help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0651
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/12/5459    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baudet, M.-L.
Right arrow Articles by Harvey, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baudet, M.-L.
Right arrow Articles by Harvey, S.
Endocrinology Vol. 144, No. 12 5459-5468
Copyright © 2003 by The Endocrine Society

Retinal Growth Hormone in the Chick Embryo

Marie-Laure Baudet, Esmond J. Sanders and Steve Harvey

Department of Physiology, University of Alberta, Edmonton, Alberta, Canada T6G 2H7

Address all correspondence and requests for reprints to: Steve Harvey, Ph.D., Department of Physiology, 7-41 Medical Sciences Building, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, Canada T6G 2H7. E-mail: steve.harvey{at}ualberta.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
The presence of GH and GH mRNA in the eyes of embryonic chicks is controversial and has, therefore, been further examined. In this study, GH cDNAs identical in size and sequence to the full-length pituitary transcript were generated by RT-PCR from mRNA extracted from the neural retinas of embryonic day (ED) 7 chick embryo eyes. GH immunoreactivity in the neural retina of embryos was primarily associated with proteins of 15 and 16 kDa, whereas only trace amounts of monomer (22–25 kDa) GH, the most abundant form in the pituitary gland, were present. GH immunoreactivity was also present in the vitreous humor, although this was associated only with the 15-kDa protein. After hatch, retinal proteins with GH immunoreactivity of 15 and 16 kDa were present neonatally but not after 42 d of age. The GH immunoreactivity in the neural retina of ED8 embryos was widespread, although GH staining was particularly abundant in retinal ganglion cells (RGCs). Full-length GH mRNA was similarly located, by in situ hybridization, throughout the neural retina and concentrated in cells in the RGC layer. The neural retina is also a site of GH action because 10-6 M chicken GH greatly increased (4- to 5-fold) the content of IGF-1 mRNA in 48-h cultured ED8 neural retinas. These results demonstrate the presence of full-length GH mRNA in the neural retina of chick embryos, in which GH immunoreactivity is primarily associated with RGCs and submonomer GH proteins of 15–16 kDa. These results also demonstrate GH action in the neural retina of embryos and suggest hitherto unsuspected roles for GH in retinal development and/or ocular function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
IT IS NOW WELL established that GH immunoreactivity is present in the brain, spinal cord, and some peripheral nerves (1, 2). In recent studies, widespread GH immunoreactivity was also seen in the neural retina of embryonic chicks (3). Because exogenous GH has been shown to stimulate retinal development in the teleost eye by inducing retinal IGF-1 synthesis (4), retinal GH may have roles in the development of the eye or ocular function.

In the chick embryo, the GH immunoreactivity found in the neural retina (3) was detected by three different antibodies raised against chicken GH and was lost after the preabsorption of the antibodies with excess recombinant GH. Shortly afterward, Takeuchi et al. (5) identified a novel GH mRNA transcript in the eye of embryonic chicks that coded for a truncated (16.5 kDa) protein. These authors found GH immunoreactivity, cross-reacting with antibodies against monomer (approximately 22 kDa) rat GH, in the retinal pigmented epithelial (RPE) cells but not in the neural retina. The GH immunoreactivity in the RPE was, however, associated with a large protein with a molecular mass of 80–86 kDa, even when examined under reducing conditions. The novel GH mRNA transcript identified by Takeuchi et al. (5) was, furthermore, not present in the RPE, neural retina, sclera, lens, vitreous body, iris, ciliary body, cornea, or rectus muscle. Takeuchi et al. (5) were also unable to find expression of the full-length GH mRNA in the eye, as found in the pituitary gland. These paradoxical findings by Takeuchi et al. (5) are difficult to reconcile and conflict with our original observations on the presence of retinal GH immunoreactivity (3). The expression and cellular localization of GH in retinal tissues has, therefore, been further assessed in the present study.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
Animals and tissues
Fertile White Leghorn eggs from the University of Alberta Poultry Unit (Shaver White strain) were incubated at 37.5 C in humidified air (3). The eggs were rotated one-quarter of a revolution each day during incubation. The eyes from decapitated embryos were collected in PBS (pH 7.4) and, in some cases, the neural retina was dissected out. Embryos at embryonic day (ED)7–8 were used because we have previously found GH immunoreactivity in the eyes of ED7 and ED8 embryos (3) before the ontogenetic differentiation of pituitary somatotrophs (at approximately ED12) (6).

Retinal GH mRNA
RT-PCR.
The presence of GH mRNA was assessed using RT-PCR. Total RNA was extracted from the eyes or neural retinas of ED7 embryos using Trizol reagent (Invitrogen, Carlsbad, CA) and any contaminating genomic DNA removed by DNase1 treatment (Ambion RNA Diagnostics, Austin, TX). DNA-free total RNA was then reverse transcribed using 15 U Thermoscript (Invitrogen) in the presence of 2.5 µM Oligo(dT)20, deoxynucleotide triphosphate mix (1 mM), cDNA synthesis buffer (1x) dithiothreitol (5 mM), and 40 U Rnase OUT (Invitrogen). The mixture was denatured (5 min at 65 C) and then incubated at 59 C for 1 h. The reaction was then terminated by a 5-min incubation at 85 C, and the template RNA was removed from the newly synthesized cDNA by Rnase H digestion (Invitrogen; 20 min at 37 C). For comparative purposes, reverse-transcribed RNA from slaughterhouse (42 d old; Hubbard/Ross strain) chicken pituitary glands was used as a positive control.

Tissue RNA, not reverse transcribed (in the absence of Thermoscript), served as a negative control. Aliquots (1.0 µl) of the cDNAs were then amplified in the presence of oligonucleotide primers (DNA Core Facility, University of Alberta) for the chicken pituitary GH cDNA (7). Oligonucleotide primers PE4F (sense) (5) and PE5R (antisense) (5) were used to amplify a 360-bp fragment derived from most of exons 4 and 5 (Fig. 1Go). Primers CLR1 (sense) (8, 9) and CLR2 (antisense) (8, 9) were used to generate a 690-bp full-length chicken GH cDNA (Fig. 1Go). The primers (10 pmol each) were in the presence of excess deoxynucleotides (1.25 mM of each), 10x PCR buffer, 2.5 mM MgCl2, and Thermus aquaticus DNA polymerase PCR beads (PURE Taq Ready-To-Go PCR Beads, Amersham, Buckinghamshire, UK). The reaction mixtures were then denatured at 94 C (5 min) and subjected to 35 cycles of denaturation (94 C for 30 sec), annealing (55 C for 30 sec), and extension (72 C for 30 sec), with a final extension of 3 min at 72 C, in a thermal cycler (Tech Gene, Fisher Scientific, Edmonton, Alberta, Canada). The amplified cDNAs were then electrophoresed in ethidium bromide-stained agarose gels (1.2% wt/vol) and viewed under UV light, in comparison with DNA molecular weight markers.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. Oligonucleotide primers of the chicken pituitary GH gene (7 ), designed to generate cDNA fragments of 360 bp (A), from exons 4 and 5 (primers PE4F and PE5R) (Takeuchi et al., Ref. 5 ) and (B) 690 bp (primers CLR1 and CLR2, from exons 1–5) (Render et al., Ref. 8 ).

 
Cloning.
Total RNA from ED7 neural retina was reverse transcribed and cDNA obtained. PCR was then performed as above with oligonucleotide primers CLR1 and CLR2 using platinum high-fidelity Taq DNA polymerase (Invitrogen) because it has proofreading activity. The 690-bp PCR product was then inserted into the pCR II-TOPO vector (Invitrogen), which was then transformed into chemically competent Escherichia coli (Invitrogen) and the cells allowed to grow overnight at 37 C. The vectors were then collected using a HiSpeed Plasmid MidiKit (Qiagen, Mississauga, Ontario, Canada) and the insert obtained by EcoRI endonuclease digestion and visualized on ethidium bromide-stained agarose gels. The sequence of the insert was determined by the University of Alberta DNA Core Facility.

In situ hybridization
Probe synthesis.
The 690-bp full-length pituitary GH cDNA obtained by PCR using the primers CLR1 and CLR2 was subcloned into the pCR II-TOPO vector (Invitrogen), as before. The vector was then linearized with restriction endonucleases HindIII and NotI for the subsequent production of antisense and sense probes, respectively. Digoxigenin (DIG)-labeled antisense and sense riboprobes were synthesized by in vitro transcription with T7 and SP6 RNA polymerase, respectively, and DIG RNA labeling mix (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Probe concentration was determined by dot blot analysis against a DIG-labeled RNA standard.

Hybridization procedure.
ED7 chick embryo heads were fixed overnight at 4 C in 4% paraformaldehyde in PBS, dehydrated, and embedded in paraffin. Tissue sections were obtained, deparaffinized in Citrisol (Decon Laboratories, Bryn Mawr, PA), rehydrated through a graded ethanol series, and washed in diethylpyrocarbonate (DEPC)-treated water and then in DEPC-PBS. The sections were then incubated in fresh 0.1% DEPC-PBS (2 x 15 min) to remove RNase, treated with proteinase K (10 µg/ml, 10 min, 37 C), postfixed in 4% paraformaldehyde (10 min), and incubated in 0.1 M triethanolamine (pH 8.0) for 10 min. The sections were then prehydridized with 50% formamide/2x saline sodium citrate (SSC) (30 min, 60 C) and hybridized in a moist chamber (overnight, 60 C) with hybridization solution (50% formamide, 2x SSC, 250 µg/ml tRNA, 50 µg/ml heparin, 2% blocking solution, and sense or antisense DIG-labeled riboprobes at concentrations of 2 µg/ml that had previously been denatured (5 min, 80 C). The sections were sequentially washed in 2x SSC (10 min), 2x SSC/50% formamide (45 min, 45 C), 2x SSC (3 x 15 min), 2x SSC (30 min, 37 C), 0.1x SSC (60 min, 60 C). The sections were then washed (2 x 5 min) in buffer one (0.01 M Tris, 0.15 M NaCl, pH 7.5), and immunohistochemical detection of the hybridized probe was achieved by incubation (2 h) with an anti-DIG antibody conjugated to alkaline phosphatase (Roche Diagnostics) in 1% blocking solution (Roche Diagnostics). The sections were then washed in buffer one (2 x 15 min), equilibrated (5 min) in buffer two (0.1 M Tris, 0.1 M NaCl, 0.05 M MgCl2, pH 9.5), and incubated in buffer two containing a commercial substrate for alkaline phosphatase [5-bromo-4-chloro-3-indolyl-phosphate and nitroblue tetrazolium chloride; Roche Diagnostics] until color developed. The color development was stopped by washing in Tris-EDTA buffer (2 x 5 min). The sections were then rinsed in PBS (3 x 5 min) and mounted with an aqueous medium. Tissue sections from the pituitary glands of slaughterhouse (42 d) chickens were similarly treated, although at probe concentrations of 200 ng/ml, and the labeling of somatotrophs in the caudal lobe (Fig. 2Go) provided a positive control (10, 11) for comparison.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. In situ hybridization of GH mRNA in the pituitary glands of slaughterhouse (42-d-old) chickens. A, Hybridization with a 690-bp DIG-labeled HindIII antisense probe for GH mRNA, showing cytoplasmic staining in individual somatotrophs. Magnification, x400. B, Hybridization with the antisense probe, showing specific staining in the caudal (Ca) lobe of the anterior pituitary gland. Magnification, x40. C, The caudal (Ca) and cephalic (Ce) lobes of the anterior pituitary gland are not labeled in the presence of the Not1 sense probe. Magnification, x40.

 

    Retinal GH immunoreactivity
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
Western blotting.
Tissues were collected into a protease inhibitor solution [HEPES, MgCl2, EDTA, EGTA, aprotinin, leupeptin, and pepstatin in 1% (wt/vol) phenylmethylsulfonyl fluoride] and homogenized using a Polytron homogenizer (Brinkmann Instruments, Westbury, NY). After centrifugation and protein determination, by the Bradford dye-binding procedure (Bio-Rad Laboratories, Mississauga, Ontario, Canada), the supernatants were stored at -20 C before Western analysis. Samples (containing 20–50 µg protein) were analyzed by one-dimensional SDS-PAGE (8, 9). The samples were added to loading buffer (10% (wt/vol) glycerol, 5% (wt/vol) 2-ß-mercaptoethanol, 2% sodium dodecyl sulfate, 0.001% (wt/vol bromophenol blue, pH 6.8), and 10% (wt/vol) dithiothreitol and denatured at 100 C for 4 min and the proteins separated by electrophoresis in 15% gels. After electrophoresis, the proteins were equilibrated in transfer buffer (25 mM Tris, 192 mM glycine, 20% (wt/vol) methanol) and transferred electrophoretically (100 V for 1 h at 4 C) to nitrocellulose paper (Bio-Rad Laboratories). After transfer, nonspecific binding sites were blocked with 5% (wt/vol) nonfat dry milk in Tris-buffered saline (25 nM Tris HCl, 0.5 M NaCl, pH 7.6) containing Tween 20 for 1 h at room temperature. GH immunoreactivity was detected using a polyclonal antibody raised in rabbits against chicken pituitary ({alpha}-cGH-1) (13), diluted 1:3000 in Tris-buffered saline/5% (wt/vol) nonfat dry milk. After an overnight incubation at room temperature, the membranes were washed with Tris-buffered saline containing Tween 20 (3 x 10 min) and then incubated for 1 h at room temperature with a biotinylated goat antirabbit IgG (Vector Laboratories, Burlingame, CA; 1:500). Antibody binding was then visualized using ABC reagents (Vector Laboratories) 1 h at room temperature, and after washing, the blots were developed with an enhanced chemiluminescence detection system (ECL kit, Amersham) and exposed to X-AR film (Kodak, Rochester, NY).

ELISA.
The presence of GH immunoreactivity in retinal tissue extracts (n = 3) was investigated using an indirect ELISA, similar to that described by Martinez-Coria et al. (12). Briefly, 96-well microtiter plates (Immulon 2HB, MTY Labs, Inc., Vienna, VA) were coated overnight at 4 C with 12 ng recombinant chicken GH (Amgen, Thousand Oaks, CA) in 100 µl 1 M carbonate buffer (pH 10.3). Tissue extracts or serial dilutions of recombinant chicken GH (5.0–5120 ng/ml) in TPBS [0.01 M sodium phosphate, 0.15 mM NaCl, 0.05% (wt/vol) Tween 20, 1% (wt/vol) nonfat dry milk] were then incubated for 16 h with 100 µl primary antibody (at a final concentration of 1:50,000) raised in rabbits against native pituitary GH ({alpha}-cGH-1) (13). This antibody is specific for GH and has no cross-reactivity with any other chicken pituitary hormones (13). The samples and standards (100 µl) were then added to the coated wells and incubated for a further 2 h at room temperature. Horseradish peroxidase conjugated to antirabbit IgG (Bio-Rad Laboratories) was then added [at a dilution of 1:3000 in 5% (wt/vol) nonfat dry milk, in 0.01 M TPBS, pH 7.0] and incubated for 2 h at room temperature. Bound secondary antibodies were then developed by reaction with 2,2'-amino-di-[3-ethylbenzothiazoline sulfonate] substrate (Roche, Mannheim, Germany). The plates were read 1 h later in an automatic ELISA microplate reader (Bio-Rad Laboratories) at a wavelength of 405 nm. The assay had a sensitivity of 2 ng/well (20 ng/ml) and interassay and intraassay coefficients of variation less than 4%.

Immunocytochemistry.
Tissues were fixed in freshly prepared paraformaldehyde (4% wt/vol; Sigma, Mississauga, Ontario, Canada) overnight at 4 C. They were then dehydrated in a graded series of ethanol (50% 15–30 min; 70% 30–60 min; 95% 30–120 min) and cleared with Hemo-De (Fisher Scientific) for 30 min. Tissues were the infiltrated with paraffin wax for 24–48 h at 60 C under normal atmospheric pressure. Serial transverse (4–8 µM) sections were taken using a microtome and mounted onto charged slides (Fisher Scientific). Confocal immunocytochemical staining was performed with a specific polyclonal antibody raised in rabbits against native chicken GH ({alpha}-cGH-1) (13) and diluted 1:500 in 4% BSA for 1.5 h at room temperature. After incubation, the slides were washed three times for 10 min in 4% BSA in PBS. Sections were then incubated for 1 h at room temperature in goat antirabbit IgG conjugated to fluorescein isothiocyanate at a dilution of 1:100. Retinal ganglion cells (RGCs) were identified using the antiislet 1 mouse monoclonal antibody, 39.4D5 (14, 15) obtained from the Developmental Studies Hybridoma Bank at the University of Iowa. Sections were labeled with undiluted 39.4D5 antibody overnight at 4 C and then incubated with a goat antimouse IgG conjugated to AlexaFluor (Molecular Probes Inc., Eugene, OR), at a dilution of 1:200 for 1.5. h at room temperature. The blocking agent was 4% BSA and sections were washed three times for 10 min each, with BSA in PBS between each step. The labeled sections were examined using a LSM5410 confocal microscope (Carl Zeiss, Göttingen, Germany) equipped with appropriate lasers. Controls, in which the antibodies were replaced by nonimmune serum, were negative.


    Retinal GH action: GH-induced IGF-1 expression
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
A role for GH in retinal development has been suggested by its stimulation of IGF-1 synthesis in the teleost eye (4). The possibility that GH may similarly act in the neural retina of early chick embryos was therefore investigated.

Neural retinas were dissected from the eyes of individual ED8 embryos into Tyrode’s saline and explanted into culture dishes coated with type I collagen, with the neural retina in contact with the substratum. The collagen (Vitrogen 1007; Cohesion Corp., Palo Alto, CA) was prepared by mixing it in the ratio 8 parts collagen:1 part medium 199 (Life Technologies, Inc., Gaithersburg, MD), 10 times concentrated:1 part 0.1 M sodium hydroxide, and allowing it to gel in the dishes at 37 C for 1 h. Pieces of retina were placed on the collagen, spread out, and allowed to adhere at 37 C for 3 h. Medium 199, plus antibiotics and 10% fetal bovine serum were then added, containing 10-6 M chicken GH (Dr. A. Parlow, National Institute of Diabetes and Digestive and Kidney Diseases’ National Hormone and Pituitary Program, Torrance, CA). This dose was used because the maximal production of IGF-1 by chicken hepatocytes requires in vitro GH concentrations of approximately 1–10 µg/ml (16). Control samples were cultured in the absence of GH.

After 48 h, total RNA was extracted from the cultured retinal tissues using Trizol reagent (Invitrogen). Before cDNA synthesis, the total RNA was treated with DNase-1 (amplification grade, Invitrogen) to eliminate contamination with genomic DNA. cDNA was synthesized from 1 µg total RNA using Superscript II RNase H-reverse transcriptase (Invitrogen) with a mixture of oligo(dT)12–18 and random primers (Invitrogen). cDNA was then amplified in a thermal cycler in the presence of oligonucleotide primers (IGF-1–1; forward primer: TTCTTCTACCTGGCCTGTG; IGF-1–2 reverse primer: CATACCCTGTAGGCTTACTG) designed to generate a 147-bp fragment of the chicken IGF-1 cDNA sequence (M33791, Gene Bank) (17). The PCR involved an initial denaturation for 10 min at 95 C, followed by 38 cycles of PCR amplification with denaturation for 30 sec at 95 C, annealing for 30 sec at 55 C, and extension for 30 sec at 72 C. After PCR, the reaction products were visualized on ethidium-bromide agarose gels. mRNA that had not been reverse transcribed served as a negative control. The same PCR conditions were used for real-time PCR to quantify IGF-1 mRNA, using an iCycler thermal cycler attached to a iCycler IQ real-time PCR detection system (Bio-Rad Laboratories) with 96-well 0.2 ml thin-walled PCR plates (Bio-Rad Laboratories). PCR components were made from SYBR Green PCR Cone reagents (PE Applied Biosystems, Foster City, CA) and Ampli Taq Gold DNA polymerase (PE Applied Biosystems) according to the manufacturer’s protocol. A standard curve was constructed from cDNA synthesized from different amounts of DNase 1-treated total RNA (50–5000 ng). For an internal control, real-time RT-PCR was also performed using a primer set (18S-1: TTCGTATTGTGCCGCTAGAG, and 18S-2: GCATCGTTATGGTCGGAAC) designed to generate a 154-bp fragment of chicken 18S rRNA (Gene Bank accession no. AF173612) (18). The PCR involved an initial denaturation of 10 min at 95 C, followed by 20 cycles of PCR amplification with denaturation for 3 sec at 95 C, annealing for 30 sec at 53 C, and extension for 30 sec at 72 C. All the primers were synthesized by the University of Alberta DNA Core Facility. The concentrations of IGF-1 mRNA and 18S rRNA in each sample were determined by the iCycler IQ real-time PCR detection system, and the concentrations of IGF-1 mRNA were then normalized relative to the 18S rRNA concentrations. Statistical differences in the data were determined by Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
Retinal GH mRNA
RT-PCR.
As expected (5), a 360-bp cDNA was generated from reverse-transcribed mRNA from the whole eyes of ED7 embryos, with oligonucleotide primers PE4F and PE5R (Fig. 3Go). This cDNA moiety was also generated, more strongly, with reverse-transcribed mRNA from the neural retina of ED7 embryos (Fig. 3Go). This moiety was not present in the mRNA controls (Fig. 3Go).



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 3. RT-PCR of mRNA extracted from the eyes and neural retinas (NR) of chick embryos (pooled tissues from at least six embryos) at ED7 in the presence of oligonucleotide primers PE4F and PE5R. RT-PCR of mRNA from the pituitary glands of slaughterhouse (42-d-old) chickens acted as a positive control. PCRs with mRNA that was not reverse transcribed with superscript (-ve) served as negative controls. Faint primer-dimer bands are visible at the bottom of the gel. The data are representative of at least three RT-PCRs using separate tissue pools.

 
Using the oligonucleotide primers CLR1 and CLR2, designed to amplify the full-length transcript of the pituitary GH cDNA, a 690-bp cDNA was generated with reverse-transcribed mRNA from the neural retinas of ED7 embryos, identical in size to that generated from pituitary mRNA (Fig. 4Go). This cDNA was not generated in the negative controls (Fig. 4Go). After cloning, the nucleotide sequence of this cDNA was 99.9% homologous (689/690 bases) to the published sequence for chicken pituitary GH cDNA (7) (Fig. 5Go). The only difference was a base substitution at position 588 (623 of the cDNA fragment) (an A for G substitution). This substitution would not change the amino acid (lysine) sequence of the predicted protein, which was 100% identical with chicken pituitary GH (7). In comparison with the sequence reported by Tanaka et al. (7), the pituitary GH cDNA reported by Lamb et al. (19) differs by base pair substitutions at positions 156 (T for C), 165 (C for T), and 302 (C for T). The pituitary GH cDNA reported by Baum et al. (20) differs by base pair substitutions at positions 336 (G for C), 465 (A for C), 466 (T for A), 467 (C for G), 468 (A for C), and 504 (T for C). The pituitary GH cDNA reported by Zhvirblis et al. (21) differs by base pair substitutions at position 336 (G for C) and 339 (T for C). None of these substitutions was present in retinal GH cDNAs sequenced from six separate clones.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 4. RT-PCR of reverse-transcribed mRNA extracted from the neural retina (NR) of chick embryos (pooled tissues from at least six embryos) at ED7, in comparison with mRNA from the pituitary glands of slaughterhouse (42-d-old) chickens, using oligonucleotide primers CLR1 and CLR2 (8 ). Reactions with mRNA in the absence of reverse transcriptase (superscript) served as negative controls (-ve). Representative data are from at least three RT-PCRs.

 


View larger version (38K):
[in this window]
[in a new window]
 
FIG. 5. Nucleotide and amino acid sequence of retinal GH cDNA (RetGH), in comparison with pituitary GH cDNA (Pit-GH) (Tanaka et al., Ref. 7 ). The initiation site is the ATG codon for methionine. The 5' flanking untranslated region is indicated as -36 to -1. The first 25 amino acids are the signal sequence for the 216-amino-acid prohormone. The base pair substitution is indicated in the boxed codon. The GenBank accession no. for retinal GH mRNA is AY373631. The GenBank accession no. for neural retina GH is AAQ81586.

 
In situ hybridization.
Hybridization of the full-length GH antisense probe was widespread in the neural retina, but it was particularly intense in large cells in the RGC layer (Fig. 6AGo), in which the staining was cytoplasmic. In contrast with the rest of the neural retina, the optic fiber layer, consisting of RGC fiber tracts, was not labeled with the GH antisense probe (Fig. 6AGo). The absence of staining in the neural retina exposed to the sense probe (Fig. 6BGo) clearly shows the specificity of the antisense hybridization in this tissue.



View larger version (97K):
[in this window]
[in a new window]
 
FIG. 6. In situ hybridization of GH mRNA in the neural retina of ED7 chick embryos. A, Specific hybridization with a 690-bp DIG-labeled HindIII antisense probe for GH mRNA is shown throughout the neural retina (NR), particularly in a layer of large cells in the RGC layer below the optic fiber layer (OFL). Magnification, x400. Specific labeling in the large cells in the RGC layer, in comparison with background labeling in the OFL, is shown at higher magnification in the boxed sections. B, The NR and RGC layer are not labeled in the presence of the Not1 sense probe. Magnification, x400. Representative data are from at least three embryos.

 
Retinal GH immunoreactivity
Western blotting.
GH immunoreactivity in extracts of the pituitary gland was mainly associated with proteins of 22 and 25 kDa and with proteins of 15 and 16 kDa (Fig. 7Go). In contrast, although the 15- and 16-kDa GH-immunoreactive proteins were abundantly present in extracts of ED6, ED8, and ED9 neural retinas, only trace amounts of the 22- and 25-kDa proteins were present in these tissues (Fig. 7Go). GH immunoreactivity was also present in the vitreous humor of ED6, ED8, and ED9 embryos, although this was associated with the 15-kDa protein (Fig. 7Go). The GH-immunoreactive 15-kDa protein was also present in medium in which the neural retinas of ED6 had been cultured for 3 d (Fig. 7Go). Other GH moieties of 16, 18, 22, and 25 kDa were also present in the culture medium but in lesser amounts (Fig. 7Go). When the neural retinas from the eyes of ED8 embryos were cultured for 24 h, the 15-kDa protein was the only GH-immunoreactive band detected in the culture medium (Fig. 7Go).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 7. Western blotting of GH-immunoreactive proteins in the neural retina and vitreous humor of chick embryos (pooled tissues from at least three embryos) at ED6, ED8, and ED9, in comparison with proteins in the pituitary (Pit) glands of slaughterhouse (42-d-old) chickens and proteins in culture media after the incubation of retinal tissues. Representative data are of at least three Western blots on separate tissue pools. The lanes were loaded with 60 µg neural retina protein, 5 µg vitreous protein, 20 µg culture media protein, and 3 µg pituitary protein.

 
After hatch, proteins with GH immunoreactivity of 15 and 16 kDa were present in the neural retinas of 1-, 5-, and 12-d neonates, in which immunoreactive proteins of approximately 25 kDa were also visible at 1 and 12 d (Fig. 8Go). By 42 d of age, the 15- and 16-kDa GH-immunoreactive proteins were no longer present in the neural retina, although a faint 25-kDa protein band was observed in this tissue. A GH-immunoreactive protein of 15 kDa was, nevertheless, abundantly present in the vitreous humor of 42-d-old chicks (Fig. 8Go).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 8. Western blotting of GH-immunoreactive proteins in the neural retina of ED8 chicks (pooled tissues from at least three birds), and in 1-, 5-, 12-, and 42-d-old chicks, in comparison with proteins in the vitreous and pituitary of slaughterhouse (42 d old) chickens. Data are representative of at least three Western blots on separate tissue pools. The lanes were loaded with 80 µg neural retina protein, 3 µg vitreous protein, and 3 µg pituitary protein.

 
ELISA.
Using ELISA, the estimated GH concentration in the neural retina of ED7 embryos was approximately 0.245 µg/mg protein. The GH concentration in the pituitary gland of 42-d-old birds was, for comparison, 39.59 ± 2.8 µg/mg protein (n = 3).

Immunocytochemistry.
GH immunoreactivity (green fluorescence) was widespread in the neural retina of ED8 embryos (Fig. 9BGo), although it was most intense in a band of large cells located in the presumptive RGC layer. Double-label confocal microscopy, using a RGC-specific monoclonal antibody (red fluorescence; Fig. 9AGo), confirmed the localization of GH primarily within the RGCs (yellow image; Fig. 9CGo).



View larger version (69K):
[in this window]
[in a new window]
 
FIG. 9. Immunocytochemical staining in the neural retina of ED8 chick embryo eyes for RGCs (red) (A) and GH (green) (B). Colocalization of GH in RGC-labeled cells (C) is indicated by the yellow image. Arrows indicate the RGCs. Magnification, x1000. Representative data are for at least six embryos.

 
Retinal GH action: GH-induced IGF-1 expression
RT-PCR amplified a 147-bp fragment of the chicken IGF-1 cDNA from reverse-transcribed retinal mRNA after ED8 retinas had been cultured for 48 h in Medium 199 (Fig. 10AGo). When cultured in 10-6 M chicken GH for 48 h, the amount of IGF-1 mRNA detected was markedly increased (Fig. 10AGo), more than 4-fold (P < 0.01, Student’s t test), when quantified by real-time PCR (Fig. 10BGo).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 10. GH action in the neural retina of ED8 chick embryos after 48 h culture in the presence (+GH) or absence (-GH) of 10-6 M chicken GH. A, RT-PCR of reverse-transcribed retinal mRNA in the presence of oligonucleotide primers designed to amplify a 147-bp fragment of chicken IGF-1 cDNA. The data are representative of six untreated neural retinas and six treated neural retinas. No cDNA fragments were generated from mRNA that had not been reverse transcribed (data not shown). B, IGF-1 mRNA determined by real-time PCR in the GH-treated neural retinas (+GH; n = 6), in comparison with untreated neural retinas (-GH; n = 6). The data are expressed relative to 18S rRNA in each sample (arbitrary units x 10-4). Means ± SEM. The asterisk indicates a statistical difference (Student’s t test), P < 0.01 between the groups.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 
Although GH gene expression primarily occurs postnatally in the pituitary gland, GH mRNA has been detected in the placenta, mammary gland, ovary, testis, lung, liver, skeletal muscle, cartilage, teeth, skin, thymus, spleen, Peyer’s patches, tonsils, salivary glands, and lymph nodes and is present in circulating lymphocytes and in blood endothelial and smooth muscle cells (22, 23, 24, 25, 26, 27, 28, 29). This is, however, the first demonstration of a full-length GH mRNA in the neural retina.

The GH transcript identified in these studies hybridized with oligonucleotide primers CLR1 and CLR2 and the primer set PE4F and PE5R to generate cDNA fragments of predicted size (7), identical with those generated from reverse-transcribed pituitary GH mRNA. Moreover, apart from a single base substitution, the amplified full-length transcript was nearly identical with the published sequence of pituitary GH cDNA and coded for the same protein (7). These results therefore clearly demonstrate expression of the full-length GH gene in the neural retina of embryonic chicks. This finding is also consistent with the presence of the full-length GH transcript in the brain (8), thymus, spleen and Bursa of Fabricius (9), and testes (30) of chickens. These results conflict, however, with the recent findings of Takeuchi et al. (5).

In contrast with our results, Takeuchi et al. (5) were unable to generate a full-length GH cDNA from reverse-transcribed mRNA from embryonic (ED17) chick eyes. These investigators were, however, able to generate a 360-bp cDNA from whole-eye mRNA using oligonucleotide primers PE4F and PE5R that spanned exons 4 and 5 of the pituitary GH gene. Although we were also able to generate this cDNA moiety with reverse-transcribed mRNA from the whole eye and from the neural retina of ED7 embryos, Takeuchi et al. (5), paradoxically, were unable to generate this moiety using reverse-transcribed mRNA from the retina, RPE, choroid, lens, sclera, vitreous body, iris, ciliary body, cornea, or the rectus muscle. They therefore thought that the GH transcript detected in the whole eye might have been derived from peripheral blood cells or other extraocular tissue collected when the eyes were removed from the embryos, rather than from the eye itself. It is, however, unclear how this transcript could be the source of the GH immunoreactivity that they found to be present in the RPE of their embryonic chicks.

Although the detection of this 360-bp cDNA indicates the presence of exons 4 and 5 sequences of the pituitary GH gene, Takeuchi et al. (5) claimed, using 5' rapid amplification of cDNA ends, that this cDNA was derived from a novel GH transcript, small chicken GH. The cDNA for this transcript was reported to be 569 bp and composed of two exons, the first exon extending from the middle of intron 3 of the pituitary GH gene to the end of exon 4, with the second exon identical with exon 5 of the pituitary GH gene. It is, however, pertinent that the 5' rapid amplification of cDNA ends data presented by Takeuchi et al. (5) does show the presence of larger cDNA moieties of approximately 700–900 bp, which may have been derived from the full-length transcript. These larger moieties were, however, not sequenced. Thus, although we did not find any evidence for the presence of the novel GH transcript reported by Takeuchi et al. (5), more than one GH transcript may be present in the eyes of embryonic chicks. It is also possible that this difference may reflect a strain difference because the birds used by Takeuchi et al. (5) were broilers (Rock Cornish), whereas ours were from a Leghorn strain (Shaver White). GH gene polymorphisms in intron and exon sequences have been reported for different chicken strains (31, 32, 33), and the single base pair substitution we found at position 588 of the GH cDNA is likely to reflect a similar polymorphism. This base pair substitution was similarly present in the GH cDNA cloned from the testes of this strain (30).

It is of interest that our nucleotide sequence for retinal GH is more homologous (99.9%) to the pituitary GH cDNA sequence reported by Tanaka et al. (7) than other reported chicken pituitary GH cDNAs, because the pituitary GH cDNA sequence reported by Baum et al. (20) differs by six nucleotides (99.1% homology), the sequence reported by Lamb et al. (19) differs by three nucleotides (99.6% homology), and the sequence reported by Zhvirblis et al. (21) differs by two nucleotides (99.7% homology). The predicted amino acid sequence of the protein coded by the retinal GH cDNA would, moreover, be 100% homologous with the protein coded by Tanaka’s (7) pituitary GH cDNA, whereas the base pair substitutions reported by Baum et al. (20), Lamb et al. (19), and Zhvirblis et al. (21) would result in proteins that differed by one amino acid (99.5% homology in each case).

The presence of the full-length GH mRNA in the neural retina and eyes of our embryonic chicks strongly supports the possibility that these tissues are extrapituitary sites of GH synthesis. Moreover, because pituitary somatotrophs do not differentiate in the chick embryo until at least ED12 (6) and because immunoreactive GH is not present in peripheral plasma until ED17 (6, 34), the presence of GH immunoreactivity in the eyes of embryonic chicks is likely to reflect its local production.

In our study, GH immunoreactivity was found throughout the neural retina of ED7–8 embryos, but it was most intense in the RGCs. These results confirm the widespread presence of GH immunoreactivity in the ED7 chick retina previously reported by Harvey et al. (3). Takeuchi et al. (5) also found GH immunoreactivity by immunocytochemistry in the eyes of chick embryos but only in the RPE and only between ED10 and ED20 (the RPE not staining for GH immunoreactivity on ED7, ED8, or ED9 or in 1- or 7-d-old neonates). The differences between these results are thus difficult to explain, but they are unlikely to reflect age-related differences in the embryos used. The antibody used by Takeuchi et al. (5) was, however, raised against rat GH, whereas ours was raised against GH purified from chicken pituitary glands (13). Although both antisera readily detect monomeric GH in the pituitary gland, it is possible that these antisera recognize different epitopes and GH variants, and that these may be differentially located in tissues of the eye or differ in their temporal expression. Indeed, it is now well established that GH in the chicken pituitary is markedly heterogeneous with numerous size and charge variants that result from differences in posttranslational processing, proteolytic cleavage, and aggregation (35, 36). It is also pertinent that we have previously found that peripheral plasma GH concentrations in chickens measured by our homologous RIA poorly correlate with those measured using a rat GH RIA, which lacks sensitivity and specificity (37).

Although we found full-length GH cDNA in the eyes of embryonic chicks, the coded full-length protein was not readily detectable in Western blots of embryonic neural retinas, although GH-immunoreactive proteins of approximately 25 kDa were present in the neural retina during neonatal and juvenile development. Smaller GH-immunoreactive proteins of 15 and 16 kDa were, however, abundantly present in the neural retina throughout embryonic development and in 1- to 12-d neonates. These smaller moieties and an 18-kDa protein are also present in pituitary extracts but in lesser amounts (35). It is, therefore, pertinent that the relative abundance of these moieties in the pituitary glands of chicken embryos is far greater than in neonates and adults (35). These moieties are likely to result from the proteolytic cleavage of monomeric GH (38). Indeed, a 15-kDa immunoreactive GH protein is derived from recombinant 25-kDa GH after its digestion with thrombin (38). The results of our study therefore indicate that ontogenetic changes in the posttranslational processing of the full-length protein might occur in the neural retina during development.

The antibody used by Takeuchi et al. (5) did not detect any small molecular weight GH moieties in the pituitary glands or ocular tissues of neonatal chicks. Although these authors claimed to have identified a novel GH transcript in the embryonic eye that coded for a 16.5-kDa protein, they could not provide any evidence for its presence in these tissues. Although we, paradoxically, detected a 16-kDa GH moiety in the neural retina of embryonic chicks, we did not detect a truncated GH transcript. The 16-kDa GH moiety that we found could, however, provide evidence of a small chicken GH coded by the truncated transcript identified by Takeuchi et al. (5) because it was not found in vitreous humor or the media used for the culture of retinal tissue. It is, therefore, of interest that the protein coded by the novel transcript identified by Takeuchi et al. (5) did not have a signal sequence, and hence it was not thought to be a secreted protein.

In our study, the vitreous humor contained abundant GH immunoreactivity. This is a novel finding and suggests that it may act as a conduit for retinal GH acting at extraretinal sites (possibly the lens, iris, ciliary body, vitreous body, or cornea). It may, alternately, act as a reservoir for retinal GH because GH was still present in the vitreous humor of juvenile chicks in which it had disappeared from the neural retina. This possibility is supported by the GH concentration in the vitreous being greater than in the neural retina, as indicated by the relative amounts of protein loaded on the gels. Moreover, because the 15-kDa GH moiety was abundantly present in the media of cultured neural retinas, it is highly likely that the 15-kDa GH immunoreactivity in the vitreous humor is derived from this tissue. Our inability to detect GH immunoreactivity in the neural retinas of juvenile (42 d) birds further indicates ontogenetic changes may occur in the transcription or translation of GH in this tissue. This is similar to the ontogenic differences in the GH immunoreactivity of the RPE reported by Takeuchi et al. (5).

The finding of GH immunoreactivity in the neural retina of embryonic chicks suggests roles for GH in ocular function, especially because GH receptor immunoreactivity has been similarly localized (3). This possibility is supported by our demonstration that GH markedly induces IGF-1 expression in the cultured neural retinas of ED8 embryos. Increased IGF-1 production is the hallmark of GH action (4, 39) and a critical step in the intracellular cascade involved in GH signal transduction (40, 41). Because IGF-1 has established antiapoptotic roles that promote cell survival (42), particularly during neurogenesis of the chick neural retina (43, 44, 45, 46), our results suggest GH involvement in these developmental processes. Indeed, exogenous GH has been shown to stimulate retinal development in the teleost eye by inducing local IGF-1 synthesis and the proliferation of stem cells and progenitors (4). GH is also thought to similarly induce neurogenesis in the developing brain and spinal cord (47, 48). It may also induce retinal angiogenesis because GH deficiency in humans is associated with reduced retinal vascularization (49), whereas exogenous GH promotes retinal angiogenesis (50), and GH excess is associated with retinopathy (51, 52, 53).

The localization of GH and its receptor (3) in the neural retina of embryonic chicks suggests GH may act as an autocrine or paracrine factor during retinal development. The extrapituitary production of GH in other target sites of GH action (54, 55) similarly supports the view that GH may act as a local growth factor during development (56, 57, 58, 59). Roles for endogenous GH in ocular function have, however, yet to be determined.

In summary, these results demonstrate the presence of GH and GH mRNA in ocular tissues of embryonic chicks. Although GH is widespread in the neural retina of early embryos, it is particularly abundant in the RGCs. The local production of GH in the eye during chick embryogenesis suggests hitherto unsuspected roles in ocular function.


    Acknowledgments
 
We thank Eve Parker and Wei Xin for their participation in some of the studies and Ortella Findlay for help in drafting the manuscript.


    Footnotes
 
This work was supported by the Canadian Institutes of Health Research. M.-L.B. is in receipt of an F.S. Chia University of Alberta Studentship and a studentship from the Alberta Heritage Foundation for Medical Research.

Abbreviations: DEPC, Diethylpyrocarbonate; DIG, digoxigenin; ED, embryonic day; RGC, retinal ganglion cell; RPE, retinal pigmented epithelium; SSC, saline sodium citrate.

Received May 27, 2003.

Accepted for publication August 25, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Retinal GH immunoreactivity
 Retinal GH action: GH-induced...
 Results
 Discussion
 References
 

  1. Harvey S, Hull KL, Fraser RA 1993 Growth hormone: neurocrine and neuro-endocrine perspective. Growth Regul 3:161–171[Medline]
  2. Harvey S, Hull KL 2003 Neural growth hormone: an update. J Mol Neurosci 20:1–13[CrossRef][Medline]
  3. Harvey S, Johnson CDM, Sanders EJ 2001 Growth hormone in neural tissues of the chick embryo. J Endocrinol 169:487–498[Abstract]
  4. Otteson DC, Cirenza PF, Hitchcock PF 2002 Persistent neurogenesis in the teleost retina: evidence for regulation by the growth hormone/insulin-like growth factor-1 axis. Mech Dev 117:137–149[CrossRef][Medline]
  5. Takeuchi S, Haneda M, Tshigawara K, Takahashi S 2001 Identification of a novel GH isoform: a possible link between GH and melanocortin systems in the developing chicken eye. Endocrinology 142:5158–5166[Abstract/Free Full Text]
  6. Harvey S, Johnson CDM, Sharma P, Sanders EJ, Hull KL 1998 Growth hormone: a paracrine growth factor in embryonic development? Comp Biochem Physiol 119C:305–315
  7. Tanaka M, Hosokawa Y, Watahiki M, Nakashima K 1992 Structure of the chicken growth hormone-encoding gene and its promoter region. Gene 112:235–239[CrossRef][Medline]
  8. Render CL, Hull KL, Harvey S 1995 Neural expression of the pituitary GH gene. J Endocrinol 147:413–422[Abstract/Free Full Text]
  9. Render CL, Hull KL, Harvey S 1995 Expression of the growth hormone gene in immune tissues. Endocrine 3:729–735
  10. Kansaku N, Shimada K, Terada O, Saito N 1994 Prolactin, growth hormone, and luteinizing hormone-beta subunit gene expression in the cephalic and caudal lobes of the anterior pituitary gland during embryogenesis and different reproductive stages in the chicken. Gen Comp Endocrinol 96:197–205[CrossRef][Medline]
  11. Kansaku N, Shimada K, Saito N 1995 Regionalized gene expression of prolactin and growth hormone in the chicken anterior pituitary gland. Gen Comp Endocrinol 99:60–68[CrossRef][Medline]
  12. Martinez-Coria H, Lopez-Rosales LJ, Carranza M, Berumen L, Luna M, Aramburo C 2002 Differential secretion of chicken growth hormone variants after growth hormone-releasing stimulation in vitro. Endocrine 17:91–102[CrossRef][Medline]
  13. Harvey S, Scanes CG 1977 Purification and radioimmunoassay of chicken growth hormone. J Endocrinol 73:321–329[Abstract/Free Full Text]
  14. Pimental B, Sanz C, Varela-Nieto I, Rapp UR, de Pablo F, de La Rosa EJ 2000 c-Raf regulates cell survival and retinal ganglion cell morphogenesis during neurogenesis. J Neurosci 20:3254–3262[Abstract/Free Full Text]
  15. Trousse F, Marti E, Gruss P, Torres M, Bovolenta P 2001 Control of retinal ganglion cell axon growth: a new role for Sonic hedgehog. Development 128:3927–3936
  16. O’Neill IE, Houston B, Goddard C 1990 Stimulation of insulin-like growth factor I production in primary cultures of chicken hepatocytes by chicken growth hormone. Mol Cell Endocrinol 70:41–47[CrossRef][Medline]
  17. Kajimoto Y, Rotwein P 1989 Structure and expression of a chicken insulin-like growth factor I precursor. Mol Endocrinol 3:1907–1913[CrossRef][Medline]
  18. van Tuinen M, Sibley CG, Hedges SB 2000 The early history of modern birds inferred from DNA sequences of nuclear and mitochondrial ribosomal genes. Mol Biol Evol 17:451–457[Abstract/Free Full Text]
  19. Lamb IC, Galehouse DM, Foster DN 1988 Chicken growth hormone cDNA sequence. Nucleic Acids Res 16:9339[Free Full Text]
  20. Baum D, Graser G, Heib M, Krampitz G 1990 Chicken growth hormone: cDNA-synthesis and base sequence. Comp Biochem Physiol B 96:491–495[CrossRef][Medline]
  21. Zhvirblis GS, Gorbulev VG, Rubtsov PM, Karapetian RV, Zhuravlev IV 1987 Genetic engineering of peptide hormones. I. Cloning and primary structure of cDNA of chicken growth hormone. Mol Biol (Mosk) 21:1620–1624
  22. Palmetshofer A, Zechner D, Luger TA, Barta A 1995 Splicing variants of the human growth hormone mRNA: detection in pituitary, mononuclear cells and dermal fibroblasts. Mol Cell Endocrinol 113:225–234[CrossRef][Medline]
  23. Wu H, Devi R, Malarkey WB 1996 Localization of growth hormone messenger ribonucleic acid in the human immune system—a clinical research study. J Clin Endocrinol Metab 81:1278–1282[Abstract]
  24. Schwartzler A, Untergasser G, Hermann M, Dirnhofer S, Abendstein B, Madersbacher S, Berger P 1997 Selective growth hormone/placental lactogen gene transcription and hormone production in pre- and postmenopausal human ovaries. J Clin Endocrinol Metab 82:3337–3341[Abstract/Free Full Text]
  25. Yoshizato H, Fujikawa T, Soya H, Tanaka M, Nakashima K 1998 The growth hormone (GH) gene is expressed in the lateral hypothalamus: enhancement by GH-releasing hormone and repression by restraint stress. Endocrinology 139:2545–2551[Abstract/Free Full Text]
  26. Tresquerres JA, Ariznavarreta C, Granados B, Costoy JA, Perez-Romero A, Salame F, Hermanussen M 1999 Salivary gland is capable of GH synthesis under GHRG stimulation. J Endocrinol 160:217–222[Abstract]
  27. Allan JT, Bloor CA, Kedia RK, Hnight RA, Spiteri MA 2000 Expression of growth hormone-releasing factor, growth hormone, insulin-like growth factor-1 and its binding proteins in human lung. Neuropeptides 34:98–107[CrossRef][Medline]
  28. Slominski A, Malarkey WB, Wortsman J, Asi SI, Carlson A 2000 Human skin expresses growth hormone but not the prolactin gene. J Lab Clin Med 136:476–481[CrossRef][Medline]
  29. Recher S, Raccurt M, Lambert A, Lobie PE, Mertani HC, Morel G 2001 Prenatal and adult growth hormone gene expression in rat lymphoid organs. J Histochem Cytochem 49:347–354[Abstract/Free Full Text]
  30. Harvey S, Murphy AE, Hull KL, Luna M, Aramburo C 2002 Testicular growth hormone and GH mRNA. GH-IGF Res 12:262
  31. Feng XP, Kuhnlein U, Aggrey SE, Gavora JS, Zadworny D 1997 Trait association of genetic markers in the growth hormone and the growth hormone receptor gene in a White Leghorn strain. Poult Sci 76:1770–1775[Abstract/Free Full Text]
  32. Ip SC, Zhang X, Leung FC 2001 Genomic growth hormone gene polymorphisms in native Chinese chickens. Exp Biol Med 226:458–462[Abstract/Free Full Text]
  33. Kuhnlein U, Ni L, Weigend S, Gavora JS, Fairfull W, Zadworny D 1997 DNA polymorphisms in the chicken growth hormone gene: response to selection for disease resistance and association with egg production. Anim Genet 28:116–123[CrossRef][Medline]
  34. Harvey S, Davison TF, Chadwick A 1979 Ontogeny of growth hormone and prolactin secretion in the domestic fowl (Gallus domesticus). Gen Comp Endocrinol 59:270–273
  35. Aramburo C, Luna M, Carranza M, Reyes M, Martinez-Coria H, Scanes G 2000 Growth hormone size variants: changes in the pituitary during development of the chicken. Proc Soc Exp Biol Med 223:67–74[Abstract/Free Full Text]
  36. Aramburo C, Carranza M, Martinez-Coria H, Reyes M, Berumen L, Lopez J, Pascacio H, Huerta L, Luna M 2001 Molecular and functional heterogeneity of growth hormone. In: Dawson A, Chaturvedi CM, eds. Avian endocrinology. New Delhi, India: Narosa Publishing House; 273–286
  37. Harvey S, Hoshino S, Suzuki M 1987 Plasma immunoreactive-growth hormone in domestic fowl: measurement by homologous and heterologous radioimmuno-assays. Gen Comp Endocrinol 65:92–98[CrossRef][Medline]
  38. Aramburo C, Carranza M, Reyes M, Luna M, Martinez-Coria H, Berumen L, Scanes CG 2001 Characterization of a bioactive 15 kDa fragment produced by proteolytic cleavage of chicken growth hormone. Endocrine 15:231–240[CrossRef][Medline]
  39. Houston B, O’Neill IE 1991 Insulin and growth hormone act synergistically to stimulate insulin-like growth factor-I production by cultured chicken hepatocytes. J Endocrinol 128:389–393[Abstract/Free Full Text]
  40. Le Roith D, Bondy C, Yakar S, Liu JL, Butler A 2001 The somatomedin hypothesis: 2001. Endocr Rev 22:53–74[Abstract/Free Full Text]
  41. Butler AA, Le Roith D 2001 Control of growth by the somatropic axis: growth hormone and the insulin-like growth factors have related and independent roles. Annu Rev Physiol 63:141–164[CrossRef][Medline]
  42. Le Roith D 2000 Regulation of proliferation and apoptosis by the insulin-like growth factor-I receptor. Growth Horm IGF Res 10:S12–S13
  43. Calvaruso G, Vento R, Guiliano M, Lauricella M, Gergino E, Tesorieere G 1996 Insulin-like growth factors in chick embryo retina during development. Regul Pept 61:92–125
  44. Frade JM, Marti E, Bovolenta P, Rodriguez-Pena MA, Perez-Garcia D, Rohrer H, Edgar D, Rodriguez-Tebar A 1996 Insulin-like growth factor-1 stimulates neurogenesis in chick retina by regulating expression of the alpha 6 integrin subunit. Development 122:2497–2506[Abstract]
  45. Alarcon C, Morales AV, Pimentel B, Serna J, de Pablo F 1998 (Pro)insulin and insulin-like growth factor 1 complementary expression and roles in early development. Comp Biochem Physiol B 121:13–17[CrossRef][Medline]
  46. Hernandez-Sanchez C, Lopez-Carranza A, Alarcon C, de La Rosa EJ, de Pablo F 1995 Autocrine/paracrine role of insulin-related growth factors in neuro-genesis: local expression and effects on cell proliferation and differentiation in retina. Proc Natl Acad Sci USA 91:9834–9838
  47. Chen L, Lund PK, Burgess SB, Rudisch BE, McIlwain DL 1997 Growth hormone, insulin-like growth factor-1 and motoneuron size. J Neurobiol 32:202–212[CrossRef][Medline]
  48. Ajo R, Cacicdeo L, Navarro C, Sanchez-Franco F 2003 Growth hormone action on proliferation and differentiation of cerebral cortical cells from fetal rat. Endocrinology 144:1086–1097[Abstract/Free Full Text]
  49. Hellstrom A, Svensson E, Carlsson B, Niklasson A, Albertsson-Wikland K 1999 Reduced retinal vascularization in children with GH deficiency. J Clin Endocrinol Metab 84:795–798[Abstract/Free Full Text]
  50. Struman I, Bentzien F, Lee H, Mainfoid V, d’Angelo G, Goffin V, Weiner RI, Martial JA 1999 Opposing actions of intact and N-terminal fragments of the human prolactin/growth hormone family members on angiogenesis: an efficient mechanism for the regulation of angiogenesis. Proc Nat Acad Sci USA 96:1246–1251[Abstract/Free Full Text]
  51. Hansen R, Koller EA, Malozowski S 2000 Full remission of growth hormone (GH)-induced retinopathy after GH treatment discontinuation: long-term follow-up. J Clin Endocrinol Metab 85:2627[Free Full Text]
  52. Hikino S, Ihara K, Yamamoto J, Takahata Y, Nakayama H, Kinukawa N, Narazaki Y, Hara T 2001 Physical growth and retinopathy in preterm infants: involvement of IGF-1 and GH. Pediatr Res 50:732–736[Medline]
  53. Chantelau E 2002 Effect of growth hormone receptor antagonist on proliferative diabetic retinopathy. Ophthalmology 109:2187–2188[Medline]
  54. Jeay S, Sonenshein GE, Postel-Vinay MC, Kelly PA, Baixeras E 2002 Growth hormone can act as a cytokine controlling survival and proliferation of immune cells: new insights into signaling pathways. Mol Cell Endocrinol 188:1–7[CrossRef][Medline]
  55. Segard HB, Moulin S, Boumard S, de Cremiers CA, Kelly PA, Finidori J 2003 Autocrine growth hormone production prevents apoptosis and inhibits differentiation in C2C12 myoblasts. Cell Signal 15:615–623[CrossRef][Medline]
  56. Pantaleon M, Whiteside EJ, Harvey MB, Barnard RT, Waters MJ, Kaye PL 1997 Functional growth hormone (GH) receptors and GH are expressed by preimplantation mouse embryos: a role for GH in early embryogenesis? Proc Natl Acad Sci USA 94:5125–5130[Abstract/Free Full Text]
  57. Waters MJ, Shang CA, Behncken SN, Tam SP, Li H, Shen B, Lobie PE 1999 Growth hormone as a cytokine. Clin Exp Pharmacol Physiol 26:760–764[CrossRef][Medline]
  58. Waters MJ, Kaye PL 2002 The role of growth hormone in fetal development. Growth Horm IGF Res 12:137–146[CrossRef][Medline]
  59. Markham KE, Kaye PL 2003 Growth hormone, insulin-like growth factor I and cell proliferation in the mouse blastocyst. Reproduction 125:327–336[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
M.-L. Baudet, B. Martin, Z. Hassanali, E. Parker, E. J. Sanders, and S. Harvey
Expression, Translation, and Localization of a Novel, Small Growth Hormone Variant
Endocrinology, January 1, 2007; 148(1): 103 - 115.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/12/5459    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend