| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Deficient Mice
Department of Pathology (K.-H.C., C.C.), University of Rochester, Rochester, New York 14642; and Departments of Pathology (Y.C., T.D., Y.A., T.K., Y.-J.Y.W.) and Medicine (Y.L.), Harbor-University of California, Los Angeles Medical Center, Torrance, California 90509
Address all correspondence and requests for reprints to: Yu-Jui Yvonne Wan, Ph.D., Department of Pathology, Harbor-University of California, Los Angeles Medical Center, 1000 West Carson Street, Torrance, California 90509. E-mail: agarose{at}ucla.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(RXR) in hepatocytes, hepatocyte RXR-deficient mice have been established. Characterization has been performed on male mice. In this paper, we show that the expression of CYP450 genes is differentially expressed in male and female hepatocyte RXR-deficient mice; male mice have reduced expression of cytochrome P450 (CYP) CYP4A, CYP3A, and CYP2B mRNAs, but females do not exhibit such phenotypes. To examine the hormonal effects on this sexual dimorphic phenotype, male and female mice were subjected to 17ß-estradiol and 5-dihydrotestosterone (DHT) treatment, respectively, and then the expression of the CYP450 genes was studied. Estradiol had no effect on protecting the hepatocyte RXR-deficient mice from reduced expression of the CYP450 genes. In contrast, DHT induced hepatocyte RXR-deficient female mice, but not wild-type female mice, to have the reduced expression of CYP450 mRNAs. In addition, castration prevented the mutant male mice from exhibiting reduced expression of CYP450 mRNAs. wild-type and mutant mouse livers from both genders express androgen receptors (ARs). By transient transfection, DHT-AR could inhibit RXR-mediated transcription. Furthermore, by transfection and coimmunoprecipitation, RXR can interact with AR in vivo. These data suggest that testosterone has a negative impact on retinoid signaling when the level of RXR is low, which may in turn reduce the expression of the CYP450 genes. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, ß, and 
) are expressed, although RXR has the highest expression level in the liver. Furthermore, liver expresses the highest level of RXR among all the organs (4). Previously, we have shown that RXR is involved in regulation of liver gene expression and hepatocyte differentiation and proliferation (5, 6). To further analyze the functional role of RXR in the liver, we have used cre-mediated recombination to disrupt the RXR gene specifically in mouse hepatocytes (7). Although such mice are viable, molecular, biochemical, and morphological parameters indicate that many metabolic pathways in the liver mediated by peroxisome proliferator-activated receptor, constitutive androstane receptor, pregnane X receptor (PXR), liver X receptor, and farnesoid X receptor are compromised in the mutant male mice (7, 8, 9, 10). Sexual differences in retinoid signaling has been identified in different experimental models. Serum retinol concentration is higher in males than females aged 20–59 yr based on analyzing data from the third National Health and Nutrition Examination Survey (11). Males are usually more sensitive to vitamin A deficiency. When rats are maintained on a vitamin A-deficient diet, male rats develop severe manifestations of hypovitaminosis A earlier than females. Male rats also presented more extensive squamous metaplasia of the trachea than females (12). In a group of 535 vitamin A-deficient cattle, blindness is only found in steers, not in heifers (13). In addition, the metabolic rate of RA was different in male vs. female. When liver microsomes of male and female rats of different strains are used to investigate the in vitro metabolism of RA, the amounts of 4-oxo metabolites derived from all-trans-RA, 13-cis-RA, and 9-cis-RA are higher in male than female liver microsomes (14). Furthermore, when pregnant rats were treated with ethanol or ethanol plus vitamin A, retinyl palmitate levels in female fetuses of the group treated with ethanol plus vitamin A were significantly higher than those of the group administered vitamin A alone, and no significant differences in the level of retinyl palmitate in male fetuses were observed between these two treated groups (15). These reports indicate that there are differences in retinol level, sensitivity to retinol deficiency, and retinoids metabolic rate between males and females.
To determine if there is any sexual dimorphic difference in receptor-mediated RA signaling, we have studied female hepatocyte RXR-deficient mice and compared the phenotype with male mice. Surprisingly, female and male mutant mice exhibit very different phenotypes in CYP450 gene expression. Male mice have reduced expression of CYP450 mRNAs, but females do not exhibit such phenotypes. However, testosterone can induce female hepatocyte RXR-deficient mice to exhibit a full mutant phenotype. Furthermore, castration prevents male mutant mice from expressing the RXR-deficient phenotype, i.e. reduced expression of the CYP450 genes. The data demonstrated a gender difference in RXR-mediated pathways and CYP450 gene expression. It also implicates a negative effect of testosterone on regulating CYP450 gene expression when retinoid signaling is low.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mutation in hepatocytes have been described elsewhere (7). The animals used in all the experiments were age-matched (3.5 months old) male and female mice. They were housed in groups of two or three in plastic microisolator cages at 22 C with a 12-h light, 12-h dark cycle and had free access to food and water. Mice were killed by anesthesia with pentobarbital (60 mg/kg, ip). The liver was removed immediately, weighed, frozen in liquid nitrogen, and processed for RNA extraction. For hormone treatment studies, a 3-wk release 17ß-estradiol (E2; 0.5 mg) and 5-dihydrotestosterone (DHT; 5 mg) pellet (Innovative Research of American, Sarasota, FL) were inserted into an sc pocket (posterior neck region) of 5-wk-old male and female mice, respectively, under anesthesia induced by ketamine/xylazine. Two weeks after implantation of the pellet, the mice were killed for studying the expression of nuclear receptor target genes in the liver. The dose used for E2 produces serum E2 levels physiologically equivalent to pregnant levels (
700–1500 ng/ml), and these data are consistent with others’ findings (Ref. 16 and data from Innovative Research of America). The dose used for DHT also produces serum DHT levels within the physiological range (6–9 ng/ml, data from Innovative Research of America). All the animal experiments were conducted in accord with the NIH Guide for the Care and Use of Laboratory Animals.
Northern blot hybridization
Liver RNA was extracted by the guanidinium isothiocyanate method (17). Twenty micrograms of total RNA per lane were resolved by electrophoresis on 1.2% agarose gels containing 2.2 M formaldehyde and then transferred to nylon membranes by capillary blotting. CYP4A1, CYP2E1 (provided by Dr. F. Gonzalez), CYP2B10 (M. Negishi, NIEHS, Research Triangle Park, NC), and CYP3A11 cDNA fragments were labeled by random priming and hybridized to membranes in 7% (wt/vol) sodium dodecyl sulfate (SDS), 0.5 M sodium phosphate (pH 6.5), 1 mM EDTA, and 1 mg/ml BSA at 68 C overnight. The membranes were washed twice in 1% SDS, 50 mM NaCl, and 1 mM EDTA at 68 C for 15 min each and autoradiographed using intensifying screens. At least five animals from each group were studied for each gene. The amount of mRNA expressed was quantitated by densitometry and then normalized with the level of ß-actin mRNA to obtain means and SDs.
Semiquantitative RT-PCR analysis
cDNA was synthesized by reverse transcription from 2.0 µg of total RNA. Mouse ß-actin, RXRß, RXR, and androgen receptor (AR) cDNAs were amplified by PCR using specific oligonucleotide primers. Sense GAGCTATGAGCTGCCTGACG (636–655) and antisense AGCACTTGCGGTCCACGATG (1045–1026) primers were used for amplification of ß-actin. Sense CAACTCCACAGTGTCGCTCC (225–244) and antisense CCGTTGACGCTCCTCCTGAA (582–563) primers were used for amplification of RXRß. Sense CGCTGCCAGTACTGTCGCTAC (603–624) and antisense TGGCATAAACCTTCTCTCGAAGAGT (1233–1208) primers were used for amplification of RXR. Sense CAGCATACCAGAATCGCGACTAC (1081–1103) and antisense TCTGGGGTGGAAAGTAATAGTCGA (1665–1641) primers were used for amplification of AR.
To ensure the amplification was within the linear range, the correlation between the intensity of PCR-amplified products and the number of PCR cycles was studied first. For RXRß, PCR conditions used were 28 cycles of 94 C for 45 sec, 64 C for 45 sec, and 72 C for 1 min. For RXR, PCR conditions were 30 cycles of 94 C for 45 sec, 62 C for 45 sec, and 72 C for 1 min. For AR, PCR conditions were 30 cycles of 94 C for 45 sec, 56 C for 45 sec, and 72 C for 1 min. All PCRs were completed with a single extension cycle of 10 min at 72 C. The products were separated by electrophoresis on 2% agarose gels, stained with ethidium bromide, and visualized by UV illumination. Intensity was determined using image analysis software (Quantity one; Bio-Rad Laboratories, Inc., Hercules, CA). The level of ß-actin mRNA was studied as an internal control. ß-Actin was amplified with 30 cycles of 94 C for 45 sec, 56 C for 45 sec, and 72 C for 1 min, followed by one cycle of 10 min at 72 C. The expression of each mRNA was normalized to ß-actin mRNA level. Statistical analysis was performed with Student’s t test, and P < 0.05 was considered statistically significant. Relative fold differences are shown and all the experiments were reproducible.
Cell culture and transfection
Cell line CV-1 was purchased from the American Type Culture Collection (Manassas, VA). Cells were cultured in MEM (Sigma, St. Louis, MO) supplemented with 10% charcoal-stripped fetal calf serum. Cells were seeded at 2 x 105 per well in six-well plates in 2 ml of complete medium. Sixteen hours after plating, cells were transfected using lipofectamine reagent (Life Technologies, Inc., Grand Island, NY) using the protocol provided by the manufacturer. Each well was transfected with 2 µg of CRBP-II-luciferase reporter plasmid (18) with or without RXR (pRS-hRXR; Ref. 19) and AR (pSG5-AR; Ref. 20) expression plasmid and 10 ng of pRL-TK (Promega Corp., Madison, WI), which expressed Renilla luciferase and served as an internal control. Then the transfected cells were treated with or without 9-cis-RA and dihydrotestosterone (DHT; Sigma) for 48 h and harvested for luciferase assay according to manufacture’s protocol (Promega Corp.).
Transfection and coimmunoprecipitation
pIRES-flag-AR was constructed by inserting flag-tagged AR cDNA into pIRESneo vector (CLONTECH Laboratories, Inc., Palo Alto, CA). pCDNA3-RXRß was from Renata Polakowska (University of Lille II, Lille, France). COS-1 cells were maintained in DMEM containing penicillin (25 U/ml), streptomycin (25 µg/ml), and 10% fetal bovine serum (FBS). Briefly, 106 cells were plated on 100-mm dishes 24 h before transfection. Then, cells were cotransfected with 10 µg of pCDNA3-RXRß and/or 10 µg of pIRES-flag-AR. Total plasmid amount was adjusted with pIRES-flag and pCDNA3 parent vector to 20 µg for each 100-mm transfection by calcium phosphate precipitation method.
Cells plated on 100-mm dishes were incubated in DMEM 10% charcoal-depleted FBS for 24 h and then treated with or without 10 nM DHT and/or 1 µM 9cRA for another 16 h. After washing with ice-cold 1x PBS, cells were solubilized in 1 ml RIPA buffer (10 mM NaHPO4/pH 7.0, 150 mM NaCl, 2 mM EDTA, 0.5% (wt/vol) Nonidet P-40, 0.1% (wt/vol) SDS, 1% (wt/vol) sodium deoxycholate, and 1 mM phenylmethylsulfonyl fluoride). Insoluble material was removed by centrifugation (16,000 x g, 10 min at 4 C). Polyclonal anti-RXRß antibodies (200 ng/ml, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added to the cell lysates and incubated for 2 h at 4 C. Immunoprecipitates were collected with protein A/G-Sepharose beads (Santa Cruz Biotechnology, Inc.), washed four times in RIPA buffer, and then analyzed by Western blotting with mouse anti-flag and anti-RXRß antibodies.
Western blot
Immunoprecipitated proteins were separated by SDS-PAGE through 10% gels, electroblotted onto polyvinylidene difluoride membrane, and Western blotted with the indicated antibodies. Blots were blocked at 4 C with Tris-buffered saline with 0.5% Tween 20 (TBST) plus 5% dry nonfat milk, and antibodies were diluted in this buffer as suggested by the manufacturers. Blots were incubated in primary antibodies for 2 h at room temperature or overnight at 4 C, washed three times in TBST. Blots were then incubated with the appropriate alkaline phosphatase-conjugated antirabbit IgG secondary antibodies (Bio-Rad Laboratories, Inc.) diluted in TBST plus 5% milk for 1 h at room temperature. Immunoblots were visualized using an alkaline phosphatase conjugate kit (Bio-Rad Laboratories, Inc.).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-deficient mice-deficient mice, the expression of nuclear receptor target genes including CYP2B, CYP3A, and CYP4A was examined by Northern blot hybridization. The CYP2B and CYP3A genes can be regulated by the constitutive androstane receptor/RXR- and PXR/RXR-mediated pathways (21). The CYP4A gene is a peroxisome proliferator-activated receptor/RXR target gene (Ref. 8 and references therein). Five to six mice per group were studied and the representative Northern results showed that the expression level of CYP2B, CYP3A, and CYP4A mRNA, but not CYP2E1, was significantly reduced in the male hepatocyte RXR-deficient mouse liver compared with the wild-type mouse liver from the same sex (Figs. 1–3
). In contrast, in female mice, the level of these CYP450 mRNAs remained unchanged in the hepatocyte RXR-deficient mouse liver compared with the wild-type mouse liver.
|
|
|
-deficient mice, but not in female wild-type mice-deficient mice, male and female mice were subjected to E2 and DHT treatments, respectively. E2 induced the expression of CYP2B mRNA in the wild-type male mouse liver but CYP2B mRNA remained undetectable after E2 treatment of hepatocyte RXR-deficient mice (Fig. 1
). In contrast, DHT had no effect on regulating CYP2B mRNA in wild-type female mice but had an inhibitory effect on CYP2B mRNA in female hepatocyte RXR-deficient mice. After DHT treatment, CYP2B mRNA became undetectable in female hepatocyte RXR-deficient mice, which was similar to the phenotypic result in male hepatocyte RXR-deficient mice (Fig. 1). Neither RXR deficiency nor hormone treatment altered the expression of the CYP2E1 gene, which is not known, can be regulated by nuclear receptors that dimerize with RXR (Fig. 1).
In male mice, E2 had no effect on the CYP3A gene in wild-type and hepatocyte RXR-deficient mice (Fig. 2). Also, in female mice, DHT did not regulate the expression of CYP3A mRNA in wild-type mice. However, DHT had an inhibitory effect on the expression of CYP3A mRNA in female hepatocyte RXR-deficient mice (2-fold reduction, P < 0.05; Fig. 2). After DHT treatment, the level of CYP3A mRNA in female hepatocyte RXR-deficient mice was similar to that in untreated male hepatocyte RXR-deficient mice (Fig. 2).
The expression of CYP4A mRNA in wild-type male mice was not changed after E2 treatment (Fig. 3). E2 weakly reduced the level of CYP4A mRNA in the liver of hepatocyte RXR-deficient male mice (Fig. 3). DHT also had a very weak effect on reducing the level of CYP4A mRNA in female wild-type mice (Fig. 3). However, DHT had a dramatic effect on inhibiting the expression of the CYP4A gene in hepatocyte RXR-deficient female mice (20-fold reduction; Fig. 3). The size of CYP4A transcript altered and the major transcript became undetectable when RXR was deficient in the male mice and when the mutant female mice were treated with DHT. The possibility of alternative splicing or usage of a different promoter of the CYP4A gene remains to be investigated. Similar to CYP2B and CYP3A mRNA, the level of CYP4A mRNA in the liver was similar in DHT-treated female and untreated male hepatocyte RXR-deficient mice. Therefore, our data indicated that E2 could not prevent the male mutant mice from having the RXR-deficient phenotype, whereas DHT helped the female hepatocyte RXR-deficient mice exhibit the male mutant phenotype.
Castration prevents male hepatocyte RXR-deficient mice from exhibiting the mutant phenotype
To further analyze the effect of male hormones on the phenotype of hepatocyte RXR-deficient mice, castration was performed in 6-wk-old wild-type and mutant male mice. Two weeks after castration, mice were killed. The expression of CYP2B, CYP3A, and CYP4A mRNA was examined in castrated and age-matched mice. Figure 4 demonstrates that castration had weak effect on the expression of the CYP2B, CYP3A, and CYP4A genes. In contrast, castration had a dramatic effect on the expression of the CYP2B, CYP3A, and CYP4A genes in RXR-deficient mice. The levels of these three mRNAs increased 8- to 20-fold after castration of hepatocyte RXR-deficient mice, and the levels of expression became similar to those of female hepatocyte RXR-deficient mice. Furthermore, treatment of castrated hepatocyte RXR-deficient mice with DHT restored the mutant phenotype; the expression of the CYP2B, CYP3A, and CYP4A was reduced (Fig. 4).
|
deficiency nor hormone treatment alters the expression of RXRß and mRNA in the liver may be higher in female than in male mouse livers. We have performed quantitative RT-PCR and found no significant difference in terms of the amount of RXRß and mRNAs expressed in males and females (Fig. 5, A and B). In addition, E2 or DHT treatment of male and female mice, respectively, did not change the levels of RXR ß and mRNAs expressed in the livers.
|
-deficient male and female mice-deficient phenotype in female mice and castration can prevent the demonstration of the mutant phenotype in male mice. To explore this possibility, the expression of AR was studied in both male and female mouse livers. Figure 6 demonstrates that the livers of wild-type and mutant mice of both genders expressed AR mRNA and that the level of AR mRNA was not affected by RXR deficiency. These data suggest that DHT mediated through AR in the liver may have a direct effect on regulating RXR-mediated pathways.
|
-mediated transcription homodimer recognition site (18). CV-1 cells were used because they contain very low levels of nuclear receptors and give very low background levels for transient transfection assays. The CRBPII-luciferase activity increased about 25-fold after 9-cis-RA treatment (Fig. 7A). In the presence of AR, DHT had a weak effect on CRBPII (2-fold induction). However, DHT significantly reduced RA-induced luciferase activity. The inhibitory effect was dependent on the amount of AR present. When the ratio of RXR and AR was 1:10, the luciferase activity was close to the basal activity. In the absence of AR, DHT had no inhibitory effect (Fig. 7B). The inhibitory effect was also dependent on the amount of DHT. At 10-8 M, DHT was able to reduce the RA-induced luciferase activity by half suggesting the effect might be physiologically relevant (Fig. 7A). Furthermore, the inhibitory effect of DHT became stronger when the amount of RXR expression plasmid included in the transfection was reduced. These data further support the in vivo finding that the effect of DHT is apparent only when retinoid signaling is low (Fig. 7B).
|
, AR was detected in the anti-RXRß antibody-precipitated complex from COS-1 cells cotransfected with the AR and the RXRß, but not in the complex from cells transfected only with the AR or the RXRß. This result demonstrated that the RXR could interact with the AR in vivo.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
deficiency. The expression of several nuclear receptor target genes including CYP2B, CYP3A, and CYP4A is retained in the liver when RXR was deficient. This difference in CYP450 gene expression was not due to differential expression of the RXRß and genes in male and female mice, because neither gender nor RXR deficiency affected the expression of the RXR ß and genes.
The other obvious factor that might explain the sexual dimorphic phenotype is a hormonal effect. Using hormone treatment, we have shown that E2 was not able to reverse the phenotype of male hepatocyte RXR-deficient mice, i.e. down-regulation of CYP2B, CYP3A, and CYP4A mRNA in the liver. In contrast, DHT could help female mutant mice to present the mutant phenotype. The effect of DHT was specific for hepatocyte RXR-deficient mice only because DHT had no significant effect on regulating the CYP2B, CYP3A, and CYP4A genes in wild-type mice. These data clearly indicated that male hormones might have an antagonizing effect on RXR-mediated pathways. In our model, only the RXR gene has been knocked out, and only in the hepatocytes. The presence of RXRß and in the liver and of RXR in other types of liver cells can still mediate the effect of RXR within the liver. This might explain why the female hepatocyte RXR-deficient mice do not have an apparent change in CYP450 gene expression. In male mutant mice, the remaining effects of RXRß and might be inhibited by male hormones because the liver does express AR and because AR and RXR can interact with each other in vivo. Therefore, the phenotype was apparent. This notion was further demonstrated by castration experiments. Castration reversed the phenotype of male RXR-deficient mice, but the effect of castration on wild-type mice was not so dramatic. Furthermore, treating castrated hepatocyte RXR-deficient mice with DHT restored the phenotype of hepatocyte RXR-deficient mice. The level of CYP2B, CYP3A, and CYP4A mRNA expressed in the liver was very similar in castrated hepatocyte RXR-deficient male and nonoperated female hepatocyte RXR-deficient mice. These findings strongly indicate that male hormones can play a negative role in the RXR-mediated pathway particularly when the RXR or RA level is low or when the male hormone or AR level is high. This observation may also explain why males are more sensitive to vitamin A deficiency. It is interesting that the effect of DHT is only observed in the context of low retinoid signaling. Because RXR is a very promiscuous receptor capable of heterodimerizing with a wide range of receptor partners, it is possible that there may be a competition for limiting amounts of coregulators in wild-type mice, thus making AR signaling less effective in wild-type than in hepatocyte RXR-deficient mice. It is also possible that the heightened retinoid signaling and high CYP450 activity in wild-type mice contribute to metabolism and inactivation of DHT and therefore the effect of DHT is not apparent in the wild-type mice.
RXRs play an important role in regulation of CYP450 gene expression (for reviews see Refs. 1, 2, 3). It appears that CYP450-dependent metabolism can produce virtually an unlimited number of ligands (both endogenous hormones and exogenous chemicals) for the nuclear receptors, and nuclear receptors can regulate CYP450 genes. Under normal conditions, sexual dimorphism in the expression of many rodent hepatic genes, including the CYP450 genes (22), is primarily mediated via the gender-specific profile of pituitary GH secretion. It would be interesting to determine if there is any interaction between retinoid-mediated signaling and the GH regulatory pathway.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: AR, Androgen receptor; CYP, cytochrome P450; E2, 17ß-estradiol; FBS, fetal bovine serum; DHT, 5-dihydrotestosterone; PXR, pregnane X receptor; RA, retinoic acid; RXR, retinoid X receptor ; SDS, sodium dodecyl sulfate; TBST, Tris-buffered saline with 0.5% Tween 20.
Received December 11, 2002.
Accepted for publication February 4, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-fetoprotein gene. J Mol Endocrinol 14:101–108 as a heterodimeric integrator of multiple physiological processes in the liver. Mol Cell Biol 20:4436–4444-mediated pathways are altered in hepatocyte-specific retinoid x receptor -deficient mice. J Biol Chem 275:28285–28290 in xenobiotic-sensing nuclear receptor-mediated pathways. Eur J Pharm Sci 15:89–96[CrossRef][Medline]
-deficient mice have reduced food intake, increased body weight, and improved glucose tolerance. Endocrinology 144:605–611This article has been cited by other articles:
 |
|
 |
|
  L. Shi, S. Ko, S. Kim, I. Echchgadda, T.-S. Oh, C. S. Song, and B. Chatterjee Loss of Androgen Receptor in Aging and Oxidative Stress through Myb Protooncoprotein-regulated Reciprocal Chromatin Dynamics of p53 and Poly(ADP-ribose) Polymerase PARP-1 J. Biol. Chem., December 26, 2008; 283(52): 36474 - 36485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Theve, Y. Feng, K. Taghizadeh, K. S. Cormier, D. R. Bell, J. G. Fox, and A. B. Rogers Sex Hormone Influence on Hepatitis in Young Male A/JCr Mice Infected with Helicobacter hepaticus Infect. Immun., September 1, 2008; 76(9): 4071 - 4078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. S. Gorman, L. Coward, C. Kerstner-Wood, L. Cork, I. M. Kapetanovic, W. J. Brouillette, and D. D. Muccio In Vitro Metabolic Characterization, Phenotyping, and Kinetic Studies of 9cUAB30, a Retinoid X Receptor-Specific Retinoid Drug Metab. Dispos., July 1, 2007; 35(7): 1157 - 1164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Auerbach, J. G. DeKeyser, M. A. Stoner, and C. J. Omiecinski CAR2 Displays Unique Ligand Binding and RXR{alpha} Heterodimerization Characteristics Drug Metab. Dispos., March 1, 2007; 35(3): 428 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Gyamfi, M. G. Kocsis, L. He, G. Dai, A. J. Mendy, and Y.-J. Y. Wan The Role of Retinoid X Receptor {alpha} in Regulating Alcohol Metabolism J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 360 - 368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-H. Chuang, Y.-F. Lee, W.-J. Lin, C.-Y. Chu, S. Altuwaijri, Y.-J. Y. Wan, and C. Chang 9-cis-Retinoic Acid Inhibits Androgen Receptor Activity through Activation of Retinoid X Receptor Mol. Endocrinol., May 1, 2005; 19(5): 1200 - 1212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-Y. Liu, J. J. Schultz, and G. A. Brent A Thyroid Hormone Receptor {alpha} Gene Mutation (P398H) Is Associated with Visceral Adiposity and Impaired Catecholamine-stimulated Lipolysis in Mice J. Biol. Chem., October 3, 2003; 278(40): 38913 - 38920. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
