| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Département dEndocrinologie et Biologie Cellulaire, Institut Cochin, Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université René Descartes (V.M., L.G., J.D.-L., X.B., M.G.C.), and Clinique des Maladies Endocriniennes et Métaboliques, Hôpital Cochin (L.G., X.B.), 75014 Paris, France
Address all correspondence and requests for reprints to: Dr. Maria Grazia Catelli, Département dEndocrinologie et Biologie Cellulaire, Institut Cochin, Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université René Descartes, 24 rue du Faubourg Saint Jacques, 75014 Paris, France. E-mail: catelli{at}cochin.inserm.fr.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Leukemia inhibitory factor (LIF), a pleiotropic cytokine that was originally identified as an inductive factor of differentiation of mouse monocytic leukemia M1 cells and plays a role in the systemic inflammatory response (14), also activates the hypothalamo-pituitary-adrenal axis (15, 16). LIF and LIF receptor (LIFR) expressions have been demonstrated in human and murine pituitary cells and in the murine corticotroph AtT-20 cell line (17, 18). LIF and LIFR gene expressions are stimulated by various inflammatory stimuli (19). The LIFR, deprived of endogenous kinase activity, is composed of the gp130 subunit, common to all receptors of the IL-6 family of cytokines, and the specific LIFR subunit. Binding of LIF to its high affinity cell surface receptor induces activation of the Janus protein tyrosine kinase (Jak) constitutively associated with the cytoplasmic portion of the gp130 receptor subunit (20). This leads to specific phosphorylation on tyrosine of the signal transducer and activator of transcription 1 (STAT1)- and STAT3-inactive cytoplasmic proteins and to their activation by homo- or heterodimerization, allowing their nuclear translocation and their binding to specific DNA elements of target genes (21, 22, 23, 24, 25).
In AtT-20 cells, LIF stimulates POMC promoter activity, POMC mRNA accumulation, and ACTH secretion (17, 26, 27). These effects are STAT3 dependent, as they are abrogated by the overexpression of dominant negative STAT3 mutants (28). Moreover, the STAT3-dependent induction of POMC promoter activity has been reported to depend on direct STAT3 cooperative binding to two adjacent low affinity sites overlapping in part the NurRE (29) in the distal domain of the POMC promoter.
Here we have found that two subregions of the POMC promoter are actually independently sufficient to sustain LIF responsiveness. The distal one, -414/-293, requires STAT1 and 3 binding to a single degenerated STAT1 and -3 response element. The proximal LIF-responsive subregion, which does not display STAT1 and -3 binding activity, has also been delimited -166/-96. Activated STAT1 and -3 may thus act on the same promoter in two different fashions: direct binding to DNA in the distal region and positive interference, in the absence of DNA binding, with other transcription factors bound to the proximal region.
| Materials and Methods |
|---|
|
|
|---|
Serum (BD Biosciences, Mountain View, CA; 2 mM glutamine and 0.5 mg/ml gentamicin). All cultures were maintained at 37 C in an atmosphere of 5% CO2 (30).
Plasmid construction
The progressive 5' deletions -480/-34, -323/-34, -166/-34 or internal deletions defining the three rat POMC promoter domains and their combinations fused to the minimal promoter -34/+63 (3) were subcloned into the pGL3-Basic-luciferase+ vector (Promega Corp., Madison, WI). The modified luciferase sequence of this vector allows elimination of the effects of enzyme accumulation. Additional constructs containing the segments -166/-96, -96/-34, and -414/-293 of the POMC promoter were made by PCR and subcloned upstream of the minimal POMC promoter into pGL3-Basic-luciferase+ vector. The sequences were controlled by automated sequencing.
The (NurRE)x3 reporter (three repetitions of NurRE sequence of the POMC promoter) was a gift from J. Drouin (9), and three repetitions of the POMC(NurRE-STAT) wild-type or mutant sequences were subcloned, giving the reporter constructs (NurRE-STAT)x3 and (NurRE-STATmut)x3 (see sequences in Fig. 5
).
|
Each sample mix for lipofection contained 500 ng POMC promoter-luciferase reporter plasmid and 250 ng Rous sarcoma virus promoter-lacZ plasmid as an internal control. Cells were washed with cold PBS and then lysed in 25 mM Tris/H3PO4 (pH 7.8), 10 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, and 15% glycerol. The luciferase activity was measured in a Lumat LB 9507 luminometer (EG&G Berthold Instruments, Nashua, NH) with 25 µl cleared cell lysate in the presence of 10 mM ATP and 28 µg D-luciferine. Integrated light emission was measured over 20 sec. Each experiment was independently repeated at least six times with each assay in triplicate. Results were expressed as the fold induction. The basal ratio of luciferase/ß-galactosidase activities of the minimal POMC promoter reporter was between 20,000 and 100,000 for all experiments.
Cytoplasmic and nuclear extracts
AtT-20 cells were grown to 80% confluence and serum-deprived for 16 h before a treatment with LIF for 20 min. Cells were harvested in cold PBS and then lysed in lysis buffer [20 mM HEPES (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.2% Nonidet P-40, 10%glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, 5 µg/ml antipain, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 mM vanadate] to obtain cytoplasmic extracts and nuclear pellets. The nuclear pellets were resuspended in extraction buffer [20 mM HEPES (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.35 M NaCl, 10% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, 5 µg/ml antipain, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 mM vanadate], and the supernatants corresponding to nuclear extracts were harvested after centrifugation. Final protein concentrations were determined by protein assay (Bio-Rad Laboratories, Inc., Richmond, CA).
Western blotting and antibodies
Cells extracts were boiled in Laemmli sample buffer [10 mM Tris-HCl (pH 6.8), 1% sodium dodecyl sulfate, 1% ß-mercaptoethanol, 10% glycerol, and 1% bromophenol blue] for 3 min and were separated by electrophoresis on 7.5% sodium dodecyl sulfate-polyacrylamide gel in separating buffer (100 mM Tris, 760 mM glycine, and 1% sodium dodecyl sulfate), then proteins were transferred to nitrocellulose membrane (Protean, Schleicher \|[amp ]\| Schuell, Inc., Keene, NH) in transfer buffer (100 mM Tris, 760 mM glycine, and 0.2% ethanol). The membrane was saturated in blocking buffer: 5% nonfat milk diluted in Tris-buffered saline containing 0.05% Tween 20. Detection of phospho-STAT1 (STAT1-YP) and phospho-STAT3 (STAT3-YP) was carried out with polyclonal anti-STAT1-YP and monoclonal anti-STAT3-YP antibodies (Upstate Biotechnology, Inc., Lake Placid, NY; 06-657 and 05-485, respectively), in blocking buffer for 16 h at 4 C. Anti-IgG conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was incubated with the membrane in blocking buffer for 1 h at room temperature, and detection was accomplished using enhanced chemiluminescence (ECL reagent, Amersham Pharmacia Biotech, Arlington Heights, IL). Before reprobing, the membrane was stripped in 0.2% sodium dodecyl sulfate, 0.1 M NaCl, and 0.1 M glycine/HCl (pH 2) for 1 h at room temperature and equilibrated in Tris-buffered saline containing 0.05% Tween 20. STAT1 and STAT3 detection was carried out with polyclonal anti-STAT1 or anti-STAT3 antibodies (G16920, Transduction Laboratories, Inc., Lexington, KY; STAT3-H190, Santa Cruz Biotechnology, Inc., respectively). Full Range Rainbow Markers (Amersham Pharmacia Biotech) were used to determine the molecular weights of proteins.
EMSA
STAT3 (H-190) and STAT1 (C-111) antibodies (Santa Cruz Biotechnology, Inc.) were incubated for 1 h on ice with 5 µg nuclear extracts from control or LIF-treated AtT-20 cells (20 min at 1 nM). This mixture or nuclear extracts alone were incubated in binding buffer containing 10 mM Tris (pH 7.4), 50 mM NaCl, 1 mM EDTA, 5 mM MgCl2, 5% glycerol with 5 fmol 32P-labeled Sis-inducible element (SIE)m67 probe, 2 µg poly(dI-dC), and 10 µg BSA for 30 min at 4 C. The protein-DNA complexes were analyzed by electrophoresis on 4% polyacrylamide gel in 0.25x TBE (Tris borate and EDTA) and visualized by autoradiography.
Biotinylated oligonucleotide-streptavidin affinity system
STAT1 and -3 binding to the potential POMC promoter-binding sites or to the specific STAT1 and -3 binding sequence, SIEm67 (31), was carried out using the biotin-streptavidin affinity system. The following 3' biotinylated DNA oligonucleotides were used: SIE-m67, CATTTCCCGTAAATC (hereafter called SIE); SIE-m67mut, CATcctCCGcggATC (hereafter called SIEmut); AP-1, GCAGTGACTAAGAGA; POMC -79/-65, CGCTGCCAGGAAGGT; POMC -120/-106, CCCTTCGCGTGGCCG; POMC -190/-175, CACTTTCCAGGCACA; POMC -390/-376 (also called STAT site), AAATGCCAGGAAGGC; POMC -402/-387, ATATTTACCTCCAAATG; POMC -407/-376 NurRE-STAT, TAGTGATATTTACCTCCAAATGCCAGGAAGGC; POMC-407/-376 NurRE-STATmut1, TAGTGATATTTACCTCCAAAcGCCAGcggGGC; and POMC -407/-376 NurRE-STATmut2, TAGTGATATTTACCTCCAAAcGCCAGGAAGGC.
After annealing, biotinylated oligonucleotides (1 µg) were incubated with precleared nuclear extracts (0.51 mg) derived from AtT-20 cells treated or not with LIF (1 nM) for 20 min and 100 µl streptavidin-agarose (Pierce Chemical Co., Rockford, IL) in a 2-ml volume of incubation buffer containing 10 mM Tris (pH 7.4), 50 mM NaCl, 5% glycerol, 1 mM EDTA, 5 mM MgCl2, 1 µg BSA, 20 µg poly(dI-dC), 5 µg/ml antipain, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 mM vanadate. Incubation was carried out on a rotating wheel for 2 h at 4 C. The proteins were eluted from the resin with Laemmli buffer, resolved on SDS-PAGE, and examined for the presence of STAT1-YP or STAT3-YP proteins by immunoblotting with the respective specific antibodies (Upstate Biotechnology, Inc.; 06-657 and 05-485).
| Results |
|---|
|
|
|---|
(91 kDa) and STAT1ß (84 kDa) isoforms, almost absent without LIF, was observed 15 min after LIF addition in cytoplasmic and nuclear extracts. It progressively declined but was still present after 1 h.
|
LIF induces dimerization and DNA-binding of STAT1/3
To investigate the relative level of DNA binding of STAT1 and -3 homo- and heterodimers, the labeled oligonucleotide corresponding to a mutant of the SIE of the c-Fos promoter (31) has been used as an EMSA probe with AtT-20 nuclear proteins before and after LIF stimulation. Three distinct complexes of different mobilities were observed after LIF treatment (Fig. 2
). When specific anti-STAT1 and -3 antibodies were included, the selective depletion and/or supershift of individual LIF-induced STAT complexes allowed the identification of STAT1/1, STAT1/3, and STAT3/3 dimers, indicating that the classical homo- and heterodimers are formed also in AtT-20 cells. After LIF stimulation, the most abundant SIE-binding dimer was STAT3/3, followed by STAT1/3 and STAT1/1 dimers. In control cells, only low levels of STAT3/3 homodimers were detectable. An excess of unlabeled SIE efficiently competed the STAT dimer interaction with the labeled probe, whereas an excess of unlabeled Sp1 oligonucleotide did not compete (data not show).
|
|
Identification of LIF-responsive regions on the POMC promoter
To determine whether more than one LIF-responsive subregion exist on the POMC promoter, the activities of the three already functionally defined POMC promoter domains (3), individually or in combination, and the activities of some subregions fused to the minimal POMC promoter and the luciferase reporter gene in the pGL3-luciferase+ vector, were tested after transient transfection into AtT-20 cells. The basal activities of each fragment, compared with that of the minimal POMC promoter -34/+63, which contains the TATA box and part of the exon 1 and is unresponsive to LIF, displayed enhancement factors reported in Table 1
.
|
2-fold) were obtained with the proximal domain or its 5' subregion (-166/-96), whereas the 3' subregion -96/-34 was unable to mediate LIF-dependent activation. Therefore, the LIF-inducible proximal domain can be reduced to the -166/-96 segment. Interestingly, the potential site -79/-65 and the half-sites contained in the fragment -166/-96 were unable to bind STAT1 and -3. It is noteworthy that the statistical significance of the enhancement factors of each promoter fragment in control conditions (Table 1
|
The STAT site AAATGCCAGGAAGGC -387/-379 confers LIF responsiveness
To investigate the relative importance of the two degenerated STAT sites, -402/-387 and -390/-376, overlapping in part the NurRE, to LIF responsiveness, the (NurRE)x3, the(NurRE-STAT)x3 and the (NurRE-STATmut)x3 constructs (see Fig. 5
) were tested (7, 9). Figure 5A
shows that the (NurRE)x3 reporter, sufficient to respond to CRH (9), was not induced by LIF and the high LIF responsiveness of (NurRE-STAT)x3 was abolished by mutations in the -387/-379 STAT site. Thus, concerning the NurRE-STAT sequence, the stimulatory effect of LIF on POMC transcription requires the integrity of the proximal STAT site -387/-379, the only site displaying specific STAT1 and -3 binding properties.
To study this STAT site in a larger POMC promoter context, we introduced into the -414/-293 fragment, shown to be sufficient for LIF response, the same mutations as in the (NurRE-STATmut)x3 (Fig. 4B
). The mutations significantly reduced the LIF responsiveness, confirming the crucial role of the -387/-379 site as a direct target in the POMC promoter of the LIF signaling pathway (Fig. 5B
).
In conclusion, we have identified in the POMC promoter a single site sufficient for direct interaction with activated STAT1 and STAT3, responsible for LIF-dependent activation of the POMC promoter fragment -412/-293 and the repeated NurRE-STAT element.
| Discussion |
|---|
|
|
|---|
can induce a 2-fold increase within 24 h of POMC gene transcription in AtT-20 cells, whereas interferon-
and -
have an acute stimulatory effect (4 h); moreover, all of these cytokines synergize with CRH (35). LIF, an IL-6 family-related cytokine, induces a similar increase in POMC gene expression and synergizes with CRH (18, 26). Here, the maximal effect on POMC promoter activity in AtT-20 cells was rapid and transient, being observed 26 h after LIF treatment, consistent with a signaling pathway that does not require protein neosynthesis but, rather, uses activation of preexisting proteins. The main Jak-STAT1/3 pathway is also activated by LIF in AtT-20 cells via the induction of specific tyrosine phosphorylation on latent STAT transcription factors (16, 28, 29). Here we show that the kinetics of tyrosine phosphorylation of STAT1 and STAT3 are both rapid and transient; the phosphorylation of STAT1 is present up to 60 min. Moreover, the most abundant SIE-binding dimers after 15 min of LIF stimulation are the STAT3/3 and STAT1/3 dimers, in agreement with the previous finding that STAT3 dominant negative mutants blunt in large part the LIF response in AtT-20 cells (28). Whether the more sustained tyrosine phosphorylation of STAT1, compared with that of STAT3, plays some role in the LIF or LIF plus CRH synergistic effect (26) remains to be determined. Indeed, STAT1 may participate in new interactions between CREB binding protein (CBP/p300) and transcription factors induced by CRH.
Two distinct subregions were shown here to confer LIF-dependent induction to the minimal POMC promoter; thus, the induction of the whole promoter may result from their additivity. The proximal LIF-inducible subregion, which does not contain STAT1- and STAT3-binding sites and was not previously delimited (29), is constituted by the 5' part of the already defined proximal POMC promoter domain (3) and displays its activity independently of the most proximal region. In this inducible subregion, we did not find, using the sensitive biotinylated oligonucleotide technique, direct binding of STAT1 and -3 to DNA sequences. Because STAT3 dominant negative mutants abrogate in large part the LIF response of the -480/+63 POMC promoter (28), we propose that in the proximal LIF-responsive subregion, activated STAT1 and -3 act as coactivators of basal transcription factors that remain to be identified. Although this mechanism has been proposed for STAT-dependent activation of transcription mediated by a non-STAT DNA-binding site (36), no example of a target gene is known. Such a possibility is the reversal of what has been shown concerning the induction by glucocorticoids and PRL of the ß-casein promoter, where activated non-DNA-bound glucocorticoid receptor displays positive interference with STAT5 bound to DNA (37). It is not known whether transcription factors bound to the proximal subregion in basal conditions may also play a role in the LIF response. Indeed, in this region nuclear proteins from AtT-20 cells interact with an Sp1-like site participating in the basal activity of the promoter (3). It has been reported that STAT1 and Sp1 interact and cooperate on the intracellular adhesion molecule 1 promoter after interferon-
stimulation (38); moreover, a physical interaction between the two proteins has been found independently of the presence of their DNA-binding sites (39). It can be proposed that LIF-activated STAT1 and -3 dimers positively interfere with an Sp1-like factor bound to the proximal LIF-responsive subregion via physical interaction. In addition, in this proximal subregion it is not excluded that LIF may modulate the activity of preexisting transcription factors by inducing STAT-dependent secondary pathways (e.g. MAPK) (40, 41).
On the basis of our observation that both distal and central-distal POMC (not shown) promoter domains were positively regulated by LIF, we have defined here a new promoter subregion -414/-293 conferring LIF responsiveness and containing essential sites for POMC expression. Indeed, this subregion contains the major regulatory sites responsible for the corticotroph-specific expression of the POMC as well as the major site, NurRE, involved in CRH induction and glucocorticoid repression of POMC expression (7). It has also been proposed that two contiguous degenerated low affinity STAT3-binding sites, partially overlapping the NurRE, are cooperatively responsible for the LIF-dependent activation of the POMC (29). However, our results on binding of activated STAT1 and -3 to biotinylated oligonucleotides revealed that only one low affinity STAT1/3-binding site, -390/-376, exists in the -480/+63 promoter. The mutation of this site abrogates STAT1 and -3 binding either in the context of the STAT site alone (not shown) or the NurRE-STAT site. In agreement with this finding, the LIF response of the (NurRE-STAT)x3 or -414/-293 luciferase reporters was abrogated after mutation of the same STAT site, demonstrating that STAT binding to this site is required for LIF responsiveness.
We present evidence that LIF regulates POMC gene expression by two different mechanisms, mediated by different promoter subregions that are functionally autonomous. The distal subregion uses the direct binding of activated STAT1 and -3 to their own unique low affinity DNA site partially overlapping the NurRE. Whether basal binding of Nur proteins to NurRE plays a role in the LIF response remains to be determined. The second mechanism at the level of the proximal subregion remains more elusive. The lack of direct STAT1 and -3 DNA binding to the proximal subregion suggests that activated STAT, via positive interference with transcription factors already bound to their regulatory sequences, such as Sp1-like proteins (3), may indirectly activate a transcriptional response.
Whether other protein-protein interactions between DNA-bound transcription factors and coactivators/cointegrators such as CBP/p300 take also place in the two LIF-dependent subregions described here remains to be determined. Further studies will focus on the relative contribution of each LIF-responsive subregion in the context of the synergistic effect of LIF and CRH on the POMC promoter (26) as well as on cross-talk between activated STAT1 and -3 and transcription factors participating in basal corticotroph-specific POMC expression. In addition, it is of interest to determine whether LIF regulates the human POMC promoter at least in part via direct STAT-DNA binding, as the region corresponding to the rat -390/-376 STAT site here identified does not contain the same STAT sequence and binds E2F in human POMC-expressing tumoral cells (42, 43).
| Acknowledgments |
|---|
| Footnotes |
|---|
1 Fellow of Ministère de la Recherche et de la Technologie. ![]()
Abbreviations: AP-1, Activating protein 1; CBP, CREB-binding protein; CREB, cAMP response element-binding protein; Jak, Janus tyrosine kinase; LIF, leukemia inhibitory factor; LIFR, LIF receptor; NBRE, Nur77-binding response element; NurRE, Nur response element; POMC, proopiomelanocortin; SIE, Sis-inducible element; STAT, signal transducer and activator of transcription.
Received March 20, 2002.
Accepted for publication June 14, 2002.
| References |
|---|
|
|
|---|
gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol 18:21082117This article has been cited by other articles:
![]() |
M. Labeur, D. Refojo, B. Wolfel, J. Stalla, V. Vargas, M. Theodoropoulou, M. Buchfelder, M. Paez-Pereda, E. Arzt, and G. K Stalla Interferon-{gamma} inhibits cellular proliferation and ACTH production in corticotroph tumor cells through a novel janus kinases-signal transducer and activator of transcription 1/nuclear factor-kappa B inhibitory signaling pathway J. Endocrinol., November 1, 2008; 199(2): 177 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. F. Bumaschny, F. S. J. de Souza, R. A. Lopez Leal, A. M. Santangelo, M. Baetscher, D. H. Levi, M. J. Low, and M. Rubinstein Transcriptional Regulation of Pituitary POMC Is Conserved at the Vertebrate Extremes Despite Great Promoter Sequence Divergence Mol. Endocrinol., November 1, 2007; 21(11): 2738 - 2749. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Latchoumanin, V. Mynard, J. Devin-Leclerc, M.-A. Dugue, X. Bertagna, and M. G. Catelli Reversal of Glucocorticoids-Dependent Proopiomelanocortin Gene Inhibition by Leukemia Inhibitory Factor Endocrinology, January 1, 2007; 148(1): 422 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Mynard, O. Latchoumanin, L. Guignat, J. Devin-Leclerc, X. Bertagna, B. Barre, J. Fagart, O. Coqueret, and M. G. Catelli Synergistic Signaling by Corticotropin-Releasing Hormone and Leukemia Inhibitory Factor Bridged by Phosphorylated 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein at the Nur Response Element (NurRE)-Signal Transducers and Activators of Transcription (STAT) Element of the Proopiomelanocortin Promoter Mol. Endocrinol., December 1, 2004; 18(12): 2997 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Abbud, R. Kelleher, and S. Melmed Cell-Specific Pituitary Gene Expression Profiles after Treatment with Leukemia Inhibitory Factor Reveal Novel Modulators for Proopiomelanocortin Expression Endocrinology, February 1, 2004; 145(2): 867 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kariagina, D. Romanenko, S.-G. Ren, and V. Chesnokova Hypothalamic-Pituitary Cytokine Network Endocrinology, January 1, 2004; 145(1): 104 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Auernhammer, N. B. Isele, F. B. Kopp, G. Spoettl, N. Cengic, M. M. Weber, G. Senaldi, and D. Engelhardt Novel Neurotrophin-1/B Cell-Stimulating Factor-3 (Cardiotrophin-Like Cytokine) Stimulates Corticotroph Function via a Signal Transducer and Activator of Transcription-Dependent Mechanism Negatively Regulated by Suppressor of Cytokine Signaling-3 Endocrinology, April 1, 2003; 144(4): 1202 - 1210. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |