| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
University of Kentucky Medical Center, Division of Nephrology, Bone and Mineral Metabolism, Lexington, Kentucky 40536-0298
Address all correspondence and requests for reprints to: N. J. Koszewski, University of Kentucky Medical Center, Division of Nephrology, Bone and Mineral Metabolism, Room MN562, 800 Rose Street, Lexington, Kentucky 40536-0298. E-mail: njhosz0{at}uky.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Conversely, very little is known about the transcription factors that may be responsible for enhanced or basal expression of the PTH gene. A cAMP response element has been described in the promoters of the human and bovine PTH genes (9, 10). The human promoter also harbors another enhancer DNA element for some, as yet, unidentified ubiquitously expressed transcription factor present in a variety of cell lines that were tested (11). Finally, the transcription factor glial cells missing 2 (Gcm2)/glial cells missing B (GCMB) appears to be essential for proper development of the parathyroid gland (PTG) itself (12, 13).
In the present study, a computer analysis of PTH promoters from four mammalian species revealed a highly conserved DNA region in each of the respective promoters. Using this region of DNA and nuclear extracts from bovine PTGs (bPTGs), an Sp1 DNA element within this sequence has been identified. Furthermore, Sp3 and Sp1 are abundantly expressed in the adult PTG and are primarily responsible for the interactions with this DNA element. Phosphatase treatment of bPTG extracts promotes Sp3/Sp1 DNA-binding with this element, which acts as an enhancer in heterologous reporter gene experiments. The data, therefore, are strongly supportive of a role for Sp3 and Sp1 in regulating PTH gene transcription.
| Materials and Methods |
|---|
|
|
|---|
Preparation of nuclear extracts
Tissues were placed in ice-cold DMEM/F-12 (1:1, no phenol red) and transported to the laboratory. It was necessary to dissect away surrounding fat from the parathyroid tissue before the extraction process. The tissues were then minced, incubated on ice in 3 volumes of a cold low-salt buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM EDTA, 2.0 mM dithiothreitol (DTT), 10% glycerol; and 1x protease inhibitor cocktail] for 20 min followed by cell disruption with a Teflon Dounce homogenizer. Following a 30-min spin at 100,000 x g, the supernatants were removed and the nuclear pellets resuspended in 1 volume cold high-salt buffer (same as above with 400 mM KCl) and incubated on ice for 30 min with occasional gentle mixing. Samples were then spun at 100,000 x g for 30 min. The supernatant fractions were collected, aliquoted into individual tubes, snap-frozen and stored at -70 C before use.
Cells in culture are trypsinized and transferred to a 50-ml conical tube. After pelleting (600 x g/10 min) the cells are washed twice with PBS. Cells are then resuspended in three volumes of ice-cold low salt buffer (20 mM Tris, pH 7.5; 1.5 mM EDTA; 2.0 mM DTT; 5% glycerol; and protease inhibitor cocktail, same as above). Cells are subjected to three rounds of freeze-thawing and then spun at 30,000 x g for 30 min. Supernatants are removed and the nuclear pellet reuspended in 1.5 volumes of extraction buffer [400 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2.0 mM DTT, 5% glycerol, 0.05% Nonidet P-40 (NP-40), and protease inhibitor cocktail, same as above]. After 30 min, the samples are spun as above, the supernatant fraction collected, aliquoted into individual tubes, snap-frozen and stored at -70 C before use.
PCR and preparation of bovine PTH promoter fragments
Bovine liver tissue (1 g) was incubated in 10 ml of digestion buffer [10 mM Tris, pH 7.5; 100 mM NaCl; 25 mM EDTA; 0.5% sodium dodecyl sulfate (SDS); and 1.1 mg proteinase K] at 50 C for 24 h. One milliliter of this mixture was removed and extracted one time with phenol/chloroform (1:1) and ethanol precipitated. The pellet was dissolved in TE [10 mM Tris (pH 8.0), 1 mM EDTA] buffer and treated with 6 µg ribonuclease A for 30 min at 37 C. The sample was again extracted with phenol/chloroform, precipitated, resuspended in TE buffer and assessed for concentration and purity by UV absorption and agarose gel electrophoresis.
RT-PCR analysis of bovine PTH mRNA
PTG tissue was extracted with guanidinium isothiocyanate and purified by CsCl centrifugation. RNA (2 µg) was used in a reaction with Moloney murine leukemia virus reverse transcriptase (Ambion, Inc., Austin, TX) and bovine PTH 3' primer, ATCCACATCAGCTTTGTCTGCT, in a 20-µl reaction volume at 42 C for 1 h according to the manufacturers directions. An aliquot (5 µl) was then removed, mixed with recombinant Taq polymerase (Invitrogen Life Technologies, Inc., Carlsbad, CA), deoxynucleotide triphsphates and a mixture containing bovine PTH 3' primer (above) and bovine PTH 5' primer, GATTGTATCCTAAGACGTGTGT, in a 50-µl PCR. Amplification was carried out by initial denaturation at 94 C for 1 min, followed by 30 cycles of 94 C/15 sec, 53 C/30 sec, and 72 C/1 min. An aliquot (9 µl) was then removed and analyzed by agarose gel electrophoresis and ethidium bromide staining.
EMSA
Bovine PTH promoter fragments were liberated from the pT-Adv cloning vector (BD Biosciences Clontech, Palo Alto, CA) by digestion with EcoRI. These DNA fragments, possessing 5' overhangs, were radiolabeled using the combination of Klenow fragment (exo-) and 32P-
-deoxy-ATP (3000 Ci/mmol, Perkin-Elmer Life Sciences, Boston, MA). The radiolabeled DNA fragments were subsequently gel purified before use in binding reactions. Double-stranded oligonucleotide probes were radiolabeled using the combination of 32P-
-ATP (6000 Ci/mmol, Perkin-Elmer Life Sciences) and T4 polynucleotide kinase.
Binding reactions (20 µl total volume) were assembled in a buffer consisting of 120 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2 mM DTT, 5% glycerol, 0.5% 3-[(cholamidopropyl)dimethylammonio]propanesulfonate, 10 mM NaF, 100 µM Na3VO4, 1.5 µg deoxyinosine-deoxycytidine, 100 µM leupeptin, and nuclear extract for 30 min at 4 C. Where indicated, samples were incubated with the indicated antiserum for 30 min before addition of the radiolabeled DNA probe. For cold competition experiments, the unlabeled competitor DNA was allowed to incubate with the samples for 30 min before addition of the radiolabeled DNA probe. Following a 30-min incubation at 4 C with the radiolabeled DNA probe, the samples were loaded onto prerun 4% polyacrylamide gels (29:1) and electrophoresis performed at approximately 14 V/cm for approximately 2 h with buffer cooling. Gels were transferred, dried, and autoradiography performed overnight with enhancer screens.
Ethylation interference footprints
The ethylation interference footprint experiments were performed as previously described (15, 16, 17). Briefly, 32P-end-labeled DNA probes in 50 mM sodium cacodylate buffer (pH 8.0) were treated with ethylnitrosourea-saturated ethanol for 20 min at 55 C. After precipitation with sodium acetate/ethanol and reprecipitation (3x), the pellets were washed with 70% ethanol, dried, and resuspended in water. Ethylated probes were then used in the gel mobility shift assay as described above, except the amounts of probe were increased to 1015 fmol. Following electrophoresis, the wet gels were exposed to x-ray film overnight at 4 C. Acrylamide sections corresponding to bound and free DNA were excised, and the DNA recovered by electrochemical elution and precipitation. Cleavage of the modified DNA was accomplished by treatment with 100 mM NaOH/0.1 mM EDTA in 10 mM phosphate buffer at 95 C for 30 min followed by neutralization with sodium acetate and precipitation with ethanol. Samples were separated through 8% sequencing gels, dried, and autoradiography performed. Footprint regions were identified by densitometry of scanned images and comparisons of bound, free and control cleavage reactions.
Tissue sectioning
The bovine PTG was immediately frozen, stored at -80 C and processed as follows. Ten-micrometer thin cryostat sections of the PTG and liver on slides were thawed briefly at room temperature, fixed with 4% paraformaldehyde for 20 min, and subsequently repeatedly rinsed in 10 mM sodium phosphate pH 7.5, 0.9% saline (PBS).
Immunostaining
The manufacturers instructions using the Vectastain Elite avidin biotin complex (ABC), avidin/biotin blocking and diaminobenzidine chromogen kits (Vector Laboratories, Burlingame, CA) were followed. Briefly, tissue sections were blocked with normal blocking serum followed by incubations in the avidin/biotin blocking reagents. Application of primary antibodies in PBS + 0.1% Triton X-100 followed and slides were incubated at 4 C overnight. The next day, rinses in PBS were performed as well as incubations in secondary antibody and ABC complex. The use of diaminobenzidine chromogen reaction localized the Sp1, Sp3, VDR, and PTH in the PTG as a golden brown reaction product over positively labeled PTG cells. The tissue sections were counterstained with methyl green and immediately dehydrated in graded alcohols, cleared in xylene, and coverslipped using DPX mountant (Fluka Biochemica, Buchs, Switzerland).
Preliminary titration experiments using 1:200, 1:1000, 1:2000, and 1:5000 were performed to determine optimal antibody concentrations for Sp1 and Sp3 polyclonal antibodies. Both Sp1 (Upstate Biotechnology, Inc.) and Sp3 (Santa Cruz Biotechnology, Inc.) antibodies were optimal at 1:2000 dilutions, hence this dilution was used for the final staining experiments. Negative controls included PTG incubated without primary antibodies or secondary antibodies or ABC complex and subsequently processed following the detailed protocol.
Microscopic analysis and imaging
Immunostained tissue sections were analyzed using the Zeiss Axioplan microscope (Zeiss Inc., Thornwood, NY). Digital images were archived by capturing with DAGE 330 charge-coupled device camera system (DAGE MTI, Michigan City, IN) linked to a Scion CG7/Apple computer (Scion Corp., Frederick, MD). Color figures were generated using Adobe PhotoShop 7.0 software and printed using the Kodak dye-sublimation printer (Eastman Kodak, Rochester, NY).
Western blot analysis
Nuclear extracts (10 µg, unless specified otherwise) were separated on 1020% gradient gels according to the method of Laemmli (18). The proteins were transferred onto polyvinylidene difluoride membranes and blocked for 30 min at 4 C with 1% non-fat dry milk in PBS/0.05% Tween 20. Incubation with anti-Sp1 antibody (Upstate Biotechnology, Inc., 1:2,000 dilution) or anti-Sp3 antibody (Santa Cruz Biotechnology, Inc., 1:10,000) was continued in the same buffer overnight at 4 C with gentle agitation. The blot was washed 3 x 10 min in PBS/Tween and was then incubated with horseradish peroxidase-linked secondary antibody (1:10,000 dilution). Following three washes as above, the blotted proteins were revealed by chemiluminescent detection (Pierce Biotechnology, Rockford, IL).
Affinity binding
Binding reactions for PTG nuclear extracts were assembled at 4 C as described above for EMSA, except the total volume was adjusted to 500 µl. After 30 min, the sample was divided into two aliquots of 240 µl and 200 pmol of ERE oligonucleotide was added to one sample while the other received 200 pmol of Sp1 consensus oligonucleotide. Samples were incubated at 4 C for 30 min at which time 20 pmol of biotinylated bovine PTH Sp1 element was added to both samples. After 30 min the samples were mixed with streptavidin agarose preequilibrated in binding buffer containing 0.1% NP-40. Samples were incubated at 4 C for 60 min at which time the agarose was pelleted at approximately 500 x g for 1 min. Supernatants were removed and an aliquot was denatured for Western blot analysis. The remaining pellet was washed 3 x 100 µl with KTEDG-150 (150 mM KCl; 20 mM Tris, pH 7.5; 1 mM EDTA; 2 mM DTT; 5% glycerol) containing 0.1% NP-40. DNA-binding proteins were recovered by incubation with 100 µl of KTEDG-500 (same as above except KCl = 500 mM) for 15 min at 4 C. Samples were spun as above, the supernatants were collected and the proteins precipitated with the combination of deoxycholate and 10% trichloroacetic acid. After washing with acetone, samples were resuspended in denaturing buffer for Western blot analysis.
Phosphatase treatment
PTG nuclear extract (45 µl) was mixed with 4.5 µl of 10x phosphatase buffer and then 11-µl aliquots were removed and mixed with either 1 µl of calf intestinal alkaline phosphatase (10 U/µl) or BSA. One set of samples (± phosphatase) was incubated at 4 C, whereas another set was incubated 37 C. After 30 min, the samples were placed on ice and 6 µl from each was removed and used in a binding reaction for EMSA as described above. The remainder of the sample was denatured with a 2x SDS sample buffer and heated at 95 C for 5 min. Western blots for Sp1 and Sp3 were performed as described above using 2.5 µl of denatured sample for each blot, respectively.
Transient transfection
OK cells were maintained in DMEM/F-12 (1:1) with 10% charcoal-stripped fetal bovine serum containing penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37 C. Cells were plated in 24-well plates and transfected in triplicate using Lipofectamine (1.5 µl/well) and Plus reagent (1.5 µl/well) with the appropriate tk/Luc reporter construct (100 ng,), cytomegalovirus-ß-galactosidase expression vector (20 ng) made up to 500 ng total DNA per well with pTZ19R carrier plasmid DNA in serum-free media. After 3 h, serum was added to 1% final concentration and incubation continued at 37 C for an additional 42 h. Lysates were prepared by washing the cells with PBS solution, followed by overlaying with lysis buffer and three rounds of freeze-thawing. Luciferase activity was determined and normalized with respect to values for ß-galactosidase enzymatic activity. Average values were calculated ± SEM and statistical comparisons were obtained with PSI-Plot software (Poly Software International, Pearl River, NY).
| Results |
|---|
|
|
|---|
|
To examine binding to the bovine PTH promoter region, a series of overlapping, PCR-amplified radiolabeled probes were prepared (Table 1
and Fig. 1C
). An additional 5' upstream DNA sequence lying outside of the 140-bp conserved region (fragment 2) was also included in this analysis because this region lacked significant similarity in the BLAST comparison and it was anticipated that it would yield few specific binding interactions in the EMSA; essentially acting as a negative control. Difficulties in identifying suitable primers for PCR amplification from the 3' end of the conserved 140-bp region limited the analysis to only 110 bp from the 5' end of this sequence. The 110-bp region was PCR-amplified to create two overlapping products designated fragments 3 and 4, with the entire 44-bp core sequence (Fig. 1A
) residing in fragment 4. All of these PCR-amplified fragments were sequenced to check for fidelity to the published sequence information (accession no. K01938). No deviations from this information were noted save for the observation of an adenine nucleotide not reported earlier (Fig. 1A
, asterisk). This appears to fill a gap in the previously reported bovine sequence as it relates to the other species in the comparison. Nuclear extracts were then simultaneously prepared from bovine liver and kidney tissues and used in the EMSAs for comparative purposes with the PTG extract.
|
|
Computer analysis using various transcription factor binding site assessment programs (AliBaba2.1, MatInspector version 2.2, Patch 2.3a) indicated possible binding of several different factors to this 56-bp region. However, to firmly establish the exact position of the binding site(s) to this fragment an ethylation interference footprinting experiment was performed (15, 17). Following recovery of the bound (B2 only) and free radiolabeled probes from EMSA, the modified DNA was cleaved with sodium hydroxide and the products subjected to sequencing gel analysis (Fig. 2B
). Comparison of B2 and free material from either strand readily revealed two distinct footprint regions lying adjacent to one another: 5' atGAGcaCCGCCCca (top strand, with the interfering nucleotide backbone positions highlighted in uppercase letters). The composite footprint clearly revealed asymmetry in the interactions over the two DNA sites and also exhibited 5' overhangs, indicative of major groove binding. The 3' half of the footprint area, 5' CCGCCC, strongly resembled an Sp1 binding site (20, 21). Collectively, the EMSA and footprint analyses indicated that some PTG nuclear factor specifically recognized an Sp1-like DNA element in the bovine PTH promoter.
Based on these results, the ability of the bovine PTG nuclear factor to recognize and bind to a consensus Sp1 DNA element was assessed. As seen in Fig. 3
, when a synthesized oligonucleotide probe corresponding to a consensus Sp1 binding site (lanes 58) was incubated with the PTG extract it produced an analogous binding pattern as that observed with the 56-bp PTH promoter fragment (lanes 14). Furthermore, in cold competition experiments, the 56-bp bovine sequence could compete for binding to the consensus Sp1 element, and likewise in the reverse experiment, the excess unlabeled Sp1 element could specifically compete for extract binding to the radiolabeled 56-bp site. Thus, these cross-competition experiments firmly established the Sp1-like nature of the binding entity present in the bovine PTG nuclear extracts.
|
|
Having established that both Sp1 and Sp3 were primarily responsible for the observed binding complexes with the bovine PTG nuclear extracts and the PTH Sp1 DNA element, cellular localization of Sp1 and Sp3 in the bPTG was determined by immunocytochemistry. Histologically, the bovine PTG is presented predominantly as islands of chief cells delimited by connective tissue capsules (Fig. 5A
). Application of antibodies to Sp1 and Sp3 indicated the presence of these factors in the bPTG (Fig. 5
, B and C). Immunostaining with PTH and VDR antibodies confirmed the histological identification of the PTG by identifying cells positive for VDR and PTH (Fig. 5
, D and E). Altogether, Sp1, Sp3, and VDR were localized to the nuclear compartment of positively labeled PTG cells, whereas PTH was localized to the cytoplasmic compartment. Absence of positive staining in negative controls indicated specific labeling in target tissues (Fig. 5F
). Infrequently, Sp1 and Sp3 positive labeling were observed in liver cells (data not shown), which is consistent with earlier reports indicating low levels of Sp1 protein in the mouse liver (22).
|
To assess whether intact Sp proteins could be specifically recovered from PTG nuclear extracts, the bovine Sp1 PTH element was then used in an affinity purification experiment. A binding reaction containing bPTG nuclear extract was divided and incubated with an excess of an ERE or a consensus Sp1 element (Sp1). Following this preincubation, a biotinylated oligonucleotide probe containing the bovine PTH Sp1 element was added and the incubation continued. After adding streptavidin agarose and allowing for capture of the biotinlyated DNA, the supernatants, containing unbound proteins, were recovered and an aliquot removed for Western blot analysis. The matrix, containing the protein-DNA complexes, was then thoroughly washed, the proteins eluted, precipitated and also subjected to Western blot analysis. The supernatant fractions following the initial recovery of the protein-DNA complexes still contained significant amounts of Sp3 immunoreactivity in the form of both the 110- and 65-kDa proteins (Fig. 6A
), suggesting that not all of the Sp3 present in the extract was capable of binding to the DNA sequence. However, material incubated with the ERE competitor DNA clearly revealed intense immunoblotting for Sp3 proteins, indicating that this nonspecific DNA did not prevent Sp3 from binding to the bovine PTH Sp1 element. In contrast, preincubation of the bPTG extract with the consensus Sp1 oligonucleotide completely abrogated binding by the Sp3 proteins to the biotinylated PTH Sp1 element. Thus, the data confirm that intact Sp3 proteins are specifically interacting with the bovine PTH Sp1 element. Analogous results were seen when the same analysis was carried out for Sp1 binding activity (Fig. 6B
).
|
2-fold) in complex formation relative to the control incubation. In contrast, control binding at 37 C was dramatically diminished, whereas treatment with phosphatase preserved strong complex formation. The dramatic decrease in binding observed in the 37 C control sample was not due to the degradation of either Sp1 or Sp3 because Western blots obtained from the same binding samples indicated that the proteins were largely intact and similar amounts were observed between the various treatments.
|
..AGCACATAACCA..) that rendered the sequence a poor competitor for specific binding by the bPTG nuclear extracts in EMSA (data not shown). A single copy of the wild-type bovine element resulted in a significant enhancement (
5-fold) of transcriptional activity (Fig. 8
|
| Discussion |
|---|
|
|
|---|
The immunocytochemical and Western blotting experiments confirmed that both Sp1 and Sp3 proteins were abundantly expressed in the PTG and of the predicted size. In particular, very robust expression of Sp3 has been consistently observed throughout multiple bovine PTG nuclear extract preparations. In contrast, the level of expression of these factors in adult bovine kidney and liver preparations were low to undetectable in EMSA and Western blots despite simultaneous processing under identical conditions. Based on murine expression and localization data, Sp1 can be highly variable in different tissues and stages of development, with kidney and liver generally expressing low amounts of mRNA and protein (22). This is consistent with our observations using nuclear extracts prepared from those same bovine tissues. Alternatively, it is also possible that Sp1 and Sp3 are being rapidly degraded by proteases in these tissues. However, Western blotting of retinoid X receptor proteins from the bovine kidney and liver nuclear extracts confirmed their presence at the expected molecular weights (data not shown). Thus, proteolysis, if it is occurring, appears not to be a general phenomenon and would suggest specific enzymes recognizing the Sp transcription factors.
These two proteins, and Sp3 in particular, constituted the major DNA-binding constituents observed with the PTH Sp1 element in EMSA. Nonetheless, other DNA-binding complexes not sensitive to the Sp protein antibodies were also capable of specifically interacting with this sequence. These include a much faster moving complex that may represent some proteolyzed version of either Sp1 or Sp3, consistent with the lower molecular weight proteins appearing in the Western blot analyses. The Sp/"X"KLF family of proteins includes numerous other members that could also bind to such a response element (31), and additional work will be required to determine the identity of these unknown DNA-binding factors.
The activity of the Sp proteins can be influenced by multiple factors, including phosphorylation, redox state, and acetylation (23, 24, 32, 33). Our finding of widespread expression of Sp1 and Sp3 proteins throughout the PTG, while important, does not address the fundamental question of whether or not, or in which cells, these proteins are present in an active state. This raises the possibility that some disconnect may exist between the presence of these factors and active synthesis or suppression of PTH mRNA transcription. In support of this possibility, the affinity binding and phosphatase experiments indicated some portion of the Sp1/Sp3 proteins was incapable of specifically binding to the PTH Sp1 element, whereas treatment with phosphatase strongly increased the DNA-binding activity. Interestingly, the control reaction for the phosphatase experiment carried out at 37 C exhibited a dramatic decrease in DNA-binding capacity that was not linked to the degradation of these proteins. This was largely prevented by phosphatase treatment and, accordingly, suggests some other type of event is occurring in the control extract under these conditions that negatively impacts Sp1/Sp3 binding. Further studies are needed to determine if this is the result of a direct effect on the Sp1/Sp3 proteins themselves or indirectly through some other factor impacting their DNA-binding ability.
The actions of Sp1 and Sp3 at a given promoter appear to be complex, but, in many cases, expression of Sp3 is thought to antagonize the stimulatory actions of Sp1 on gene transcription (34, 35, 36). In the present circumstance, such a scenario would lead to a prediction that Sp1 acts as an enhancer of PTH gene transcription, whereas Sp3 opposes those actions. Therefore, in the simplest scenario that ignores the contribution of other transcription factors, reduced expression of Sp3 would lead to a prediction of hyperparathyroidism. Sp1 knockout mice are embryonic lethal (37), apparently at a stage of development that precedes PTG development (38). On the other hand, Sp3 knockout mice survive to birth, at which time they apparently succumb to respiratory failure (39). Suske and colleagues (40) have also described bone abnormalities in the Sp3 knockout mouse, with what appears to be a defect in osteoblast function. In view of our observations, it would be extremely enlightening to determine the circulating concentrations of PTH in the Sp3 knockout mice. This could then provide a clue as to the relative importance and direction of the Sp3 protein in regulating transcription of the PTH gene.
Recently, GCMB/gcm2 has been found to be a transcription factor that is essential for proper development of the PTG (12, 13). While the relationship between GCMB/gcm2 and the PTH gene is still evolving, our findings suggest that the Sp family is likely playing an important role in transcription of the peptide hormone by interacting with a highly conserved Sp1 DNA element in the genes promoter. It will be of interest to determine the relationship between these and other transcription factors that impact synthesis of the PTH gene, and how these may play a role in the development of various disease conditions that affect production of this key regulatory hormone.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: ABC, Avidin biotin complex; BLAST, basic local alignment search tool; bPTG, bovine PTG; ERE, estrogen response element; Gcm2, glial cells missing 2; GCMB, glial cells missing b; OK, opossum kidney; PTG, parathyroid gland; SDS, sodium dodecyl sulfate; NP-40, Nonidet P-40; tk/Luc, thymidine kinase/luciferase; VDR, vitamin D receptor.
Received January 27, 2003.
Accepted for publication March 28, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Ogasawara, T. Terada, J.-i. Asaka, T. Katsura, and K.-i. Inui Human Organic Anion Transporter 3 Gene Is Regulated Constitutively and Inducibly via a cAMP-Response Element J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 317 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Boylan, L. I. Jepeal, and M. M. Wolfe Sp1/Sp3 binding is associated with cell-specific expression of the glucose-dependent insulinotropic polypeptide receptor gene Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1287 - E1295. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Alimov, O.-K. Park-Sarge, K. D. Sarge, H. H. Malluche, and N. J. Koszewski Transactivation of the Parathyroid Hormone Promoter by Specificity Proteins and the Nuclear Factor Y Complex Endocrinology, August 1, 2005; 146(8): 3409 - 3416. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Koszewski, A. P. Alimov, O.-K. Park-Sarge, and H. H. Malluche Suppression of the Human Parathyroid Hormone Promoter by Vitamin D Involves Displacement of NF-Y Binding to the Vitamin D Response Element J. Biol. Chem., October 8, 2004; 279(41): 42431 - 42437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Alimov, M. C. Langub, H. H. Malluche, O.-K. Park-Sarge, and N. J. Koszewski Contrasting Mammalian Parathyroid Hormone (PTH) Promoters: Nuclear Factor-Y Binds to a Deoxyribonucleic Acid Element Unique to the Human PTH Promoter and Acts as a Transcriptional Enhancer Endocrinology, June 1, 2004; 145(6): 2713 - 2720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Nesbit, M. R. Bowl, B. Harding, A. Ali, A. Ayala, C. Crowe, A. Dobbie, G. Hampson, I. Holdaway, M. A. Levine, et al. Characterization of GATA3 Mutations in the Hypoparathyroidism, Deafness, and Renal Dysplasia (HDR) Syndrome J. Biol. Chem., May 21, 2004; 279(21): 22624 - 22634. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||