help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0119
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alimov, A. P.
Right arrow Articles by Koszewski, N. J.
Endocrinology Vol. 144, No. 7 3138-3147
Copyright © 2003 by The Endocrine Society

Sp3/Sp1 in the Parathyroid Gland: Identification of an Sp1 Deoxyribonucleic Acid Element in the Parathyroid Hormone Promoter

Alexander P. Alimov, M. Chris Langub, Hartmut H. Malluche and Nicholas J. Koszewski

University of Kentucky Medical Center, Division of Nephrology, Bone and Mineral Metabolism, Lexington, Kentucky 40536-0298

Address all correspondence and requests for reprints to: N. J. Koszewski, University of Kentucky Medical Center, Division of Nephrology, Bone and Mineral Metabolism, Room MN562, 800 Rose Street, Lexington, Kentucky 40536-0298. E-mail: njhosz0{at}uky.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A highly conserved region in the PTH promoter was identified using the basic local alignment search tool (BLAST) 2 Sequences comparison. Strong specific complexes were observed with a DNA probe that contained much of the computer-derived conserved sequence in the EMSA using bovine parathyroid gland (bPTG) nuclear extracts. Ethylation interference footprinting indicated that the major complex made contacts to a sequence strikingly similar to an Sp1 binding site. Sp3 was evident in the major DNA-binding complexes, whereas the contribution by Sp1 was substantially weaker. Specific binding by additional unidentified bPTG nuclear factors was also evident. Immunocytochemical and Western blotting analyses established that Sp1 and Sp3 were positively localized in the nuclei of chief cells of the bPTG and of the expected molecular weights, with particularly robust expression of Sp3. Affinity DNA-binding experiments using the bovine PTH Sp1 element demonstrated specific recovery of intact Sp3 and Sp1 proteins, although a significant portion of both proteins failed to interact with the affinity-tagged DNA. Treatment of the bPTG nuclear extracts with phosphatase, however, significantly increased the DNA-binding capacity of the Sp1/Sp3 complexes. Finally, transient transfection analysis indicated that the bovine Sp1-like element acted as an enhancer of heterologous gene expression. The present study identified an Sp1 element in the promoter of the PTH gene that represents a complex DNA-binding site involving interactions primarily with Sp1/Sp3 proteins. The data, therefore, highlight the likely involvement of the Sp family in regulating PTH gene expression through interactions with an Sp1 DNA element in the hormone’s promoter.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTH HAS LONG been recognized as a key component in the maintenance of calcium homeostasis in the body, with direct effects on the kidney and bone. Yet, despite the clear importance of this peptide hormone in calcium regulation, very little is known of the factors that control the transcription of this gene. Most of the studies have focused on factors that repress transcription of the PTH gene. One of the most intensively studied factors in this regard has been the vitamin D receptor (VDR), a member (NR1I1) of the nuclear receptor superfamily (1). Repressor DNA response elements have been identified that are in close proximity to the promoters of the human and chicken PTH genes (2, 3), whereas elements for the bovine and rat genes lie several hundred base pairs away (4, 5). In addition, other repressor elements, including a negative calcium response element, have also been identified in the PTH promoter and upstream regions (6, 7, 8).

Conversely, very little is known about the transcription factors that may be responsible for enhanced or basal expression of the PTH gene. A cAMP response element has been described in the promoters of the human and bovine PTH genes (9, 10). The human promoter also harbors another enhancer DNA element for some, as yet, unidentified ubiquitously expressed transcription factor present in a variety of cell lines that were tested (11). Finally, the transcription factor glial cells missing 2 (Gcm2)/glial cells missing B (GCMB) appears to be essential for proper development of the parathyroid gland (PTG) itself (12, 13).

In the present study, a computer analysis of PTH promoters from four mammalian species revealed a highly conserved DNA region in each of the respective promoters. Using this region of DNA and nuclear extracts from bovine PTGs (bPTGs), an Sp1 DNA element within this sequence has been identified. Furthermore, Sp3 and Sp1 are abundantly expressed in the adult PTG and are primarily responsible for the interactions with this DNA element. Phosphatase treatment of bPTG extracts promotes Sp3/Sp1 DNA-binding with this element, which acts as an enhancer in heterologous reporter gene experiments. The data, therefore, are strongly supportive of a role for Sp3 and Sp1 in regulating PTH gene transcription.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
General
All enzymes were purchased from New England Biolabs, Inc. (Beverly, MA) unless otherwise specified. Protease inhibitor cocktail (Complete, Mini) was purchased from Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). The sequence (top strand) of the consensus Sp1 element was GATCTGCTCGCCCCGCCCCGATCGAATG; bovine PTH Sp1 element, AGAATGAGCACCGCCCCATGGGAGTGTGTG; chicken vitellogenin II estrogen response element (ERE), CTTCCTGGTCAGCGTGACCGGAGC; biotinlyated bovine PTH Sp1 element, GAAGAATGAGCACCGCCCCATGGGAGTGTGTGTGC-Bt. The anti-Sp1 antibody was purchased from Upstate Biotechnology, Inc. (Waltham, MA) and the anti-Sp3 antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The antibovine PTH antibody was purchased from Fitzgerald Industries (Concord, MA), whereas the anti-VDR Ab192 has been described previously (14). Gradient gels for Western blotting were purchased from BioWhittaker, Inc. Molecular Applications (Rockland, ME). Streptavidin agarose was purchased from Pierce Chemical Co. (Rockford, IL). The opossum kidney (OK) cell line was purchased from American Type Culture Collection (Manassas, VA). Lipofectamine and Plus reagent were purchased from Invitrogen Life Technologies, Inc. (Carlsbad, CA). Luciferin assay reagent and cell lysis buffer were purchased from Promega Corp. (Madison, WI). The thymidine kinase/luciferase (tk/Luc) reporter vector was a generous gift from Dr. D. Kaetzel, University of Kentucky (Lexington, KY). This vector was cut with BamHI, blunt-ended with T4 DNA polymerase and the indicated double-stranded oligonucleotides ligated into this site with T4 DNA ligase. Plasmids containing oligonucleotide inserts were subjected to manual sequencing analysis to verify sequence identity. PTGs were obtained from local meat processing facilities, including C&W Meat (Cynthiana, KY) and Boone’s Abattoir (Bardstown, KY).

Preparation of nuclear extracts
Tissues were placed in ice-cold DMEM/F-12 (1:1, no phenol red) and transported to the laboratory. It was necessary to dissect away surrounding fat from the parathyroid tissue before the extraction process. The tissues were then minced, incubated on ice in 3 volumes of a cold low-salt buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM EDTA, 2.0 mM dithiothreitol (DTT), 10% glycerol; and 1x protease inhibitor cocktail] for 20 min followed by cell disruption with a Teflon Dounce homogenizer. Following a 30-min spin at 100,000 x g, the supernatants were removed and the nuclear pellets resuspended in 1 volume cold high-salt buffer (same as above with 400 mM KCl) and incubated on ice for 30 min with occasional gentle mixing. Samples were then spun at 100,000 x g for 30 min. The supernatant fractions were collected, aliquoted into individual tubes, snap-frozen and stored at -70 C before use.

Cells in culture are trypsinized and transferred to a 50-ml conical tube. After pelleting (600 x g/10 min) the cells are washed twice with PBS. Cells are then resuspended in three volumes of ice-cold low salt buffer (20 mM Tris, pH 7.5; 1.5 mM EDTA; 2.0 mM DTT; 5% glycerol; and protease inhibitor cocktail, same as above). Cells are subjected to three rounds of freeze-thawing and then spun at 30,000 x g for 30 min. Supernatants are removed and the nuclear pellet reuspended in 1.5 volumes of extraction buffer [400 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2.0 mM DTT, 5% glycerol, 0.05% Nonidet P-40 (NP-40), and protease inhibitor cocktail, same as above]. After 30 min, the samples are spun as above, the supernatant fraction collected, aliquoted into individual tubes, snap-frozen and stored at -70 C before use.

PCR and preparation of bovine PTH promoter fragments
Bovine liver tissue (1 g) was incubated in 10 ml of digestion buffer [10 mM Tris, pH 7.5; 100 mM NaCl; 25 mM EDTA; 0.5% sodium dodecyl sulfate (SDS); and 1.1 mg proteinase K] at 50 C for 24 h. One milliliter of this mixture was removed and extracted one time with phenol/chloroform (1:1) and ethanol precipitated. The pellet was dissolved in TE [10 mM Tris (pH 8.0), 1 mM EDTA] buffer and treated with 6 µg ribonuclease A for 30 min at 37 C. The sample was again extracted with phenol/chloroform, precipitated, resuspended in TE buffer and assessed for concentration and purity by UV absorption and agarose gel electrophoresis.

RT-PCR analysis of bovine PTH mRNA
PTG tissue was extracted with guanidinium isothiocyanate and purified by CsCl centrifugation. RNA (2 µg) was used in a reaction with Moloney murine leukemia virus reverse transcriptase (Ambion, Inc., Austin, TX) and bovine PTH 3' primer, ATCCACATCAGCTTTGTCTGCT, in a 20-µl reaction volume at 42 C for 1 h according to the manufacturer’s directions. An aliquot (5 µl) was then removed, mixed with recombinant Taq polymerase (Invitrogen Life Technologies, Inc., Carlsbad, CA), deoxynucleotide triphsphates and a mixture containing bovine PTH 3' primer (above) and bovine PTH 5' primer, GATTGTATCCTAAGACGTGTGT, in a 50-µl PCR. Amplification was carried out by initial denaturation at 94 C for 1 min, followed by 30 cycles of 94 C/15 sec, 53 C/30 sec, and 72 C/1 min. An aliquot (9 µl) was then removed and analyzed by agarose gel electrophoresis and ethidium bromide staining.

EMSA
Bovine PTH promoter fragments were liberated from the pT-Adv cloning vector (BD Biosciences Clontech, Palo Alto, CA) by digestion with EcoRI. These DNA fragments, possessing 5' overhangs, were radiolabeled using the combination of Klenow fragment (exo-) and 32P-{alpha}-deoxy-ATP (3000 Ci/mmol, Perkin-Elmer Life Sciences, Boston, MA). The radiolabeled DNA fragments were subsequently gel purified before use in binding reactions. Double-stranded oligonucleotide probes were radiolabeled using the combination of 32P-{gamma}-ATP (6000 Ci/mmol, Perkin-Elmer Life Sciences) and T4 polynucleotide kinase.

Binding reactions (20 µl total volume) were assembled in a buffer consisting of 120 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2 mM DTT, 5% glycerol, 0.5% 3-[(cholamidopropyl)dimethylammonio]propanesulfonate, 10 mM NaF, 100 µM Na3VO4, 1.5 µg deoxyinosine-deoxycytidine, 100 µM leupeptin, and nuclear extract for 30 min at 4 C. Where indicated, samples were incubated with the indicated antiserum for 30 min before addition of the radiolabeled DNA probe. For cold competition experiments, the unlabeled competitor DNA was allowed to incubate with the samples for 30 min before addition of the radiolabeled DNA probe. Following a 30-min incubation at 4 C with the radiolabeled DNA probe, the samples were loaded onto prerun 4% polyacrylamide gels (29:1) and electrophoresis performed at approximately 14 V/cm for approximately 2 h with buffer cooling. Gels were transferred, dried, and autoradiography performed overnight with enhancer screens.

Ethylation interference footprints
The ethylation interference footprint experiments were performed as previously described (15, 16, 17). Briefly, 32P-end-labeled DNA probes in 50 mM sodium cacodylate buffer (pH 8.0) were treated with ethylnitrosourea-saturated ethanol for 20 min at 55 C. After precipitation with sodium acetate/ethanol and reprecipitation (3x), the pellets were washed with 70% ethanol, dried, and resuspended in water. Ethylated probes were then used in the gel mobility shift assay as described above, except the amounts of probe were increased to 10–15 fmol. Following electrophoresis, the wet gels were exposed to x-ray film overnight at 4 C. Acrylamide sections corresponding to bound and free DNA were excised, and the DNA recovered by electrochemical elution and precipitation. Cleavage of the modified DNA was accomplished by treatment with 100 mM NaOH/0.1 mM EDTA in 10 mM phosphate buffer at 95 C for 30 min followed by neutralization with sodium acetate and precipitation with ethanol. Samples were separated through 8% sequencing gels, dried, and autoradiography performed. Footprint regions were identified by densitometry of scanned images and comparisons of bound, free and control cleavage reactions.

Tissue sectioning
The bovine PTG was immediately frozen, stored at -80 C and processed as follows. Ten-micrometer thin cryostat sections of the PTG and liver on slides were thawed briefly at room temperature, fixed with 4% paraformaldehyde for 20 min, and subsequently repeatedly rinsed in 10 mM sodium phosphate pH 7.5, 0.9% saline (PBS).

Immunostaining
The manufacturer’s instructions using the Vectastain Elite avidin biotin complex (ABC), avidin/biotin blocking and diaminobenzidine chromogen kits (Vector Laboratories, Burlingame, CA) were followed. Briefly, tissue sections were blocked with normal blocking serum followed by incubations in the avidin/biotin blocking reagents. Application of primary antibodies in PBS + 0.1% Triton X-100 followed and slides were incubated at 4 C overnight. The next day, rinses in PBS were performed as well as incubations in secondary antibody and ABC complex. The use of diaminobenzidine chromogen reaction localized the Sp1, Sp3, VDR, and PTH in the PTG as a golden brown reaction product over positively labeled PTG cells. The tissue sections were counterstained with methyl green and immediately dehydrated in graded alcohols, cleared in xylene, and coverslipped using DPX mountant (Fluka Biochemica, Buchs, Switzerland).

Preliminary titration experiments using 1:200, 1:1000, 1:2000, and 1:5000 were performed to determine optimal antibody concentrations for Sp1 and Sp3 polyclonal antibodies. Both Sp1 (Upstate Biotechnology, Inc.) and Sp3 (Santa Cruz Biotechnology, Inc.) antibodies were optimal at 1:2000 dilutions, hence this dilution was used for the final staining experiments. Negative controls included PTG incubated without primary antibodies or secondary antibodies or ABC complex and subsequently processed following the detailed protocol.

Microscopic analysis and imaging
Immunostained tissue sections were analyzed using the Zeiss Axioplan microscope (Zeiss Inc., Thornwood, NY). Digital images were archived by capturing with DAGE 330 charge-coupled device camera system (DAGE MTI, Michigan City, IN) linked to a Scion CG7/Apple computer (Scion Corp., Frederick, MD). Color figures were generated using Adobe PhotoShop 7.0 software and printed using the Kodak dye-sublimation printer (Eastman Kodak, Rochester, NY).

Western blot analysis
Nuclear extracts (10 µg, unless specified otherwise) were separated on 10–20% gradient gels according to the method of Laemmli (18). The proteins were transferred onto polyvinylidene difluoride membranes and blocked for 30 min at 4 C with 1% non-fat dry milk in PBS/0.05% Tween 20. Incubation with anti-Sp1 antibody (Upstate Biotechnology, Inc., 1:2,000 dilution) or anti-Sp3 antibody (Santa Cruz Biotechnology, Inc., 1:10,000) was continued in the same buffer overnight at 4 C with gentle agitation. The blot was washed 3 x 10 min in PBS/Tween and was then incubated with horseradish peroxidase-linked secondary antibody (1:10,000 dilution). Following three washes as above, the blotted proteins were revealed by chemiluminescent detection (Pierce Biotechnology, Rockford, IL).

Affinity binding
Binding reactions for PTG nuclear extracts were assembled at 4 C as described above for EMSA, except the total volume was adjusted to 500 µl. After 30 min, the sample was divided into two aliquots of 240 µl and 200 pmol of ERE oligonucleotide was added to one sample while the other received 200 pmol of Sp1 consensus oligonucleotide. Samples were incubated at 4 C for 30 min at which time 20 pmol of biotinylated bovine PTH Sp1 element was added to both samples. After 30 min the samples were mixed with streptavidin agarose preequilibrated in binding buffer containing 0.1% NP-40. Samples were incubated at 4 C for 60 min at which time the agarose was pelleted at approximately 500 x g for 1 min. Supernatants were removed and an aliquot was denatured for Western blot analysis. The remaining pellet was washed 3 x 100 µl with KTEDG-150 (150 mM KCl; 20 mM Tris, pH 7.5; 1 mM EDTA; 2 mM DTT; 5% glycerol) containing 0.1% NP-40. DNA-binding proteins were recovered by incubation with 100 µl of KTEDG-500 (same as above except KCl = 500 mM) for 15 min at 4 C. Samples were spun as above, the supernatants were collected and the proteins precipitated with the combination of deoxycholate and 10% trichloroacetic acid. After washing with acetone, samples were resuspended in denaturing buffer for Western blot analysis.

Phosphatase treatment
PTG nuclear extract (45 µl) was mixed with 4.5 µl of 10x phosphatase buffer and then 11-µl aliquots were removed and mixed with either 1 µl of calf intestinal alkaline phosphatase (10 U/µl) or BSA. One set of samples (± phosphatase) was incubated at 4 C, whereas another set was incubated 37 C. After 30 min, the samples were placed on ice and 6 µl from each was removed and used in a binding reaction for EMSA as described above. The remainder of the sample was denatured with a 2x SDS sample buffer and heated at 95 C for 5 min. Western blots for Sp1 and Sp3 were performed as described above using 2.5 µl of denatured sample for each blot, respectively.

Transient transfection
OK cells were maintained in DMEM/F-12 (1:1) with 10% charcoal-stripped fetal bovine serum containing penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37 C. Cells were plated in 24-well plates and transfected in triplicate using Lipofectamine (1.5 µl/well) and Plus reagent (1.5 µl/well) with the appropriate tk/Luc reporter construct (100 ng,), cytomegalovirus-ß-galactosidase expression vector (20 ng) made up to 500 ng total DNA per well with pTZ19R carrier plasmid DNA in serum-free media. After 3 h, serum was added to 1% final concentration and incubation continued at 37 C for an additional 42 h. Lysates were prepared by washing the cells with PBS solution, followed by overlaying with lysis buffer and three rounds of freeze-thawing. Luciferase activity was determined and normalized with respect to values for ß-galactosidase enzymatic activity. Average values were calculated ± SEM and statistical comparisons were obtained with PSI-Plot software (Poly Software International, Pearl River, NY).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study of the PTH promoter has been handicapped by the lack of transformed cell lines capable of synthesizing and secreting PTH, i.e. maintaining a phenotype corresponding to that of a parathyroid chief cell. Therefore, knowing this limitation, our attempt to study factors controlling PTH gene transcription focused on a cross-species computer analysis of promoter regions available in the public genome database, including the human (accession no. AF346654), bovine (accession no. K01938), rat (accession no. K01267) and mouse (accession no. AF066074) sequence information. We reasoned that highly conserved regions of DNA from the different species may exist that could potentially harbor universal transcription factor(s) binding sites that are critical for proper expression of the PTH message. To analyze these regions, the pairwise basic local alignment search tool (BLAST) 2 Sequences alignment program available through the NCBI web site was used (19). Accordingly, all six possible pairwise combinations were examined. Through this analysis, an approximately 140-bp DNA fragment emerged that exhibited highly conserved areas of DNA. Most striking was a core element spanning 44 bp as it relates to the four species examined in the computation (Fig. 1AGo). This core sequence did not include the previously described cAMP response element (9, 10), or another unidentified ubiquitous transcription factor binding site (11).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. A, The 44-bp core element identified through the BLAST 2 Sequences alignment. Numbering relates to positions from respective transcription start sites, and differences from the bovine sequence are underlined. Adenine in bovine sequence that was absent in the original sequence reported in GenBank (accession no. K01938) but was observed in sequencing of this fragment in the present study is marked by asterisk. B, Ethidium bromide stained gel of RT-PCR products for bovine PTH mRNA. Lane 1, 100-bp molecular weight ladder; lane 2, RNA extracted bovine male PTG; lane 3, RNA extracted from bovine female PTG; lane 4, RNA extracted from SaOS-2 cells. The 0.5-kb standard is indicated. C, Diagram of DNA fragments used to analyze binding over the approximately 200-bp region of the bovine PTH promoter. Numbering relates to position from transcription start site.

 
The bovine DNA sequence was chosen for further study for the following reasons: 1) the availability of obtaining glands of sufficient size that would permit the preparation of suitable quantities of protein extracts for the investigation of factors binding to this region of interest, and 2) the combination of bovine PTG extracts binding to bovine PTH promoter DNA sequences provides a species-consistent screen of transcription factors. To ensure that PTGs were indeed being harvested, RNA was prepared from glands obtained from two different animals and RT-PCR performed using primers specific for bovine PTH (accession nos. M25082 and V00106). These primers were positioned to amplify from the 5' untranslated region of the mRNA and the extreme 3' end of coding sequence, including some 3' untranslated sequence. Amplification from contaminating genomic DNA would produce a more than 2 kb PCR product from the same primer pair. Amplification of the bovine PTH mRNA produced a PCR product of the expected size of approximately 320 bp from both animals, whereas this DNA product was not observed in the negative control RNA preparation from SaOS-2 cells (Fig. 1BGo). Thus, bPTGs were being correctly identified and could be gathered for subsequent experiments.

To examine binding to the bovine PTH promoter region, a series of overlapping, PCR-amplified radiolabeled probes were prepared (Table 1Go and Fig. 1CGo). An additional 5' upstream DNA sequence lying outside of the 140-bp conserved region (fragment 2) was also included in this analysis because this region lacked significant similarity in the BLAST comparison and it was anticipated that it would yield few specific binding interactions in the EMSA; essentially acting as a negative control. Difficulties in identifying suitable primers for PCR amplification from the 3' end of the conserved 140-bp region limited the analysis to only 110 bp from the 5' end of this sequence. The 110-bp region was PCR-amplified to create two overlapping products designated fragments 3 and 4, with the entire 44-bp core sequence (Fig. 1AGo) residing in fragment 4. All of these PCR-amplified fragments were sequenced to check for fidelity to the published sequence information (accession no. K01938). No deviations from this information were noted save for the observation of an adenine nucleotide not reported earlier (Fig. 1AGo, asterisk). This appears to fill a gap in the previously reported bovine sequence as it relates to the other species in the comparison. Nuclear extracts were then simultaneously prepared from bovine liver and kidney tissues and used in the EMSAs for comparative purposes with the PTG extract.


View this table:
[in this window]
[in a new window]
 
Table 1. PCR products and primer pairs used for amplification

 
Several complexes appeared with the PTG extracts with DNA fragments 3 and 4 that were not observed with either liver or kidney preparations (Fig. 2AGo). Cold competition experiments (not shown) indicated that the PTG extract formed a single specific complex with fragment 3 (marked by an asterisk), whereas two major specific complexes were observed forming with fragment 4 (marked as B1 and B2). Binding complexes to fragment 2 were evident with all three extracts, however, cold competition experiments (not shown) indicated only a single weak complex was specific (marked by an asterisk). This was in basic agreement with expectations based on the computer analysis that indicated little cross-species conservation of potential binding sites within this sequence.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 2. Panel A, EMSA using nuclear extracts from bovine liver (lanes L), kidney (lanes K), and PTG (lanes P). Radiolabeled probes (fragments 2–4) used in the EMSA are indicated below each set. Specific complexes formed with fragments 2 and 3 marked by asterisks. Specific complexes formed by PTG extract with fragment 4 are denoted as B1, B2 and with arrow. Control binding to 56-bp fragment (lane 1) is examined for specificity by competition with excess unlabeled 56-bp fragment derived by PCR (lane 2) and estrogen response element (lane 3). NS, Nonspecific; F, free probe. Panel B, Footprint analysis of B2 complex from bPTG extract binding to top strand (left image) and bottom strand (right image) of 56-bp fragment. B, Bound; F, free; C, control cleavage of ethylated probe; S, guanine sequencing chemistry. Footprint regions over each strand are indicated, and the composite footprint for both strands is shown below.

 
Because relatively more robust binding complexes formed with the 84-bp fragment 4 and this sequence encompassed the previously described highly conserved 44-bp core motif (Fig. 1AGo), it became the focus of further experiments. Through a series of additional cold competition studies using a similar strategy of overlapping oligonucleotide fragments, it was determined that all the specific binding activity to fragment 4 was localized to 56 bp in the 3' half of the sequence (Fig. 2BGo, lanes 1–3 and data not shown). These results indicated that the 5' one third of fragment 4, including the first 7 nucleotides of the core sequence identified in Fig. 1Go, were dispensable for binding by the PTG transcription factor(s) to this site.

Computer analysis using various transcription factor binding site assessment programs (AliBaba2.1, MatInspector version 2.2, Patch 2.3a) indicated possible binding of several different factors to this 56-bp region. However, to firmly establish the exact position of the binding site(s) to this fragment an ethylation interference footprinting experiment was performed (15, 17). Following recovery of the bound (B2 only) and free radiolabeled probes from EMSA, the modified DNA was cleaved with sodium hydroxide and the products subjected to sequencing gel analysis (Fig. 2BGo). Comparison of B2 and free material from either strand readily revealed two distinct footprint regions lying adjacent to one another: 5' atGAGcaCCGCCCca (top strand, with the interfering nucleotide backbone positions highlighted in uppercase letters). The composite footprint clearly revealed asymmetry in the interactions over the two DNA sites and also exhibited 5' overhangs, indicative of major groove binding. The 3' half of the footprint area, 5' CCGCCC, strongly resembled an Sp1 binding site (20, 21). Collectively, the EMSA and footprint analyses indicated that some PTG nuclear factor specifically recognized an Sp1-like DNA element in the bovine PTH promoter.

Based on these results, the ability of the bovine PTG nuclear factor to recognize and bind to a consensus Sp1 DNA element was assessed. As seen in Fig. 3Go, when a synthesized oligonucleotide probe corresponding to a consensus Sp1 binding site (lanes 5–8) was incubated with the PTG extract it produced an analogous binding pattern as that observed with the 56-bp PTH promoter fragment (lanes 1–4). Furthermore, in cold competition experiments, the 56-bp bovine sequence could compete for binding to the consensus Sp1 element, and likewise in the reverse experiment, the excess unlabeled Sp1 element could specifically compete for extract binding to the radiolabeled 56-bp site. Thus, these cross-competition experiments firmly established the Sp1-like nature of the binding entity present in the bovine PTG nuclear extracts.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 3. Binding to 56 bp (lanes 1–4) and consensus Sp1 (lanes 5–8) radiolabeled DNA probes and cold competition analysis. Lane 1, bPTG extract; lane 2, excess unlabeled 56-bp fragment; lane 3, excess ERE; lane 4, excess consensus Sp1 element; lane 5, bPTG extract; lane 6, excess consensus Sp1 element; lane 7, excess 56-bp fragment; lane 8, excess ERE.

 
The clear implication of the possible involvement of the Sp family in the observed binding activity was evident. Therefore, EMSA was used in combination with antibodies against Sp1 and Sp3, two of the more widely expressed family members (20), to examine whether these complexes contained these two proteins. As seen in Fig. 4Go, binding of the bPTG nuclear extract produced the characteristic binding pattern that included the previously noted B2 and B1 complexes, as well as a previously observed faster migrating specific complex (marked by arrow). Inclusion of an anti-Sp1 antibody resulted in a modest loss of binding activity, whereas addition of an anti-Sp3 antibody resulted in a more significant loss of binding activity associated with the major B2 complex, as well as the disappearance of the band previously denoted as B1. Inclusion of normal rabbit serum as a control failed to displace any of the binding complexes. Simultaneous inclusion of both antibodies in the binding reaction removed the majority of the aforementioned complexes but failed to displace two weak binding bands, one of which migrated in the B2 position, whereas the other was slightly slower than B1 (lane 7).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 4. EMSA using bovine PTG nuclear extract and Sp3/Sp1 antibodies. Lane 1, Control binding reaction of the PTG nuclear extract with bovine PTH Sp1 DNA element; lane 2, addition of an excess of unlabeled bovine PTH Sp1 element; lane 3, addition of an excess of unlabeled ERE; lane 4, addition of anti-Sp1 antibody; lane 5, addition of anti-Sp3 antibody; lane 6, addition of rabbit serum; lane 7, addition of both anti-Sp3 and anti-Sp1 antibodies; lane 8, both antibodies together with excess unlabeled bovine PTH Sp1 element; lane 9, both antibodies together with excess unlabeled ERE.

 
These latter two weak binding complexes raised a concern over the specificity of their interaction with the PTH Sp1 DNA element. The earlier cold competition experiment had shown that an excess of specific competitor could displace all of the slower moving complexes, but it was necessary to determine if a nonspecific competitor could also compete for binding to these bands otherwise obscured by the Sp1/Sp3 complexes. Consistent with earlier competition studies, addition of excess unlabeled specific competitor DNA in the presence of both antibodies resulted in the elimination of all complexes (lane 8). Addition of an excess of nonspecific competitor DNA; however, failed to displace these two bands (lane 9), indicating that they were binding specifically to this DNA element. Thus, whereas Sp3/Sp1 comprise a significant DNA-binding presence with this particular element, additional factors in bPTG nuclear extracts also appear to be capable of specifically interacting with this sequence.

Having established that both Sp1 and Sp3 were primarily responsible for the observed binding complexes with the bovine PTG nuclear extracts and the PTH Sp1 DNA element, cellular localization of Sp1 and Sp3 in the bPTG was determined by immunocytochemistry. Histologically, the bovine PTG is presented predominantly as islands of chief cells delimited by connective tissue capsules (Fig. 5AGo). Application of antibodies to Sp1 and Sp3 indicated the presence of these factors in the bPTG (Fig. 5Go, B and C). Immunostaining with PTH and VDR antibodies confirmed the histological identification of the PTG by identifying cells positive for VDR and PTH (Fig. 5Go, D and E). Altogether, Sp1, Sp3, and VDR were localized to the nuclear compartment of positively labeled PTG cells, whereas PTH was localized to the cytoplasmic compartment. Absence of positive staining in negative controls indicated specific labeling in target tissues (Fig. 5FGo). Infrequently, Sp1 and Sp3 positive labeling were observed in liver cells (data not shown), which is consistent with earlier reports indicating low levels of Sp1 protein in the mouse liver (22).



View larger version (113K):
[in this window]
[in a new window]
 
Figure 5. Histology, immunocytochemical, and Western blot analyses. A, Clusters of chief bPTG cells encapsulated by connective tissue, hematoxylin and eosin counterstained. B, Sp1 positive staining (brown reaction product) in nuclei of PTG cells. C, Sp3 positive staining (brown reaction product) in nuclei of PTG cells. D, PTH positive staining (brown reaction product) in cell cytoplasm and parenchyma of the PTG. E, VDR positive staining (arrows) (brown reaction product) in nuclei of PTG cells. F, Representative negative control PTG section shows absence of specific staining. Tissues in B–F counterstained with methyl green; scale bars, 100 µm in A and 50 µm in B–E. G, Sp1 Western blot using OK cell extract (O), HeLa cell nuclear extract (H), bovine kidney nuclear extract (K), bovine liver nuclear extract (L), and bovine PTG nuclear extract (P). Arrow indicates position of intact Sp1 protein at approximately 115 kDa. H, Sp3 Western blot using the same samples as in G). Arrows indicate position of large form of Sp3 at approximately 110,000 and the small form at approximately 65,000. Molecular weight markers (x103) are indicated.

 
Concurrently, bPTG nuclear extracts were examined in Western blots to confirm that the signal observed by immunocytochemistry corresponded to the predicted molecular weight values for these proteins. Western blotting with an anti-Sp1 antibody revealed the presence of a protein at approximately 115 kDa in the PTG extract (Fig. 5GGo), consistent with positive controls consisting of HeLa and OK cell extracts, as well as smaller immunologically reactive bands that may represent breakdown products. No similarly sized band corresponding to Sp1 was observed in the preparations from bovine liver and kidney, although smaller immunologically reactive bands were evident. Similarly, two intense bands of approximately 110 kDa and 65 kDa were evident in the anti-Sp3 Western blot of bPTG tissue that corresponded to the same sized molecular weights observed for the HeLa and OK cell preparations (Fig. 5HGo). Again, there was no evidence of either of these bands in the liver nuclear extract and only a very weak signal was observed for the 110-kDa protein in the kidney preparation. Together with the immunocytochemical study, it can be concluded that full-length Sp1 and Sp3 are both expressed in the bovine PTG.

To assess whether intact Sp proteins could be specifically recovered from PTG nuclear extracts, the bovine Sp1 PTH element was then used in an affinity purification experiment. A binding reaction containing bPTG nuclear extract was divided and incubated with an excess of an ERE or a consensus Sp1 element (Sp1). Following this preincubation, a biotinylated oligonucleotide probe containing the bovine PTH Sp1 element was added and the incubation continued. After adding streptavidin agarose and allowing for capture of the biotinlyated DNA, the supernatants, containing unbound proteins, were recovered and an aliquot removed for Western blot analysis. The matrix, containing the protein-DNA complexes, was then thoroughly washed, the proteins eluted, precipitated and also subjected to Western blot analysis. The supernatant fractions following the initial recovery of the protein-DNA complexes still contained significant amounts of Sp3 immunoreactivity in the form of both the 110- and 65-kDa proteins (Fig. 6AGo), suggesting that not all of the Sp3 present in the extract was capable of binding to the DNA sequence. However, material incubated with the ERE competitor DNA clearly revealed intense immunoblotting for Sp3 proteins, indicating that this nonspecific DNA did not prevent Sp3 from binding to the bovine PTH Sp1 element. In contrast, preincubation of the bPTG extract with the consensus Sp1 oligonucleotide completely abrogated binding by the Sp3 proteins to the biotinylated PTH Sp1 element. Thus, the data confirm that intact Sp3 proteins are specifically interacting with the bovine PTH Sp1 element. Analogous results were seen when the same analysis was carried out for Sp1 binding activity (Fig. 6BGo).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Affinity isolation of Sp proteins using the bovine PTH Sp1 element. Bovine PTG nuclear extract was incubated in a binding reaction containing either excess unlabeled consensus Sp1 oligonucleotide (Sp1) or ERE, and biotinylated bovine PTH Sp1 element. Following binding and capture by streptavidin agarose the supernatant fractions (Super), containing nuclear factors not initially bound to the bovine PTH Sp1 DNA element, were collected and SDS samples prepared for Western blot analysis (~1% of input). Proteins bound to the biotinylated bovine PTH Sp1 element (Bound) were subsequently recovered and analyzed in Western blots (~20% of recovered material). A, Analysis for Sp3 protein. Arrows indicate positions of the 110- and 65-kDa proteins. B, Analysis for Sp1 protein. Arrow indicates position of the 115-kDa protein.

 
The presence of the Sp1/Sp3 proteins in the supernatants from the affinity binding experiment, in conjunction with the reported influence that phosphorylation can have on DNA-binding of Sp proteins (23, 24), lead us to consider whether phosphorylation status could alter the DNA binding observed by the Sp1/Sp3 complexes in EMSA. As seen in Fig. 7Go, treatment of the bovine PTG nuclear extract with phosphatase at 4 C resulted in a strong increase (~2-fold) in complex formation relative to the control incubation. In contrast, control binding at 37 C was dramatically diminished, whereas treatment with phosphatase preserved strong complex formation. The dramatic decrease in binding observed in the 37 C control sample was not due to the degradation of either Sp1 or Sp3 because Western blots obtained from the same binding samples indicated that the proteins were largely intact and similar amounts were observed between the various treatments.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 7. Phosphatase treatment of bPTG nuclear extracts. Extracts were treated with or without phosphatase at the indicated temperatures, then aliquots were removed and used in (A) an EMSA binding reaction with the PTH Sp1 DNA element, or (B) Western blot analyses with the indicated anti-Sp antibodies. CIP, Calf intestinal phosphatase.

 
Finally, due to the lack of a suitable transformed parathyroid chief cell line, transient transfection analysis was pursued in OK cells to determine if the bovine Sp1 PTH element affected transcriptional activity. Our group has worked extensively with OK cells (25, 26), and these seemed a suitable alternative given the presence of both Sp1/Sp3 proteins in Western blots (Fig. 3Go, G and H). A single copy of an oligonucleotide containing the bovine PTH Sp1 element was cloned into the tk/Luc reporter and compared with the parent vector as well as a reporter construct containing a mutated form of this element. Based on the prior footprint analysis this mutant bovine Sp1-like sequence contained mutations (..AGCACCGCCCCA.. -> ..AGCACATAACCA..) that rendered the sequence a poor competitor for specific binding by the bPTG nuclear extracts in EMSA (data not shown). A single copy of the wild-type bovine element resulted in a significant enhancement (~5-fold) of transcriptional activity (Fig. 8Go). Luciferase activity declined significantly with the mutant bovine sequence, approximating the activity observed with the parent vector. Thus, the minimal bovine Sp1-like DNA element is capable of acting as an enhancer of heterologous promoter activity in this cell line.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 8. OK cells were transfected with the tk/Luc control vector (tk), the tk/Luc reporter containing the bovine PTH Sp1 site (BovSp1), and the tk/Luc reporter containing a mutant form of the bovine PTH Sp1 site (BovMutSp1). Cells were harvested; luciferase activities determined and normalized to ß-galactosidase enzymatic activities. Data are representative of three independent experiments. a, Significantly different from tk/Luc control, P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Sp proteins are considered to be essential factors for the transcription of a host of genes, including many that are expressed in a tissue-specific manner (27, 28, 29, 30). The present study identified the Sp1 and Sp3 proteins as specifically binding to a previously uncharacterized Sp1 DNA element in the PTH promoter. This element is highly conserved across PTH promoters from several different species and analogous Sp1/Sp3 binding complexes were similarly observed with the rat, murine, and human sequences (data not shown). The PTH Sp1 DNA element was capable of acting as an enhancer of gene transcription in a heterologous system; however, because of the lack of a transformed cell line that mimics a parathyroid chief cell, the exact role of this element within the context of chief cell transcription factors remains to be explored. Nevertheless, the finding of a highly conserved Sp1 element in the PTH promoter is consistent with a prominent role for the Sp family of transcription factors in regulating basal expression of this tissue-specific hormone.

The immunocytochemical and Western blotting experiments confirmed that both Sp1 and Sp3 proteins were abundantly expressed in the PTG and of the predicted size. In particular, very robust expression of Sp3 has been consistently observed throughout multiple bovine PTG nuclear extract preparations. In contrast, the level of expression of these factors in adult bovine kidney and liver preparations were low to undetectable in EMSA and Western blots despite simultaneous processing under identical conditions. Based on murine expression and localization data, Sp1 can be highly variable in different tissues and stages of development, with kidney and liver generally expressing low amounts of mRNA and protein (22). This is consistent with our observations using nuclear extracts prepared from those same bovine tissues. Alternatively, it is also possible that Sp1 and Sp3 are being rapidly degraded by proteases in these tissues. However, Western blotting of retinoid X receptor proteins from the bovine kidney and liver nuclear extracts confirmed their presence at the expected molecular weights (data not shown). Thus, proteolysis, if it is occurring, appears not to be a general phenomenon and would suggest specific enzymes recognizing the Sp transcription factors.

These two proteins, and Sp3 in particular, constituted the major DNA-binding constituents observed with the PTH Sp1 element in EMSA. Nonetheless, other DNA-binding complexes not sensitive to the Sp protein antibodies were also capable of specifically interacting with this sequence. These include a much faster moving complex that may represent some proteolyzed version of either Sp1 or Sp3, consistent with the lower molecular weight proteins appearing in the Western blot analyses. The Sp/"X"KLF family of proteins includes numerous other members that could also bind to such a response element (31), and additional work will be required to determine the identity of these unknown DNA-binding factors.

The activity of the Sp proteins can be influenced by multiple factors, including phosphorylation, redox state, and acetylation (23, 24, 32, 33). Our finding of widespread expression of Sp1 and Sp3 proteins throughout the PTG, while important, does not address the fundamental question of whether or not, or in which cells, these proteins are present in an active state. This raises the possibility that some disconnect may exist between the presence of these factors and active synthesis or suppression of PTH mRNA transcription. In support of this possibility, the affinity binding and phosphatase experiments indicated some portion of the Sp1/Sp3 proteins was incapable of specifically binding to the PTH Sp1 element, whereas treatment with phosphatase strongly increased the DNA-binding activity. Interestingly, the control reaction for the phosphatase experiment carried out at 37 C exhibited a dramatic decrease in DNA-binding capacity that was not linked to the degradation of these proteins. This was largely prevented by phosphatase treatment and, accordingly, suggests some other type of event is occurring in the control extract under these conditions that negatively impacts Sp1/Sp3 binding. Further studies are needed to determine if this is the result of a direct effect on the Sp1/Sp3 proteins themselves or indirectly through some other factor impacting their DNA-binding ability.

The actions of Sp1 and Sp3 at a given promoter appear to be complex, but, in many cases, expression of Sp3 is thought to antagonize the stimulatory actions of Sp1 on gene transcription (34, 35, 36). In the present circumstance, such a scenario would lead to a prediction that Sp1 acts as an enhancer of PTH gene transcription, whereas Sp3 opposes those actions. Therefore, in the simplest scenario that ignores the contribution of other transcription factors, reduced expression of Sp3 would lead to a prediction of hyperparathyroidism. Sp1 knockout mice are embryonic lethal (37), apparently at a stage of development that precedes PTG development (38). On the other hand, Sp3 knockout mice survive to birth, at which time they apparently succumb to respiratory failure (39). Suske and colleagues (40) have also described bone abnormalities in the Sp3 knockout mouse, with what appears to be a defect in osteoblast function. In view of our observations, it would be extremely enlightening to determine the circulating concentrations of PTH in the Sp3 knockout mice. This could then provide a clue as to the relative importance and direction of the Sp3 protein in regulating transcription of the PTH gene.

Recently, GCMB/gcm2 has been found to be a transcription factor that is essential for proper development of the PTG (12, 13). While the relationship between GCMB/gcm2 and the PTH gene is still evolving, our findings suggest that the Sp family is likely playing an important role in transcription of the peptide hormone by interacting with a highly conserved Sp1 DNA element in the gene’s promoter. It will be of interest to determine the relationship between these and other transcription factors that impact synthesis of the PTH gene, and how these may play a role in the development of various disease conditions that affect production of this key regulatory hormone.


    Acknowledgments
 
The authors thank H. Gravatte, A. Rowan, T. Sexton and J. van Willigen for their excellent technical assistance. They would also like to extend their sincere thanks to C. Courtney and M. Wasson (C&W Meats, Cynthiana, KY), and J. Boone (Boone’s Abattoir, Bardstown, KY) for their assistance in procuring bovine tissues.


    Footnotes
 
This work was supported in part by NIH Grants DK-54276 (to N.J.K.), DK-002830 (to M.C.L.), DK-051530 (to H.H.M.), and the University of Kentucky Medical Center Research Fund (to N.J.K.).

Abbreviations: ABC, Avidin biotin complex; BLAST, basic local alignment search tool; bPTG, bovine PTG; ERE, estrogen response element; Gcm2, glial cells missing 2; GCMB, glial cells missing b; OK, opossum kidney; PTG, parathyroid gland; SDS, sodium dodecyl sulfate; NP-40, Nonidet P-40; tk/Luc, thymidine kinase/luciferase; VDR, vitamin D receptor.

Received January 27, 2003.

Accepted for publication March 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163 (Letter)[CrossRef][Medline]
  2. Liu SM, Koszewski N, Lupez M, Malluche HH, Olivera A, Russell J 1996 Characterization of a response element in the 5'-flanking region of the avian (chicken) PTH gene that mediates negative regulation of gene transcription by 1, 25-dihydroxyvitamin D3 and binds the vitamin D3 receptor. Mol Endocrinol 10:206–215[Abstract]
  3. Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM 1992 Sequences in the human parathyroid hormone gene that bind the 1, 25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1, 25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 89:8097–8101[Abstract/Free Full Text]
  4. Hawa NS, O’Riordan JL, Farrow SM 1994 Binding of 1, 25-dihydroxyvitamin D3 receptors to the 5'-flanking region of the bovine parathyroid hormone gene. J Endocrinol 142:53–60[Abstract/Free Full Text]
  5. Russell J, Ashok S, Koszewski NJ 1999 Vitamin D receptor interactions with the rat parathyroid hormone gene: synergistic effects between two negative vitamin D response elements. J Bone Miner Res 14:1828–1837[CrossRef][Medline]
  6. Izumi T, Henner WD, Mitra S 1996 Negative regulation of the major human AP-endonuclease, a multifunctional protein. Biochemistry 35:14679–14683[CrossRef][Medline]
  7. Okazaki T, Zajac JD, Igarashi T, Ogata E, Kronenberg HM 1991 Negative regulatory elements in the human parathyroid hormone gene. J Biol Chem 266:21903–21910[Abstract/Free Full Text]
  8. Okazaki T, Chung U, Nishishita T, Ebisu S, Usuda S, Mishiro S, Xanthoudakis S, Igarashi T, Ogata E 1994 A redox factor protein, ref1, is involved in negative gene regulation by extracellular calcium. J Biol Chem 269:27855–27862[Abstract/Free Full Text]
  9. Rupp E, Mayer H, Wingender E 1990 The promoter of the human parathyroid hormone gene contains a functional cyclic AMP-response element. Nucleic Acids Res 18:5677–5683[Abstract/Free Full Text]
  10. Deutsch PJ, Hoeffler JP, Jameson JL, Lin JC, Habener JF 1988 Structural determinants for transcriptional activation by cAMP-responsive DNA elements. J Biol Chem 263:18466–18472[Abstract/Free Full Text]
  11. Darwish HM, DeLuca HF 1999 Identification of a transcription factor that binds to the promoter region of the human parathyroid hormone gene. Arch Biochem Biophys 365:123–130[CrossRef][Medline]
  12. Gunther T, Chen ZF, Kim J, Priemel M, Rueger JM, Amling M, Moseley JM, Martin TJ, Anderson DJ, Karsenty G 2000 Genetic ablation of parathyroid glands reveals another source of parathyroid hormone. Nature 406:199–203[CrossRef][Medline]
  13. Ding C, Buckingham B, Levine MA 2001 Familial isolated hypoparathyroidism caused by a mutation in the gene for the transcription factor GCMB. J Clin Invest 108:1215–1220[CrossRef][Medline]
  14. Koszewski NJ, Reinhardt TA, Langub MC, Malluche HH, Horst RL 1998 Selectivity of a C-terminal peptide antiserum for different DNA-binding states of the vitamin D receptor. Arch Biochem Biophys 349:388–396[CrossRef][Medline]
  15. Siebenlist U, Gilbert W 1980 Contacts between Escherichia coli RNA polymerase and an early promoter of phage T7. Proc Natl Acad Sci USA 77:122–126[Abstract/Free Full Text]
  16. Koszewski NJ, Notides AC 1991 Phosphate-sensitive binding of the estrogen receptor to its response elements. Mol Endocrinol 5:1129–1136[CrossRef][Medline]
  17. Koszewski NJ, Malluche HH, Russell J 2000 Vitamin D receptor interactions with positive and negative DNA response elements: an interference footprint comparison. J Steroid Biochem Mol Biol 72:125–132[CrossRef][Medline]
  18. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]
  19. Tatusova TA, Madden TL 1999 BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174:247–250[CrossRef][Medline]
  20. Suske G 1999 The Sp-family of transcription factors. Gene 238:291–300[CrossRef][Medline]
  21. Lania L, Majello B, De Luca P 1997 Transcriptional regulation by the Sp family proteins. Int J Biochem Cell Biol 29:1313–1323[CrossRef][Medline]
  22. Saffer JD, Jackson SP, Annarella MB 1991 Developmental expression of Sp1 in the mouse. Mol Cell Biol 11:2189–2199[Abstract/Free Full Text]
  23. Leggett RW, Armstrong SA, Barry D, Mueller CR 1995 Sp1 is phosphorylated and its DNA binding activity down-regulated upon terminal differentiation of the liver. J Biol Chem 270:25879–25884[Abstract/Free Full Text]
  24. Ge Y, Matherly LH, Taub JW 2001 Transcriptional regulation of cell-specific expression of the human cystathionine ß-synthase gene by differential binding of Sp1/Sp3 to the -1b promoter. J Biol Chem 276:43570–43579[Abstract/Free Full Text]
  25. Koszewski NJ, Ashok S, Russell J 1999 Turning a negative into a positive: vitamin D receptor interactions with the avian parathyroid hormone response element. Mol Endocrinol 13:455–465[Abstract/Free Full Text]
  26. Koszewski NJ, Kiessling S, Malluche HH 2001 Isolation of genomic DNA sequences that bind vitamin D receptor complexes. Biochem Biophys Res Commun 283:188–194[CrossRef][Medline]
  27. Hirata H, Yamamura I, Yasuda K, Kobayashi A, Tada N, Suzuki M, Hirayoshi K, Hosokawa N, Nagata K 1999 Separate cis-acting DNA elements control cell type- and tissue-specific expression of collagen binding molecular chaperone HSP47. J Biol Chem 274:35703–35710[Abstract/Free Full Text]
  28. Whetstine JR, Matherly LH 2001 The basal promoters for the human reduced folate carrier gene are regulated by a GC-box and a cAMP-response element/AP-1-like element. Basis for tissue-specific gene expression. J Biol Chem 276:6350–6358[Abstract/Free Full Text]
  29. Cohen HT, Bossone SA, Zhu G, McDonald GA, Sukhatme VP 1997 Sp1 is a critical regulator of the Wilms’ tumor-1 gene. J Biol Chem 272:2901–2913[Abstract/Free Full Text]
  30. Rodenburg RJ, Holthuizen PE, Sussenbach JS 1997 A functional Sp1 binding site is essential for the activity of the adult liver-specific human insulin-like growth factor II promoter. Mol Endocrinol 11:237–250[Abstract/Free Full Text]
  31. Philipsen S, Suske G 1999 A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res 27:2991–3000[Abstract/Free Full Text]
  32. Braun H, Koop R, Ertmer A, Nacht S, Suske G 2001 Transcription factor Sp3 is regulated by acetylation. Nucleic Acids Res 29:4994–5000[Abstract/Free Full Text]
  33. Ammendola R, Mesuraca M, Russo T, Cimino F 1994 The DNA-binding efficiency of Sp1 is affected by redox changes. Eur J Biochem 225:483–489[Medline]
  34. Birnbaum MJ, van Wijnen AJ, Odgren PR, Last TJ, Suske G, Stein GS, Stein JL 1995 Sp1 trans-activation of cell cycle regulated promoters is selectively repressed by Sp3. Biochemistry 34:16503–16508[CrossRef][Medline]
  35. Ghayor C, Chadjichristos C, Herrouin JF, Ala-Kokko L, Suske G, Pujol JP, Galera P 2001 Sp3 represses the Sp1-mediated transactivation of the human COL2A1 gene in primary and de-differentiated chondrocytes. J Biol Chem 276:36881–36895[Abstract/Free Full Text]
  36. Yang Y, Hwang CK, Junn E, Lee G, Mouradian MM 2000 ZIC2 and Sp3 repress Sp1-induced activation of the human D1A dopamine receptor gene. J Biol Chem 275:38863–38869[Abstract/Free Full Text]
  37. Marin M, Karis A, Visser P, Grosveld F, Philipsen S 1997 Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89:619–628[CrossRef][Medline]
  38. Tucci J, Russell A, Senior PV, Fernley R, Ferraro T, Beck F 1996 The expression of parathyroid hormone and parathyroid hormone-related protein in developing rat parathyroid glands. J Mol Endocrinol 17:149–157[Abstract/Free Full Text]
  39. Bouwman P, Gollner H, Elsasser HP, Eckhoff G, Karis A, Grosveld F, Philipsen S, Suske G 2000 Transcription factor Sp3 is essential for post-natal survival and late tooth development. EMBO J 19:655–661[CrossRef][Medline]
  40. Gollner H, Dani C, Phillips B, Philipsen S, Suske G 2001 Impaired ossification in mice lacking the transcription factor Sp3. Mech Dev 106:77–83[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
K. Ogasawara, T. Terada, J.-i. Asaka, T. Katsura, and K.-i. Inui
Human Organic Anion Transporter 3 Gene Is Regulated Constitutively and Inducibly via a cAMP-Response Element
J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 317 - 322.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. O. Boylan, L. I. Jepeal, and M. M. Wolfe
Sp1/Sp3 binding is associated with cell-specific expression of the glucose-dependent insulinotropic polypeptide receptor gene
Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1287 - E1295.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Alimov, O.-K. Park-Sarge, K. D. Sarge, H. H. Malluche, and N. J. Koszewski
Transactivation of the Parathyroid Hormone Promoter by Specificity Proteins and the Nuclear Factor Y Complex
Endocrinology, August 1, 2005; 146(8): 3409 - 3416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. J. Koszewski, A. P. Alimov, O.-K. Park-Sarge, and H. H. Malluche
Suppression of the Human Parathyroid Hormone Promoter by Vitamin D Involves Displacement of NF-Y Binding to the Vitamin D Response Element
J. Biol. Chem., October 8, 2004; 279(41): 42431 - 42437.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Alimov, M. C. Langub, H. H. Malluche, O.-K. Park-Sarge, and N. J. Koszewski
Contrasting Mammalian Parathyroid Hormone (PTH) Promoters: Nuclear Factor-Y Binds to a Deoxyribonucleic Acid Element Unique to the Human PTH Promoter and Acts as a Transcriptional Enhancer
Endocrinology, June 1, 2004; 145(6): 2713 - 2720.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Nesbit, M. R. Bowl, B. Harding, A. Ali, A. Ayala, C. Crowe, A. Dobbie, G. Hampson, I. Holdaway, M. A. Levine, et al.
Characterization of GATA3 Mutations in the Hypoparathyroidism, Deafness, and Renal Dysplasia (HDR) Syndrome
J. Biol. Chem., May 21, 2004; 279(21): 22624 - 22634.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services