ovine urocortin (accession no. AF051807), human urocortin (accession no. AF038633), frog SVG (accession no. P01144) is given. A gap (dot) has been introduced to maximize alignment. B, Homology tree of same group CRH family members. The sequence alignment and homology analysis was performed using DNAMAN software.

 
Gene organization of CRH and UI
Comparison of the CRH and UI genomic sequences with their cDNA sequences suggested the existence of two exons for both genes. The whole coding region of CRH or UI is located in the second exon (Fig. 3Go). A single intron of 492 bp or 515 bp with consensus splice signals followed the ‘GT—AG rule’ (Mount, 1986) for the splice donor and acceptor sequences separates the two exons of the CRH and UI genes in the relative 5'-UTR regions.



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 3. Nucleotide sequence and genomic organization of flounder CRH and UI. A, Schematic presentation of flounder CRH genomic DNA organization and 492-bp intron nucleotide sequence (EMBL accession no.: AJ571695). B, Schematic presentation of flounder UI genomic DNA organization and 515 bp intron nucleotide sequence (EMBL accession no.: AJ571694). Start and stop codons are shown in capital letters.

 
Southern blot analysis of flounder genomic DNA yielded bands similar to those predicted from the restriction map of the CRH or UI gene, indicating that single CRH and UI genes are present in the flounder genome (data not shown).

Expression of CRH and UI genes
Tissue distribution of flounder CRH and UI mRNAs.
Northern blot analysis of a range of tissues using the CRH probe identified the CNSS as the major site of production of this peptide (Fig. 4Go). One major gene transcript (~1350 nt) and three minor transcripts (2700, 4400, and 6800 nt) were identified (Fig. 4AGo). The size of the major transcript is consistent with the predicted length, based on the cDNA clones obtained. After even longer exposure (1 wk), the gene transcripts were not detected in brain or other tissue samples by Northern blot analysis. Similarly, and consistent with previous findings, UI mRNA was only detected in CNSS RNA samples. The UI-specific probe detected one major band (~1650 nt) and four minor bands (900, 3500, 5500, and 7100 nt). This is consistent both with the predicted length (1650-nt major band and 900-nt minor band), based on the cDNA clones obtained, and expected tissue localization of the mRNA. The nature of the 2700-, 4400-, and 6800-nt transcripts is unknown and awaits further investigations.



View larger version (74K):
[in this window]
[in a new window]
  		FIG. 4. Tissue distribution of CRH and UI mRNA. A, Northern blot showing tissue distribution and size of the flounder CRH and UI transcripts. The intensity of 18S rRNA shows similar loading for each sample. B, RT-PCR amplification of flounder CRH, UI and actin using cDNA-specific PCR primers showing tissue distribution. C, The brain distribution of CRH and UI by RT-PCR and picture of the brain regions used for RNA extraction: a, forebrain (olfactory bulbs and telencephalon-preoptic region); b, midbrain (optic tectum-thalamus region); c, hindbrain (cerebella, medulla, and spinal cord); d hypothalamus; e, pituitary.

 
RT-PCR using intron-spanning primers indicated the presence of CRH transcripts in all tissues tested (Fig. 4Go, B and C). Figure 4CGo also shows that CRH transcripts were not detected in pituitary. Using RT-PCR, UI transcripts were detected in brain and CNSS (Fig. 4Go, B and C).

CRH and UI in the caudal neurosecretory system
In situ hybridization of CNSS serial sections using 35S-labeled CRH and UI RNA probes (antisense) showed that about 70% of large Dahlgren cells (40–65 µm) and all small Dahlgren cells (25 µm) contained abundant gene expression for both CRH and UI (Fig. 5Go). CRH (Fig. 5AGo) and UI (Fig. 5BGo) mRNAs were not detected in nerve axons, urophysis, capillaries, or ependymal cells of the central canal. Figure 5Go, C and D, shows the lack of hybridization of CRH and UI sense probes, respectively, indicating the specificity of the signal. Arrows indicate the multinucleated nature of a typical Dahlgren cell.



View larger version (158K):
[in this window]
[in a new window]
  		FIG. 5. In situ hybridization of CRH and UI in the flounder spinal cord. A, CRH gene expression around the nuclei of a group of Dahlgren cell (d) with an antisense CRH 35S RNA probe. B, UI gene expression around the nuclei of the same group of Dahlgren cell (d) with an antisense UI 35S RNA probe. C, In situ hybridization of CRH and UI (D) with a sense 35S RNA probes (negative controls). (a), Axon; (e), ependymal cells.

 
Immunoreactivity for CRH and UI were examined by immunocytochemistry on serial sections of the CNSS. First, we demonstrated the specificity of the antibodies used for our studies. The results are presented in Fig. 6Go. Panel A shows the specificity of the CRH antibody signal, demonstrated by the lack of immunoreactivity when preimmune serum is used and when preabsorption of the antibody with the antigenic peptide is performed before applying the antibody. Panel A also shows that the CRH antibody does not cross-react with the UI antigen. Panel B shows the ability of the CRH and UI antibodies to detect selectively their respective antigens. Figure 6Go also shows that the specificity of CRH and UI immunoreactive species was maintained in urophysial tissue (panel C), where immunoreactive signals were abolished in the presence of the relative antigenic peptides.



View larger version (78K):
[in this window]
[in a new window]
  		FIG. 6. Characterization of the CRH and UI antibodies. A, The specificity of the CRH antibody is confirmed by the lack of immunoreactivity in the presence of preimmune serum (PIM) and in the presence of the CRH antigenic peptide (CRH Ab + CRH Ag). The CRH antibody does not cross react with UI, as demonstrated by the presence of immunostaining when the CRH antibody is preincubated with the UI antigenic peptide (CRH Ab + UI Ag). B, Electrophoretic separation of CRH and UI antigenic peptides and specific (i.e. peptide protectable) cross-reactivity with affinity-purified CRH and UI antibodies (CRH Ab and UI Ab, respectively). C, CRH and UI immunoreactitivies can be detected in urophysial tissues (predicted immunoreactivities for both peptides are ~4 kDa).

 
Our gene-specific antibodies detected colocalization of CRH and UI immunoreactive species in more than 90% of the Dahlgren cells. Specifically, Fig. 7Go shows colocalization of CRH (Fig. 7AGo) and UI (Fig. 7BGo) in the cytoplasm of large Dahlgren perikarya and in a nearby nerve axon. Both CRH and UI were also apparent in the nerve endings in the urophysis (Fig. 7CGo). Most large and all small Dahlgren cells contained both CRH and UI. In the control slide, no immunoreactivity was detected for either CRH or UI in the ependymal cells of central canal, in Dahlgren cells and in the nerve axon endings (Fig. 7DGo). Finally, we assessed the CNSS contribution to stress in an acute (30 min) net restraint paradigm and the results are presented in Fig. 8Go. Figure 8AGo shows that plasma cortisol levels are significantly increased 3 h after restraint. The increase in circulating cortisol levels is mirrored by an increase in cortisol receptor mRNA in the CNSS, as measured by qPCR (Fig. 8AGo, right panel). Figure 8AGo also shows that both cortisol and cortisol receptor mRNA levels returned to baseline at 24 h after the net restraint. We then measured mRNA levels for CRH and UI in CNSS and hypothalamic samples extracted from the same animals in which cortisol levels were determined. Figure 8BGo shows that CRH levels are significantly increased 3 h after the restraint in CNSS, but not in the hypothalamus. We have also measured baseline mRNA levels for CRH in CNSS and found that, when values are normalized for the ß-actin content, CNSS CRH levels are approximately 1200-fold higher than those measured in the hypothalamus (not shown). Whether this difference is because of the fact that the urophysis tissue is far more pure than the hypothalamic CRH producing cells and/or whether these differences in mRNA expression levels translate into differences in CRH protein remains to be investigated.



View larger version (148K):
[in this window]
[in a new window]
  		FIG. 7. Immunocytochemistry of flounder spinal cord. A, CRH in the cytoplasm of a group of Dahlgren cells (d) and in a nerve axon (a) nearby. B, UI in the cytoplasm of same group of Dahlgren cell (d) and in a nerve axon (a) nearby. C, The antisera to CRH detected peptide in the nerve axon endings (ae) in the urophysis. D, The same group of cells showed no immunoreactivity when the specific primary antisera used in A and B were omitted. The multinucleated structure of a typical Dahlgren cell is indicated by arrows.

 


View larger version (29K):
[in this window]
[in a new window]
  		FIG. 8. Acute (30 min) net restraint experiments. A, Plasma cortisol levels (ng/ml) are increased 3 h after net restraint. This increase is accompanied by an increase in CNSS cortisol receptor mRNA levels (qPCR). Both parameters returned to baseline 24 h after the acute stress. B, In the same animals, CNSS, but not hypothalamus, mRNA levels are also increased 3 h after restraint. Vice versa, UI mRNA levels are increased in the hypothalamus, but not in the CNSS, 3 h after net restraint (n = 4; *, P < 0.05).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
From this study, we conclude that, in fish, the CNSS is a major site of production/storage of CRH, and it is likely that such an organ is a significant neuroendocrine source of circulating CRH. In addition, we demonstrate, for the first time, colocalization of CRH and UI peptides within the same magnocellular neurons of the CNSS, which raises the intriguing possibility that, at the level of fish, these peptides share roles in the neuroendocrine mediation of stress-induced changes in interrenal cortisol secretion.

Molecular identification and characterization of CRH and UI cDNAs
The molecular sequences of the CRH and UI genes were unknown for the European flounder. We therefore generated a CNSS library, from which precursors belonging to the CRH family peptides, CRH and UI could be isolated. Both precursor sequences contain a signal peptide, succeeded by a divergent cryptic region, and the mature peptide sequence near the C terminus with the cleavage and amidation sites (21). Moreover, similar to other CRH precursors, the cryptic region of flounder preproCRH contains a characteristic region of conserved amino acids (residues 54–65; Fig. 1AGo). It has previously been suggested that this region may have a functional role (5, 21). The same region was not found in flounder UI, whereas it has been previously described in gold fish (22).

Despite these structural similarities, a comparison of deduced amino acid sequences of the two cloned flounder peptides with other peptides from the CRH family shows that flounder CRH and UI are members of two discrete lineages within the CRF family, viz. those that are structurally more akin to CRH, and those more akin to UI. The flounder CRH is most closely related to that of tilapia and catfish (95–100%), a new group in CRH division (23), whereas trout CRH only shares 79% identity with flounder and occupies a separate group. The other two groups consist of human, rat, and pig CRH with the rest of known teleosts, namely carp, goldfish, and white sucker (93–100%, Fig. 2Go), and a separate group which contains ovine and cow CRH (22, 24). Despite the differences between amino acid sequences (two residue differences with flounder CRH), the tilapia and rat CRH have equal potency in stimulating ACTH and {alpha}-MSH release by tilapia pituitaries in vitro (23). In mammals, CRH inhibits feeding induced by neuropeptide Y, and mediates part of the anorexigenic effects of bombesin, leptin, and possibly serotonin (25, 26, 27). Whether CRH is involved in the regulation of a specialized feeding behavior to accommodate the need for a specific diet or for other ecological challenges remains to be determined.

Urocortin is the human equivalent of flounder UI. Sequence analysis shows that the flounder UI is more closely related to teleost UI (common carp, goldfish, trout, and white sucker) than to the orthologous vertebrate (human, ovine, and rat) urocortin, indicating species divergence. Examination of the presence of UI and CRH isoforms in invertebrates suggests that only one of these lineages was inherited from their protovertebrate ancestors (16). This raises the possibility that CRH peptides may be derived from UI peptides by gene duplication and later function refinement in vertebrates.

Our studies revealed the presence of multiple CRH and UI gene transcripts in the CNSS. These results suggest the possibility of multiple polyadenylation signals in the 3'-UTR region of CRH and UI genes. In contrast, a similar analysis of CRH gene transcripts from goldfish and white sucker brains revealed a single 1.3-kb CRH mRNA in goldfish, and 1.3- and 1.8-kb mRNA white sucker (5, 22). The two versions of CRH mRNA in white sucker are apparently derived from the same primary transcript through different polyadenylation signals, and are differentially expressed according to the glucocorticoid status of the fish (5). In addition, UI multiple polyadenylation signals have been found in the CNSS of carp (28) and trout (29). Because some preproCRH and all preproUI cDNAs described to date contain multiple polyadenylation signals (5, 22, 28, 29), the varying sizes of CRH and UI mRNA found among teleost brain and CNSS are likely to be the result of differential processing of the CRH and UI transcripts. This suggests that CNSS-mediated cortisol release could be controlled by a feedback mechanism that is dependent on the glucocorticoid status of the animal, acting through regulation of the speed and the stability of the gene expression.

Analysis of the genomic organization shows that both CRH and UI genes contain two exons, and that their entire coding regions are located in the second exon. Southern blot results show a single copy of CRH and UI genes in the flounder, indicative that there is no alternative gene product for these peptides. Structurally, the flounder CRH and UI genomic organizations are very similar to those of the human and rat CRH and urocortin (30, 31, 32, 33). This further implies an evolutionary conservation in the CRH peptide family.

Tissue distribution of CRH and UI mRNA
Northern blot analysis of total RNA prepared from a range of flounder tissues revealed that the CNSS is a major site of expression of both CRH and UI genes. This is an important observation, as although high circulating levels of CRH have been measured in acutely stressed fish and cortisol production appears to be independent of the activation of the hypothalamic-pituitary-interrenal axis (34), its site of production has been thus far elusive. Peptide production by the CNSS has often been suggested to play pivotal roles in osmoregulation, reproductive biology and possibly nutritional behavior. In addition, we and others have previously demonstrated that UI stimulates cortisol secretion from flounder interrenal tissue in vitro (16) and administration of CRH and UI in vivo can also elicit an increase in plasma cortisol level in goldfish (35, 36). The demonstration that high levels of CRH and UI are present in the CNSS, together with the findings that glucocorticoid receptors are also expressed in Dahlgren cells (37), lend further credibility to our hypothesis that the CNSS also plays an important role in the regulation of stress-dependent cortisol production (13).

RT-PCR using intron-flanking specific primers indicated the presence of CRH and UI transcripts in tissues outside the CNSS, especially in the brain. The detection of both CRH and UI transcripts in the telencephalon-preoptic region, optic tectum-thalamus, posterior brain and hypothalamic region in flounder is consistent with results from goldfish (22). CRH gene expression is absent in the pituitary. Mammals lack the CNSS, and the brain is the major site expression of CRH and UI. However, whereas immunoreactivities for CRF and urocortin are distributed throughout the rat brain, the supraoptic nucleus and the lateral hypothalamus are the only sites where these peptides appear to colocalize (38). Furthermore, both peptides appear to have distinct functions through their effect on specific CRF1 and CRF2 receptors (15). Our observations show that, in contrast, in flounder brain CRH and UI mRNAs have a much greater degree of brain region colocalization. Differences in the colocalization between CRH and UI also occur in goldfish (22) and in rat brain (38). Whether these can be ascribed to the hormonal status of the animal is currently unknown. Finally, the expression of CRH and UI mRNAs in other fish tissue suggests that these peptides could be synthesized there and may be involved in tissue-specific paracrine roles (39, 40).

Coexpression of CRH and UI gene in the caudal neurosecretory system
Earlier work by us and others in which ovine CRF antibodies were employed to detect UI immunoreactive species in fish revealed an apparent widespread distribution of UI. However, because of the heterologous antibodies’ cross-reactivity with CRH, conclusive information about UI immunolocalization could not be achieved. In the current study, we employed specific antibodies for flounder UI and CRH and showed colocalization of the peptides in most of the Dahlgren cells of the CNSS. Axons of the Dahlgren cells also contain CRH, and the presence of CRH in the urophysis with concentration around the capillaries suggests that, similar to UI, CRH reaches the urophysis by axonal transport. Here, the secretory products of Dahlgren cells are concentrated into axonal enlargements, the site of storage and subsequent secretion into general circulation (14). Indeed, our preliminary studies at the ultrastructural level reveal colocalization of CRH and UI antibodies to the same nerve endings and, to some extent, to the same neurosecretory vesicles (our unpublished observations). It is interesting to note that we found CRH and UI peptides in the axons, both in the spinal cord and in the urophysis, whereas transcripts for both CRH and UI were only detected in the Dahlgren cells. This suggests that the mRNAs for CRH and UI are expressed in Dahlgren cells, and that the mature peptides are axonally transported to the urophysis. The differences in the number of cells positive for in situ hybridization (mRNA distribution) vs. immunocytochemistry (protein) suggests that functional subtypes of Dahlgren cells might be associated with differential peptide secretion for adding (recruiting) or removing (switching off) a subpopulation from the functional group. This correlates well with our recent electrophysiology studies of Dahlgren cells (41). The idea also has parallels with observations of recruitment/derecruitment within the population of oxytocin magnocellular neurons in mammals (42) and requires further study.

Overall, analysis of the distribution of these peptides in the CNSS confirmed that CRH and UI genes are predominantly coexpressed in Dahlgren cells and both of CRH and UI peptides are delivered to the urophysis by axonal transport, where they are secreted into the systemic circulation. Drainage of the urophysis into the caudal vein and renal-portal system ensures swift delivery of its secretory products to the bladder, gonad, kidney, interrenal (i.e. adrenal homolog), thyroid follicles (i.e. thyroid gland homolog), intestine, liver, and spleen.

In conclusion, our study demonstrates that, in fish, the CNSS represents a major site of production and release of CRH in the blood. Thus, in addition to its modulatory effects on osmoregulatory, reproductive and nutritional behaviors, the CNSS could also mediate the transduction of stress-specific regulation of cortisol production and therefore play a role in phenotypic plasticity, acting at the interface between organism’s environment and its physiology (43). Furthermore, we have observed, for the first time, the colocalization of CRH and UI in a major neuroendocrine system of fish. Whether the absence/evolutionary loss of the CNSS in vertebrates beyond fish underscores the importance attributed to segregation of function and physical distribution of these closely related neuropeptides in tetrapods and mammals remains to be investigated.


   Footnotes
 
This work was supported by The Biotechnology and Biological Sciences Research Council Neurone Initiative.

Abbreviations: CNSS, Caudal neurosecretory system; DNase, deoxyribonuclease; dT, deoxythymidine; nt, nucleotide; ORF, open reading frame; qPCR, quantitative pas, downstream antisense primer; PCR; RNase, ribonuclease; ps, primer sequence; SDS, sodium dodecyl sulfate; SSC, standard saline citrate; UI, urotensin I; UII, urotensin II; UTR, untranslated region.

Received February 5, 2004.

Accepted for publication September 1, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Vale W, Spiess J, Rivier C, Rivier J 1981 Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotrophin and ß-endorpin. Science 213:1394–1397[Free Full Text]
  2. Montecucchi PC, Henschen A 1981 Amino acid composition and sequence analysis of sauvagine, a new peptide from the skin of Phyllomedusa sauvagei. Int J Pept Protein Res 18:113–120[Medline]
  3. Ichikawa T, McMaster D, Lederis K, Kobayashi H 1982 Isolation and amino acid sequences of urotensin I. A vasoactive and ACTH-releasing neuropeptide from the carp (Cyprinus carpio) urophysis. Peptides 3:859–867[CrossRef][Medline]
  4. Lederis K, Letter A, McMaster D, Moore G, Schlesinger 1982 Complete amino acid sequence of Urotensin I, a hypotensive and corticotrophin-releasing neuropeptide from Catostomus. Science 218:162–164[Abstract/Free Full Text]
  5. Morley SD, Schoenrock C, Richter D, Okawara Y, Lederis K 1991 Corticotropin-releasing factor (CRF) gene family in the brain of the teleost fish Catostomus commersoni (white sucker): molecular analysis predicts distinct precursors for two CRFs and one urotensin I peptide. Mol Mar Biol Biotechnol 1:48–57[Medline]
  6. Stenzel-Poore MP, Heldwein KA, Stenzel P, Lee S, Vale WW 1992 Characterization of the genomic corticotropin-releasing factor (CRF) gene from Xenopus laevis: two members of the CRF family exist in amphibians. Mol Endocrinol 6:1716–1724[Abstract]
  7. Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C 1995 Urocortin, a mammalian neuropeptide related to urotensin I and to corticotropin-releasing factor. Nature 378:287–292[CrossRef][Medline]
  8. Donaldson CJ, Sutton SW, Perrin MH, Corrigan AZ, Lewis KA, Rivier JE, Vaughan JM, Vale WW 1996 Cloning and characterization of human urocortin. Endocrinology 137:2167–2170[Abstract]
  9. Linton EA, Perkins AV, Hagan P, Poole S, Bristow AF, Tilders F, Corder R, Wolfe CD 1995 Corticotrophin-releasing hormone (CRH) binding protein interference with CRH antibody binding: implications for direct CRH immunoassay. J Endocrinol 146:45–53[Abstract/Free Full Text]
  10. McLean M, Bisits A, Davies J, Woods R, Lowry P, Smith R 1995 A placental clock controlling the length of human pregnancy. Nat Med 1:460–463[CrossRef][Medline]
  11. Catalan R, Gallart JM, Castellanos JM, Galard R 1998 Plasma corticotrophin-releasing hormone in depressive disorders. Soc Biol Psychiatry 44:15–20
  12. Pepels PPLM, van Helvoort H, Bonga SEW, Balm PHM 2004 Corticotropin-releasing hormone (CRH) in the teleost stress response: rapid appearance of peptide in plasma of tilapia (Oreochromis mossambicus). J Endocrinol 180:425–438[Abstract]
  13. Winter MJ, Ashworth A, Bond H, Brierley MJ, McCrohan CR, Balment RJ 2000 The caudal neurosecretory system: control and function of a novel neuroendocrine system in fish. Biochem Cell Biol 78:193–203[CrossRef][Medline]
  14. Onstott D, Elde R 1986 Immunohistochemical localization of urotensin I/corticotropin-releasing factor, urotensin II, and serotonin immunoreactivities in the caudal spinal cord of non-teleost fish. J Comp Neurol 249:205–225[CrossRef][Medline]
  15. Lovejoy DA, Balment RJ 1999 Evolution and physiology of the corticotrophin-releasing factor (CRF) family of neuropeptides in vertebrates. Gen Comp Endocrinol 115:1–22[CrossRef][Medline]
  16. Kelsall CJ, Balment RJ 1998 Native urotensins influence cortisol secretion and plasma cortisol concentration in the euryhaline flounder, Platichthys flesus. Gen Comp Endocrinol 112:210–219[CrossRef][Medline]
  17. Conlon JM, Arnold-Reed DE, Balment RJ 1990 Urotensin I and its N-terminal flanking peptide from the flounder, Platichthys flesus. Peptides 11:891–895[CrossRef]
  18. Sambrook J, Fritsch EF, Maniatis T 1989 Analysis and cloning of eukaryotic genomic DNA in molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
  19. Santos CRA, Ingleton PM, Cavaco JEB, Kelly PA, Edery M, Power DM 2001 Cloning, characterisation and tissue distribution of prolactin receptor in the sea bream (Sparus aurata). Gen Comp Endocrinol 121:32–47[CrossRef][Medline]
  20. Huising MO, Metz, JR, van Schooten C, Taverne-Thiele AJ, Hermsen T, Verburg-vanKemenade BML, Flik G 2004 Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. J Mol Endocrinol 32:627–648[Abstract]
  21. Lederis K, Fryer JN, Okawara Y, Schonrock C, Richter D 1994 Corticotropin-releasing factors acting on the fish pituitary: experimental and molecular analysis. In: Sherwood NM, Hew C, eds. Fish physiology. San Diego: Academic Press; 67–100
  22. Bernier NJ, Lin X, Peter RE 1999 Differential expression of corticotropin-releasing factor (CRF) and urotensin I precursor genes, and evidence of CRF gene expression regulated by cortisol in goldfish brain. Gen Comp Endocrinol 116:461–477[CrossRef][Medline]
  23. van Enckevort FH, Pepels PP, Leunissen JA, Martens GJ, Bonga SEW, Balm PH 2000 Oreochromis mossambicus (tilapia) corticotropin-releasing hormone: cDNA sequence and bioactivity. J Neuroendocrinol 12:177–186[CrossRef][Medline]
  24. Lovejoy DA 1996 Peptide hormone evolution: functional heterogeneity with GnRH and CRH families. Biochem Cell Biol 74:1–7[Medline]
  25. Bovetto S, Rouillard C, Richard D 1996 Role of CRH in the effects of 5-HT-receptor agonists on food intake and metabolic rate. Am J Physiol 271:R1231–R1238
  26. Kent P, Anisman H, Merali Z 1998 Are bombesin-like peptides involved in the mediation of stress response? Life Sci 62:103–114[Medline]
  27. Heinrichs SC, Richard D 1999 The role of corticotrophin-releasing factor and urocortin in the modulation of ingestive behaviour. Neuropeptides 33:350–359[CrossRef][Medline]
  28. Ishida I, Ichikawa T, Deguchi T 1986 Cloning and sequence analysis of cDNA encoding urotensin I precursor. Proc Natl Acad Sci USA 83:308–312[Abstract/Free Full Text]
  29. Barsyte D, Tipping D, Brennand J, Baker B, Lovejoy D 1999 Rainbow trout (Oncorhynchus mykiss) urotensin-I: structural differences between urotensin-I and urocortin. Gen Comp Endocrinol 115:169–177[CrossRef][Medline]
  30. Shibahara S, Morimoto Y, Furutani Y, Notake M, Takahashi H, Shimizu S, Horikawa S, Numa S 1983 Isolation and sequence analysis of the human corticotropin-releasing factor precursor gene. EMBO J 2:775–779[Medline]
  31. Thompson RC, Seasholtz AF, Herbert E 1987 Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1:363–370[CrossRef][Medline]
  32. Zhao L, Donaldson CJ, Smith GW, Vale WW 1998 The structures of the mouse and human urocortin genes (Ucn and UCN). Genomics 50:23–33[CrossRef][Medline]
  33. Park J-H, Lee Y-J, Na S-Y, Kim KL 2000 Genomic organization and tissue-specific expression of rat urocortin. Neurosci Lett 292:45–48[CrossRef][Medline]
  34. Balm PHM, Pepels P, Helfrich S, Hovens MLM, Wendelaar Bonga SE 1994 Adrenocorticotropic hormone in relation to interrenal function during stress in tilapia (Oreochromis mossambicus). Gen Comp Endocrinol 96:347–360[CrossRef][Medline]
  35. De Pedro N, Alonso-Gomez AL, Gancedo B, Valenciano AI, Delgado MJ, Alonso-Bedate M 1997 Effect of {alpha}-helical CRF(9–41) on feeding in goldfish: involvement of cortisol and catecholamines. Behav Neurosci 111:398–403[CrossRef][Medline]
  36. Bernier NJ, Peter RE 2001 Appetite-suppressing effects of urotensin I and corticotropin-releasing hormone in goldfish (Carassius auratus). Neuroendocrinology 73:248–60[CrossRef][Medline]
  37. Bond H, Kelsall CJ, Teitsma C, Balment RJ 1999 In teleost fish the caudal neurosecretory system (CNSS) affords pituitary-independent control of cortisol secretion. Comp Biochem Physiol 12A:S89
  38. Morin M, Ling N, Liu X-J, Kahl SD, Gehlert DR 1999 Differential distribution of urocortin- and corticotropin-releasing factor-like immunoreactivities in the rat brain. Neuroscience 92:281–291[CrossRef][Medline]
  39. Vale W, Vaughan J, Perrin M 1997 Corticotropin-releasing factor (CRH) family of ligands and their receptors. Endocrinologist 7:S3–S9
  40. Kageyama K, Bradbury MJ, Zhao L, Blount AL, Vale WW 1999 Urocortin messenger ribonucleic acid: tissue distribution in the rat and regulation in thymus by lipopolysaccharide and glucocorticoids. Endocrinology 140:5651–5658[Abstract/Free Full Text]
  41. Brierley MJ, Ashworth AJ, Craven TP, Woodburn M, Bank JR, Lu W, Riccardi D, Balment RJ, McCrohan CR 2003 Electrical activity of caudal neurosecretory neurons in seawater- and freshwater-adapted flounder: responses to cholinergic agonists. J Exp Biol 206:4011–4020[Abstract/Free Full Text]
  42. Russell JA, Leng G, Douglas AJ 2003 The magnocellular oxytocin system, the fount of maternity: adaptations in pregnancy. Front Neuroendocrinol 24:27–61[CrossRef][Medline]
  43. Seasholtz AF, Valverde RA, Denver RJ 2002 Corticotropin-releasing hormone-binding protein: biochemistry and function from fishes to mammals. J Endocrinol 175:89–97[Abstract]



This article has been cited by other articles:


Home page
 J EndocrinolHome page
N. J Bernier, S. L Alderman, and E. N Bristow
Heads or tails? Stressor-specific expression of corticotropin-releasing factor and urotensin I in the preoptic area and caudal neurosecretory system of rainbow trout
J. Endocrinol., March 1, 2008; 196(3): 637 - 648.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
M. O Huising, L. M van der Aa, J. R Metz, A. de Fatima Mazon, B M L. V.-v. Kemenade, and G. Flik
Corticotropin-releasing factor (CRF) and CRF-binding protein expression in and release from the head kidney of common carp: evolutionary conservation of the adrenal CRF system
J. Endocrinol., June 1, 2007; 193(3): 349 - 357.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
W. Lu, M. Greenwood, L. Dow, J. Yuill, J. Worthington, M. J. Brierley, C. R. McCrohan, D. Riccardi, and R. J. Balment
Molecular Characterization and Expression of Urotensin II and its Receptor in the Flounder (Platichthys flesus): A Hormone System Supporting Body Fluid Homeostasis in Euryhaline Fish
Endocrinology, August 1, 2006; 147(8): 3692 - 3708.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Biol.Home page
A. F. Mazon, B. M. L. Verburg-van Kemenade, G. Flik, and M. O. Huising
Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding protein (CRH-BP) are expressed in the gills and skin of common carp Cyprinus carpio L. and respond to acute stress and infection
J. Exp. Biol., February 1, 2006; 209(3): 510 - 517.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
P. M. Craig, H. Al-Timimi, and N. J. Bernier
Differential Increase in Forebrain and Caudal Neurosecretory System Corticotropin-Releasing Factor and Urotensin I Gene Expression Associated with Seawater Transfer in Rainbow Trout
Endocrinology, September 1, 2005; 146(9): 3851 - 3860.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. O. Huising and G. Flik
The Remarkable Conservation of Corticotropin-Releasing Hormone (CRH)-Binding Protein in the Honeybee (Apis mellifera) Dates the CRH System to a Common Ancestor of Insects and Vertebrates
Endocrinology, May 1, 2005; 146(5): 2165 - 2170.
[Abstract] [Full Text] [PDF]

This Article