help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, Y. L.
Right arrow Articles by Dannies, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, Y. L.
Right arrow Articles by Dannies, P. S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*BARIUM CHLORIDE
*BARIUM COMPOUNDS
Endocrinology Vol. 143, No. 11 4243-4248
Copyright © 2002 by The Endocrine Society


ARTICLE

Prolonged Retention after Aggregation into Secretory Granules of Human R183H-Growth Hormone (GH), a Mutant that Causes Autosomal Dominant GH Deficiency Type II

Yong Lian Zhu, Becky Conway-Campbell, Michael J. Waters and Priscilla S. Dannies

Department of Pharmacology (Y.L.Z., P.S.D.), Yale University School of Medicine, New Haven, Connecticut 06520; and Physiology and Pharmacology Department and Institute for Molecular Bioscience (B.C.-C., M.J.W.), University of Queensland, St. Lucia 4072, Australia

Address all correspondence and requests for reprints to: Priscilla S. Dannies, Yale University School of Medicine, Department of Pharmacology, 333 Cedar Street, New Haven, Connecticut 06520-8066. E-mail: priscilla.dannies{at}yale.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human R183H-GH causes autosomal dominant GH deficiency type II. Because we show here that the mutant hormone is fully bioactive, we have sought to locate an impairment in its progress through the secretory pathway as assessed by pulse chase experiments. Newly synthesized wild-type and R183H-GH were stable when expressed transiently in AtT20 cells, and both formed equivalent amounts of Lubrol-insoluble aggregates within 40 min after synthesis. There was no evidence for intermolecular disulfide bond formation in aggregates of wild-type hormone or the R183H mutant. Both wild-type and R183H-GH were packaged into secretory granules, assessed by the ability of 1 mM BaCl2 to stimulate release and by immunocytochemistry. The mutant differed from wild-type hormone in its retention in the cells after packaging into secretory granules; 50% more R183H-GH than wild-type aggregates were retained in AtT20 cells 120 min after synthesis, and stimulated release of R183H-GH or a mixture of R183H-GH and wild-type that had been retained in the cell was reduced. The longer retention of R183H-GH aggregates indicates that a single point mutation in a protein contained in secretory granules affects the rate of secretory granule release.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NEUROENDOCRINE CELLS STORE protein hormones in concentrated forms in dense cores of secretory granules, with the result that large amounts of hormones are available for rapid release when needed. The protein hormones in the dense cores are so concentrated that they may be isolated from granules as insoluble aggregates (1, 2). Some protein hormones are proteolytically cleaved to mature forms in addition to being concentrated in granules, but for others the process is simpler. Prolactin (PRL) and GH are monomeric proteins that are not proteolytically processed or covalently modified in any way during concentration into granules (3, 4). Aggregation appears to be a primary step in the formation of secretory granules containing PRL or GH, based on the morphology of the secretory pathway of PRL-producing cells in lactating rats (5). PRL aggregates are detected before secretory granules start to form, scattered throughout the trans-Golgi complex. The trans-Golgi cisternae then appear to be consumed completely by budding of many small vesicles, too small to contain the relatively large aggregates of PRL. Secretory granules form as extraneous membrane and soluble material are removed, leaving behind the aggregates as the contents of secretory granules.

Although the formation of aggregates of GH or PRL is likely to be an essential early step in the formation of secretory granules, other events must occur as well. Membrane proteins necessary for proper transport and regulated exocytosis of the granules must be appropriately located in the vesicles that contain hormone aggregates. Some secretory granule membrane proteins are necessary for regulated exocytosis, such as synaptotagmin, which is the major Ca2+ sensor responsible for regulated release (6), and synaptobrevin, also referred to as VAMP, which is a constituent of the fusion complex responsible for exocytosis (7). These proteins are not located exclusively in membranes of secretory granules but are also found in synaptic vesicle-like microvesicles found in neuroendocrine cells. There are other proteins, such as ICA512 (also called IA-2) and phogrin, which preferentially localize in membranes of dense core secretory granules (8, 9, 10, 11, 12). Their function is not well understood, although ICA512 is thought to play a role in the proper transport of the granules (13).

Human R183H-GH is a mutant that causes familial isolated autosomal dominant GH deficiency (type II) (14, 15). Deladoey et al. (16) have demonstrated that an individual with this mutation does have releasable GH stores, but release is severely impaired. We show here that aggregates of R183H-GH are retained longer than those of wild-type GH when these proteins are expressed in AtT20 cells, so that secretory granules containing R183H-GH are not as effectively exocytosed as those containing wild-type hormone.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Vectors for transfection
Human GH cDNA was a gift from Drs. Frances DeNoto and Brian West (University of California, San Francisco, CA) and was cloned into pcDNA3 (Invitrogen, Carlsbad, CA) by adding XhoI and HindIII sites by PCR with primers as previously described (17). Arginine 183 was mutated to histidine using the technique of Ho et al. (18), with primers 5'ccctccacagagtggcactgc3' and 5'atcgtgcagtgccactctgtg3'. The mutation was confirmed by sequencing in the W. M. Keck Foundation Biotechnology Resource Laboratory at Yale University (New Haven, CT).

Pulse chase procedures
Cells, at 2.3 x 105 cells/60-mm plate, were transfected with 15 µl of Superfect and 5 µg pcDNA3 containing sequences for human wild-type GH or R183H-GH. For incorporation of 35S-amino acids, cells were incubated one day after transfection with 180 µC Express 35S-Protein Labeling Mix (NEN Life Science Products, Boston, MA) in cysteine and methionine-free DMEM with 10 mM 2[N-morpholino]ethane sulfonic acid (MES), 10 mM HEPES, 4 mM NaHCO3, and 5% horse serum (Central Biomedia, Inc., Irwin, MO); incubation was for 10 min unless otherwise indicated. During the chase period, cells were incubated with DMEM, plus 2 mM cysteine, 2 mM methionine, 10 mM HEPES, 10 mM 2[N-morpholino]ethane sulfonic acid (MES), 4 mM NaHCO3, and 15% horse serum. Solutions used for these incubations were equilibrated in a 5% CO2 atmosphere before use. For analysis at each time point, medium and cells were collected and cells dissolved in 0.32 M sucrose; 1.5% Lubrol; 0.5% BSA; 10 mM sodium phosphate buffer, pH 7.0; 100 µg/ml phenylmethylsulfonylfluoride; 1 µg/ml aprotinin; and 2.5 µg/ml pepstatin, and then centrifuged at 50,000 x g for 1 h at 4 C. The pellet was resuspended in lysis buffer and immunoprecipitation followed by gel electrophoresis carried out as previously described (19). The amount of 35S-protein in the supernatant, pellet, and medium was quantified after gel electrophoresis using a Molecular Imager (Bio-Rad Laboratories, Inc., Hercules, CA). In the experiments to assess intermolecular disulfide bond formation or release induced by BaCl2, cells were resuspended in lysis buffer directly, with or without reducing agents, followed by immunoprecipitation and gel electrophoresis.

Antiserum to human GH for immunoprecipitation and immunocytochemistry was from the NIDDK National Hormone and Pituitary Program and A. F. Parlow.

Immunocytochemistry
Cells were grown on glass coverslips as described above and then fixed in 2% formaldehyde and 120 mM sodium phosphate buffer, pH 7.4. The primary antiserum was rabbit antihuman GH, and the secondary antiserum goat antirabbit antibody conjugated to Texas Red (Molecular Probes, Inc., Eugene, OR). Confocal microscopy was performed on a Carl Zeiss (Jena, Germany) LSM 510 microscope at the Yale University Center for Cell Imaging.

Bioassay and immunoassay
The human GH bioactivity in the samples of media taken from wild-type or the R183H GH transfected GH4C1 cells was determined by the MTT [3-(4,5,-dimethylthiazol-2-yl)-2,5,-diphenyltetrazolium bromide], colorimetric assay for cell proliferation (20) using a BaF/B03 clonal cell line (BaF-B2B2) stably expressing around 7400 human GH receptors per cell (21, 22). Cells grown to 70% confluence in Roswell Park Memorial Institute 1640 medium supplemented with 10% serum supreme and 100 ng/ml human GH were washed with PBS before being resuspended at 8 x 105 cells/ml in bioassay media (Roswell Park Memorial Institute 1640 medium supplemented with 0.5% serum supreme). Fifty microliters of cells were added to100 µl of serially diluted sample media from either wild-type or R183H GH in a 96-well microtitre plate. Each point was performed in sextuplicate. The plate was incubated for 18 h at 37 C and 5% CO2, and then MTT [3-(4,5,-dimethylthiazol-2-yl)-2,5,-diphenyltetrazolium bromide] was added at a final concentration of 1 mg/ml for a further 3 h incubation under the same conditions. The cells were lysed with 120 µl of isopropanol and, after 15 min color development, the absorbance was read at 595 nm using a Bio-Rad Laboratories, Inc. microplate reader. The bioactivity was determined from the ED50 calculation for each sample using Microsoft Corp. (Redmond, WA) Excel and DeltaGraph data-processing software packages. Samples were assayed on four separate occasions.

Immunoreactivity of human GH in each sample was determined using the human GH RIA kit from the National Hormone and Peptide Program as instructed, using serial dilutions of medium, with media blanks diluted in parallel. After bound/free separation, bound counts were measured in an LKB 1277 {gamma}-counter (Vienna, Austria), and unknown concentrations were derived from the standard curve using DeltaGraph data processing software. Samples were assayed independently, four times.

Statistics
The data presented are the mean of three or more independent experiments. Significant differences were determined by ANOVA, followed by Neuman-Keuls posttest.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human GH expressed in AtT20 cells was soluble in Lubrol immediately after synthesis, assayed after a 10-min incubation with 35S-amino acids, but became insoluble with time (Fig. 1Go). Forty minutes after synthesis, an average of 41% of total 35S-GH (intracellular plus extracellular) was insoluble in Lubrol, similar to results obtained previously (19). By 120 min, over half of 35S-GH was secreted, and 23% remained in the cells in a Lubrol-insoluble form. Newly synthesized R183H-GH was also soluble immediately after incubation with 35S-amino acids and also became insoluble with time (Fig. 1Go); 40 min after synthesis, an average of 49% of the total 35S-R183H-GH was insoluble in Lubrol. R183H-GH differed from wild-type GH in that it was not secreted from the cells as rapidly, particularly the Lubrol-insoluble form; 120 min after synthesis, 38% of the 35S-R183H-GH still remained in the cells in a Lubrol-insoluble form compared with 23% of the wild-type hormone. R183H-GH was stable, as was wild-type GH, for at least 2 h after synthesis (Fig. 2Go). Cells transfected in the same experiment with equal amounts of DNA usually synthesized approximately equal amounts of wild-type or mutant hormone. In the series of experiments in which we performed pulse chase procedures, the mean amount of 35S-R183H-GH synthesized was 126 ± 44% (mean ± SD) of the amount of wild-type hormone. The amounts of mutant and wild-type hormone in the medium after incubating overnight with 35S-amino acids were also approximately the same; the accumulation of 35S-R183H-GH was 102 ± 22% of 35S-wild-type GH.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Newly synthesized wild-type or R183H-GH in transfected AtT20 cells. A, Immunoprecipitation followed by gel electrophoresis of 35S-GH immediately at the end of a 10-min incubation with 35S-amino acids (0 min of chase) or 40 min after synthesis (40 min of chase), in cells transfected with wild-type GH (wild-type) or R183H-GH (R183H). Cells were lysed in Lubrol buffer and centrifuged as described in Materials and Methods. S, Supernatant of cell lysate; P, pellet of cell lysate; M, medium. B, 35S-GH in transfected AtT20 cells at times after incubation with 35S-amino acids. Top, 35S-GH secreted into the medium as a percent of total 35S-GH in the culture. Bottom, 35S-GH insoluble in Lubrol as a percent of total 35S-GH in the culture. Squares, Wild-type GH; circles, R183H-GH. *, P < 0.05 for R183H-GH compared with wild-type hormone.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Stability of newly synthesized wild-type or R183H-GH in transfected AtT20 cells. Intact 35S-GH remaining in the cultures (cells plus medium) as a percent of that present at the end of the 10-min incubation with 35S-amino acids (pulse), determined by SDS gels as in Fig. 1Go. Squares, Wild-type GH; circles, R183H-GH.

 
The Lubrol-insoluble aggregates of R183H-GH appeared to form in the same manner as those of wild-type GH because formation of each aggregate was affected to the same extent by several conditions. Incubation at 15 C prevents transfer of newly synthesized proteins from the endoplasmic reticulum to the Golgi complex (23). Incubating AtT20 cells transfected with wild-type or R183H-GH at 15 C after the incubation with 35S-amino acids reduced conversion of newly synthesized wild-type and mutant hormone to the Lubrol-insoluble form to the same extent (Fig. 3Go). Incubation at 20 C causes accumulation of material in the trans-Golgi region and prevents vesicle budding from that region and further transport (24). Incubating AtT20 cells transfected with wild-type or R183H-GH at 20 C after the incubation with 35S-amino acids also reduced conversion of wild-type and mutant hormone to the Lubrol-insoluble form, but not to the extent that incubation at 15 C did (Fig. 3Go). These results suggest aggregation of both mutant and wild-type hormone occurs after transport from the endoplasmic reticulum, and some occurs in the trans-Golgi region. Bafilomycin A1 inhibits vacuolar adenosine triphosphatases and therefore neutralizes acidic compartments in cells (25). We previously found that an acidic pH in the secretory pathway was not necessary for aggregation of rat PRL in GH4C1 cells, although an acidic pH facilitated aggregation formation (19). Human GH expressed in AtT20 cells behaved in a similar fashion because addition of bafilomycin A1 after the incubation with 35S-amino acids caused no significant reduction in the amount of Lubrol-insoluble aggregate that formed 40 min later, although there was an inhibition of secretion (Fig. 4Go). The effect of bafilomycin A1 on formation of Lubrol-insoluble R183H-GH and secretion was similar (Fig. 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Effect of temperature on conversion of newly synthesized wild-type or R183H-GH to a Lubrol-insoluble form in transfected AtT20 cells. Cells were incubated with 35S-amino acids for 10 min at 37 C, and then for a subsequent 40-min incubation without 35S-amino acids at the indicated temperatures: 37, 20, or 15 C. Data are the amount of 35S-GH insoluble in Lubrol as a percent of total 35S-GH in the culture. Open bars, Wild-type GH; filled bars: R183H-GH. Values at 20 C are significantly different from those at 15 or 37 C (P < 0.05); there is no significant difference between wild-type and R183H-GH at any temperature.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Effect of bafilomycin A1 on conversion of newly synthesized wild-type or R183H-GH to a Lubrol-insoluble form in transfected AtT20 cells. Cells were incubated with 35S-amino acids for 10 min, and then for a subsequent 40-min incubation without 35S-amino acids with or without 1 µM bafilomycin A1. Data in the top panel are the amounts of 35S-GH secreted into the medium as a percent of total 35S-GH in the culture. Data in the bottom panel are the amounts of Lubrol-insoluble 35S-GH as a percent of the total 35S-GH in the culture. WT, Wild-type hormone (open bars). R183H, R183H-GH (filled bars). +, 1 µM bafilomycin (BAF) added; -, no additions.

 
Staining the transfected AtT20 cells by immunohistochemical techniques indicates that wild-type and R183H-GH were found in similar locations in the cells in small discrete patches near the plasma membrane and concentrated in the processes (Fig. 5Go). This pattern of localization is found in AtT20 cells with transfected proteins stored in secretory granules (26). BaCl2, 1 mM, stimulated release of wild-type GH from AtT20 cells 2 h after its synthesis, which is also consistent with a location in secretory granules (Fig. 6Go, left panel). Release of R183H-GH was stimulated, although to a lesser extent than that of wild-type hormone. Most newly synthesized hormone in cells incubated for only 10 min with 35S-amino acids is secreted from the cells relatively rapidly (Fig. 1Go). To increase the amount of labeled hormone in the retained stores, cells were incubated with 35S-amino acids for 4 h, then incubated for 2 h in the absence of 35S-amino acids to allow hormone that was not well retained to be released. Stimulation of release of 35S-GH that had been retained in the cells for up to 6 h after synthesis was then examined (Fig. 6Go, right panel). BaCl2 stimulated GH release significantly from those cells transfected with wild-type hormone alone (Fig. 6Go, right panel); stimulation of secretion from cells transfected with a mixture of half wild-type hormone and half R183H-GH or those transfected with R183H-GH alone was significantly less. We did not find the total amounts that accumulate in the medium overnight significantly reduced, as described above, but the amounts that are retained in cells are a very small proportion of the total synthesized. Therefore, although release of this set of granules is reduced, it is not a sufficiently large effect to affect the total secretion significantly.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. Transfected AtT20 cells stained for human GH. Wild-type GH, left panels; R183H-GH, right panels. Top panels, Section through nucleus of cells; bottom panels, lower sections of the same cells shown in top panels, with section showing extended processes.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Stimulation of release of human wild-type and R183H-GH from transfected AtT20 cells. Left panel, Release after 2 h. Cells transfected with 5 µg plasmid with wild-type or R183H-GH. Cells were incubated with 35S-amino acids for 10 min, and then for 120 min without 35S-amino acids. At that time, the medium was replaced with fresh medium with (+) or without (-) 1 mM BaCl2, and the cells incubated for 30 min more. The data are the amount of 35S-GH that accumulated in the medium during the final 30-min incubation as a percent of total 35S-GH present in the cultures at that time. Right panel, Release after 6 h. Cells transfected with 5 µg plasmid with wild-type GH or R183H-GH or 2.5 µg plasmid with wild-type and 2.5 µg plasmid with R183H-GH, and incubated with 35S-amino acids for 4 h, and then for 120 min without 35S-amino acids. At that time, the medium was replaced with fresh medium with (+) or without (-) 1 mM BaCl2, and the cells incubated for 30 min more. The data are the amount of 35S-GH that accumulated in the medium during the final 30-min incubation as a percent of total 35S-GH present in the cultures at that time. *, P < 0.05 compared with stimulated release of wild-type GH.

 
R183 is adjacent to C182, which forms a disulfide bond with C189, raising the possibility that incorrect cysteine pairing could explain the secretory defect. However, R183H-GH did not form intermolecular disulfide bonds during aggregation to any greater extent than wild-type GH. Forty minutes after incubation with 35S-amino acids, when wild-type and R183H-GH have formed aggregates, 35S-GH was immunoprecipitated and gel electrophoresis under reducing and nonreducing conditions performed (Fig. 7Go). 35S-GH migrated more rapidly and less evenly in nonreducing gels than reducing gels, but the recovery of 35S-GH in nonreducing gels compared with reducing gels at the position to which the monomer migrates was the same for mutant and wild-type hormone. The other bands that appear on the gel are nonspecific bands that are found in untransfected cells (Fig. 7Go) and when normal rabbit serum is used instead of antiserum against human GH (not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. Migration of 35S-GH in gels under reducing and nonreducing conditions. Transfected AtT20 cells were incubated with 35S-amino acids for 10 min and then for 40 min without 35S-amino acids, at which time cells (C) and medium (M) were collected and immunoprecipitation performed followed by electrophoresis with 10% ß-mercaptoethanol and 200 mM dithiothreitol (reducing) or without reductants (nonreducing). N, Not transfected; wt, transfected with wild-type GH; R183H, transfected with R183H-GH. The position to which monomeric GH migrates is indicated by GH; the estimated position of the GH dimer indicated by D.

 
A second indication that R183H-GH has not formed intermolecular disulfide bonds is that the ratio of biological activity to immunoreactivity activity of the hormone after secretion into the medium is the same for mutant and wild-type hormone (Table 1Go). The ratio is important as bioactivity considered alone does not account for differences in amounts secreted. The transfection experiment assayed in Table 1Go was an early experiment in which there was less R183H-GH secreted than wild-type GH, but in the later pulse-chase experiments, similar amounts were secreted when transfections in the same experiments were compared, as described above.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of biological activity to immunoreactivity of wild-type and R183H GH in the medium of transfected cells

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human GH is a relatively small (22 kDa), soluble, monomeric protein, and the only processing that occurs to it is cleavage of the 26-amino-acid leader sequence that is necessary for transport into the endoplasmic reticulum. Mature GH is a 4 {alpha}-helix bundle with 2 intramolecular disulfide bridges. It is interesting that mutations in this relatively simple protein have been found that cause autosomal dominant isolated GH deficiency. In most affected families, these mutations are in the donor splice site of intron 3 of the GH GH1 gene, and they result in misspliced mRNA, so that GH produced from this message lacks amino acids 32–71 (del32–71-GH) (15, 27, 28, 29, 30, 31, 32, 33). Coexpression of this mutant with wild-type GH in transiently transfected neuroendocrine cell lines results in posttranslation suppression of GH production (17, 34). The occurrence of this effect in the pituitary gland of affected individuals would contribute to the GH deficiency, although other mechanisms may also be involved (17).

In four unrelated families, a simpler mutation, in which a single base change of G to A replaces arginine at position 183 with histidine, also causes autosomal dominant isolated GH deficiency (14). Arginine 183 is adjacent to cysteine 182 in human GH, and this cysteine forms a disulfide bond with cysteine 189 in the properly folded wild-type protein (35). The cysteine is present in all GHs and PRLs, and arginine 183 is widely conserved in both hormones. A reasonable hypothesis for an effect of the conservative substitution of a histidine for this arginine would be that the bulkier histidine interferes with proper formation of the disulfide bond between residues 182 and 189, but we found no evidence for abnormal folding of R183H-GH. R183H-GH was stable for at least 2 h; proteins that misfold are frequently degraded rapidly in the endoplasmic reticulum (36, 37). R183H-GH also formed aggregates after synthesis with the same time course and susceptibility to temperature as wild-type GH, with no evidence for intermolecular disulfide bonds. Finally, R183H-GH secreted from transfected cells had the same biological activity to immunoreactivity ratio as wild-type hormone. Arginine 183 is part of binding site 1 of GH to its receptor and affects the on rate of binding (38), but the bioactivity of R183H-GH is consistent with the clinical evidence that this mutation causes GH deficiency rather than secretion of inactive forms (14, 16, 39).

Wild-type and R183H-GH are in vector constructions with the same sequences except for the single base change that changes arginine to histidine, so it is unlikely that mRNAs for each protein are transported to different regions of the cells, and therefore the translated products should be subjected to the same environmental influences. Both wild-type and R183H-GH aggregate after transport from the endoplasmic reticulum, based on temperature sensitivity, and are packaged into secretory granules, based on localization by immunocytochemistry and the ability to stimulate release by barium chloride, but aggregates of R183H-GH are retained longer than those of wild-type hormone, and stimulated release of mutant hormone that has been retained in the cells for several hours, either alone or in a mixture with wild-type hormone, is reduced.

Work by Deladoey et al. (16) indicated granules containing a mixture of wild-type and mutant hormone were not released normally; a single clone of AtT20 cells stably expressing HA-tagged wild-type and myc-tagged R183HGH did not release the hormones when stimulated as well as a clone expressing either alone. This finding is consistent with the content of granules affecting their function, although it differs somewhat from our findings in that they found stimulated release of only the mixture was impaired, whereas stimulated release of the mutant alone was not reduced. The combination of tags may have had effects in addition to the single amino acid mutation that account for differences with the untagged proteins we used.

The increased retention and reduction of release we observed in the AtT20 cell model may not alone be sufficient to account for the observed GH deficiency in affected individuals. The effects might be more evident in normal human somatotrophs, in which there may be less spontaneous release of newly synthesized hormone. The prolonged retention and reduced release of R183H-GH, however, is interesting in itself in relation to secretory granule formation, for it suggests that the content of granules affects their function.

There are two other examples of cargo influencing granule behavior. Firstly, in bag cells of Aplysia californica, the precursor form of egg-laying hormone is cleaved in the trans-Golgi lumen into a C-terminal and an N-terminal portion that form separate distinct aggregates in the lumen of the trans-Golgi before secretory granules form (40). Two types of secretory granules form, containing primarily N-terminal or C-terminal portions, and the two types are transported to separate processes in the bag cell (41). Secondly, in atrial myocytes, mutations in the N-terminal portion of proatrial natriuretic peptide change the shape of secretory granules and their ability to dock at the plasma membrane (42). These examples of content influencing secretory granule behavior support the view that the longer retention of rat PRL than rat GH in GH4C1 cells (19), and other cases where two secretory granule proteins expressed in the same cells behave differently (26, 43, 44), may be a result of granule cargo affecting its secretory behavior. A possible mechanism for this influence may be that efficiency of recognition of a surface motif on the hormone aggregates influences the rate of accumulation of membrane proteins necessary for granule function, hence affecting the rate of filling and release of the secretory stores.


    Acknowledgments
 


    Footnotes
 
This work was supported by a grant from the American Diabetes Association and NIH Grant DK-46097 and the Cell Biology Core of the Diabetes Endocrinology Research Grant.

Abbreviation: PRL, Prolactin.

Received June 3, 2002.

Accepted for publication July 3, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Giannattasio G, Zanini A, Meldolesi J 1975 Molecular organization of rat prolactin granules. I. In vitro stability of intact and "membraneless" granules. J Cell Biol 64:246–251[Abstract/Free Full Text]
  2. Michael J, Carroll R, Swift HH, Steiner DF 1987 Studies on the molecular organization of rat insulin secretory granules. J Biol Chem 262:16531–16535[Abstract/Free Full Text]
  3. Mastro RM, Dannies PS 1995 Lack of correlation of distribution of prolactin (PRL) charge isoforms with induction of PRL storage. Endocrinology 136:69–74[Abstract]
  4. Thorner MO, Vance ML, Horvath E, Kovacs K 1992 Textbook of endocrinology. 8th ed. Philadelphia: W. B. Saunders
  5. Rambourg A, Clermont Y, Chretien M, Olivier L 1992 Formation of secretory granules in the Golgi apparatus of prolactin cells in the rat pituitary gland: a stereoscopic study. Anat Rec 232:169–179[CrossRef][Medline]
  6. Bennett MR 1999 The concept of a calcium sensor in transmitter release. Prog Neurobiol 59:243–277[CrossRef][Medline]
  7. Sutton RB, Fasshauer D, Jahn R, Brunger AT 1998 Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395:347–353[CrossRef][Medline]
  8. Rabin DU, Pleasic SM, Shapiro JA, Yoo-Warren H, Oles J, Hicks JM, Goldstein DE, Rae PM 1994 Islet cell antigen 512 is a diabetes-specific islet autoantigen related to protein tyrosine phosphatases. J Immunol 152:3183–3188[Abstract]
  9. Lan MS, Lu J, Goto Y, Notkins AL 1994 Molecular cloning and identification of a receptor-type protein tyrosine phosphatase, IA-2, from human insulinoma. DNA Cell Biol 13:505–514[Medline]
  10. Solimena M, Dirkx Jr R, Hermel JM, Pleasic-Williams S, Shapiro JA, Caron L, Rabin DU 1996 ICA 512, an autoantigen of type I diabetes, is an intrinsic membrane protein of neurosecretory granules. EMBO J 15:2102–2114[Medline]
  11. Wasmeier C, Hutton JC 1996 Molecular cloning of phogrin, a protein-tyrosine phosphatase homologue localized to insulin secretory granule membranes. J Biol Chem 271:18161–18170[Abstract/Free Full Text]
  12. Dirkx Jr R, Hermel JM, Rabin DU, Solimena M 1998 ICA 512, a receptor tyrosine phosphatase-like protein, is concentrated in neurosecretory granule membranes. Adv Pharmacol 42:243–246
  13. Ort T, Maksimova E, Dirkx R, Kachinsky AM, Berghs S, Froehner SC, Solimena M 2000 The receptor tyrosine phosphatase-like protein ICA512 binds the PDZ domains of ß2-syntrophin and nNOS in pancreatic ß-cells. Eur J Cell Biol 79:621–630[CrossRef][Medline]
  14. Wajnrajch MP, Gertner JM, Mullis PE, Deladoey J, Cogan JD, Lekhakula S, Kim S, Dannies PS, Saenger P, Moshang T, Phillips III JA, Leibel RL 2000 Arg183His, a new mutational "hot-spot" in the growth hormone (GH) gene causing isolated GH deficiency type II. J Endocr Genet 1:125–135
  15. Phillips III JA, Cogan JD 1994 Genetic basis of endocrine disease. 6. Molecular basis of familial human growth hormone deficiency. J Clin Endocrinol Metab 78:11–16[CrossRef][Medline]
  16. Deladoey J, Stocker P, Mullis PE 2001 Autosomal dominant GH deficiency due to an Arg183His GH-1 gene mutation: clinical and molecular evidence of impaired regulated GH secretion. J Clin Endocrinol Metab 86:3941–3947[Abstract/Free Full Text]
  17. Lee MS, Wajnrajch MP, Kim SS, Plotnick LP, Wang J, Gertner JM, Leibel RL, Dannies PS 2000 Autosomal dominant growth hormone (GH) deficiency type II: the Del32–71-GH deletion mutant suppresses secretion of wild-type GH. Endocrinology 141:883–890[Abstract/Free Full Text]
  18. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  19. Lee MS, Zhu YL, Chang JE, Dannies PS 2001 Acquisition of lubrol insolubility, a common step for growth hormone and prolactin in the secretory pathway of neuroendocrine cells. J Biol Chem 276:715–721[Abstract/Free Full Text]
  20. Mossman T 1983 Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65:55–63[CrossRef][Medline]
  21. Behncken SN, Rowlinson SW, Rowland JE, Conway-Campbell BL, Monks TA, Waters MJ 1997 Aspartate 171 is the major primate-specific determinant of human growth hormone. Engineering porcine growth hormone to activate the human receptor. J Biol Chem 272:27077–27083[Abstract/Free Full Text]
  22. Roswall EC, Mukku VR, Chen AB, Hoff EH, Chu H, McKay PA, Olson KC, Battersby JE, Gehant RL, Meunier A, Garnick RL 1996 Novel assays based on human growth hormone receptor as alternatives to the rat weight gain bioassay for recombinant human growth hormone. Biologicals 24:25–39[CrossRef][Medline]
  23. Saraste J, Svensson K 1991 Distribution of the intermediate elements operating in ER to Golgi transport. J Cell Sci 100(Part 3):415–430
  24. Griffiths G, Pfeiffer S, Simons K, Matlin K 1985 Exit of newly synthesized membrane proteins from the trans cisterna of the Golgi complex to the plasma membrane. J Cell Biol 101:949–964[Abstract/Free Full Text]
  25. Bowman EJ, Siebers A, Altendorf K 1988 Bafilomycins: a class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc Natl Acad Sci USA 85:7972–7976[Abstract/Free Full Text]
  26. Castle AM, Huang AY, Castle JD 1997 Passive sorting in maturing granules of AtT-20 cells: the entry and exit of salivary amylase and proline-rich protein. J Cell Biol 138:45–54[Abstract/Free Full Text]
  27. Cogan JD, Ramel B, Lehto M, Phillips III J, Prince M, Blizzard RM, de Ravel TJ, Brammert M, Groop L 1995 A recurring dominant negative mutation causes autosomal dominant growth hormone deficiency—a clinical research center study. J Clin Endocrinol Metab 80:3591–3595[Abstract]
  28. Binder G, Ranke MB 1995 Screening for growth hormone (GH) gene splice-site mutations in sporadic cases with severe isolated GH deficiency using ectopic transcript analysis. J Clin Endocrinol Metab 80:1247–1252[Abstract]
  29. Cogan JD, Prince MA, Lekhakula S, Bundey S, Futrakul A, McCarthy EM, Phillips III JA 1997 A novel mechanism of aberrant pre-mRNA splicing in humans. Hum Mol Genet 6:909–912[Abstract/Free Full Text]
  30. Missarelli C, Herrera L, Mericq V, Carvallo P 1997 Two different 5' splice site mutations in the growth hormone gene causing autosomal dominant growth hormone deficiency. Hum Genet 101:113–117[CrossRef][Medline]
  31. Kamijo T, Hayashi Y, Seo H, Ogawa M1999 Hereditary isolated growth hormone deficiency caused by GH1 gene mutations in Japanese patients. Growth Horm IGF Res 9(Suppl B):B31–B34
  32. Massa GG, Binder G, Oostdijk W, Ranke MB, Wit JM 1998 De novo mutations of the growth hormone gene: an important cause of congenital isolated growth hormone deficiency? Eur J Pediatr 157:272–275[CrossRef][Medline]
  33. Saitoh H, Fukushima T, Kamoda T, Tanae A, Kamijo T, Yamamoto M, Ogawa M, Hayashi Y, Ohmori S, Seo H 1999 A Japanese family with autosomal dominant growth hormone deficiency. Eur J Pediatr 158:624–627[CrossRef][Medline]
  34. Hayashi Y, Yamamoto M, Ohmori S, Kamijo T, Ogawa M, Seo H 1999 Inhibition of growth hormone (GH) secretion by a mutant GH-I gene product in neuroendocrine cells containing secretory granules: an implication for isolated GH deficiency inherited in an autosomal dominant manner. J Clin Endocrinol Metab 84:2134–2139[Abstract/Free Full Text]
  35. de Vos AM, Ultsch M, Kossiakoff AA 1992 Human growth hormone and extracellular domain of its receptor: crystal structure of the complex. Science 255:306–312[Abstract/Free Full Text]
  36. Hammond C, Helenius A 1995 Quality control in the secretory pathway. Curr Opin Cell Biol 7:523–529[CrossRef][Medline]
  37. Helenius A 2001 Quality control in the secretory assembly line. Philos Trans R Soc Lond B Biol Sci 356:147–150[CrossRef][Medline]
  38. Cunningham BC, Wells JA 1993 Comparison of a structural and a functional epitope. J Mol Biol 234:554–563[CrossRef][Medline]
  39. Deladoey J, Gex G, Vuissoz JM, Strasburger CJ, Wajnrajch MP, Mullis PE 2002 Effect of different growth hormone (GH) mutants on the regulation of GH-receptor gene transcription in a human hepatoma cell line. Eur J Endocrinol 146:573–581[Abstract]
  40. Sossin WS, Fisher JM, Scheller RH 1990 Sorting within the regulated secretory pathway occurs in the trans-Golgi network. J Cell Biol 110:1–12[Abstract/Free Full Text]
  41. Sossin WS, Sweet-Cordero A, Scheller RH 1990 Dale’s hypothesis revisited: different neuropeptides derived from a common prohormone are targeted to different processes. Proc Natl Acad Sci USA 87:4845–4848[Abstract/Free Full Text]
  42. Baertschi AJ, Monnier D, Schmidt U, Levitan ES, Fakan S, Roatti A 2001 Acid prohormone sequence determines size, shape, and docking of secretory vesicles in atrial myocytes. Circ Res 89:E23–E29
  43. Marx R, El Meskini R, Johns DC, Mains RE 1999 Differences in the ways sympathetic neurons and endocrine cells process, store, and secrete exogenous neuropeptides and peptide-processing enzymes. J Neurosci 19:8300–8311[Abstract/Free Full Text]
  44. Mowla SJ, Pareek S, Farhadi HF, Petrecca K, Fawcett JP, Seidah NG, Morris SJ, Sossin WS, Murphy RA 1999 Differential sorting of nerve growth factor and brain-derived neurotrophic factor in hippocampal neurons. J Neurosci 19:2069–2080[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
O. Hess, Y. Hujeirat, M. P. Wajnrajch, S. Allon-Shalev, Z. Zadik, I. Lavi, and Y. Tenenbaum-Rakover
Variable Phenotypes in Familial Isolated Growth Hormone Deficiency Caused by a G6664A Mutation in the GH-1 Gene
J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4387 - 4393.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Salemi, S. Yousefi, K. Baltensperger, I. C A F Robinson, A. Eble, D. Simon, P. Czernichow, G. Binder, E. Sonnet, and P. E Mullis
Variability of isolated autosomal dominant GH deficiency (IGHD II): impact of the P89L GH mutation on clinical follow-up and GH secretion
Eur. J. Endocrinol., December 1, 2005; 153(6): 791 - 802.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, Y. L.
Right arrow Articles by Dannies, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, Y. L.
Right arrow Articles by Dannies, P. S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*BARIUM CHLORIDE
*BARIUM COMPOUNDS


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals