help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winters, S. J.
Right arrow Articles by Plant, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Winters, S. J.
Right arrow Articles by Plant, T. M.
Endocrinology Vol. 142, No. 7 2874-2878
Copyright © 2001 by The Endocrine Society

ARTICLES

Pituitary Follistatin and Activin Gene Expression, and the Testicular Regulation of FSH in the Adult Rhesus Monkey (Macaca mulatta)1

Stephen J. Winters, Satoru Kawakami2, Abhiram Sahu and Tony M. Plant

Departments of Medicine (S.J.W., S.K.) and Cell Biology and Physiology (A.S., T.M.P.), University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; and Departments of Medicine, Biochemistry, and Molecular Biology, University of Louisville School of Medicine (S.J.W.), Louisville, Kentucky 40202

Address all correspondence and requests for reprints to: Dr. Tony M. Plant, Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, 828A Scaife Hall, Pittsburgh, Pennsylvania 15261. E-mail: plant1+{at}pitt.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In rats, FSHß gene expression and FSH secretion are increased and decreased, respectively, by pituitary activin and follistatin. Because little information is available on the paracrine control of FSH secretion in the primate, follistatin and activin/inhibin ßB messenger RNA (mRNA) levels were measured in pituitaries of adult male rhesus monkeys 6 weeks after castration or sham surgery (n = 5/group). Follistatin mRNA was determined by quantitative RT-PCR assay using oligonucleotide primers designed to span exons 3–5 of the human follistatin gene. Activin/inhibin ßB mRNA levels were measured by ribonuclease protection. Orchidectomy resulted in a 100-fold increase in plasma FSH concentrations and a 60-fold rise in those of LH. In castrated monkeys, levels of mRNA encoding FSHß, LHß, {alpha}- subunit, and GnRH receptor (GnRH-R) were increased 21-, 2.1-, 1.7-, and 1.7-fold, respectively (P < 0.01). Levels of pituitary follistatin and activin/inhibin ßB mRNAs, however, were similar in castrated and intact animals. These data suggest that the paracrine control of FSH secretion in the male differs substantially in primates and rodents. Specifically, the relatively greater postcastration rise in FSHß gene expression and FSH secretion in the adult male monkey may result because in this species pituitary follistatin gene expression does not increase after orchidectomy, as it does in the rat.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CIRCULATING FSH and LH levels increase when the testes are removed, because plasma testosterone, estradiol, and inhibin B levels plummet, and negative feedback is disrupted. Interestingly, the magnitude of the rise in circulating FSH concentrations after postpubertal orchidectomy varies substantially among species; for example, in rats (1, 2) and mice (3, 4), plasma FSH levels increase 1- to 4-fold, whereas in rhesus monkeys circulating FSH levels increase approximately 50-fold (5, 6). These castration-associated increases in circulating FSH concentrations are paralleled by proportionate increments in pituitary FSHß messenger RNA (mRNA) levels. Thus, in rats (7, 8) and mice (3, 4) orchidectomy leads to approximately 2- to 4-fold higher FSHß mRNA levels, whereas in the monkey pituitary FSHß mRNA is increased up to 40-fold after castration (6). These relationships suggest that species differences in the control of FSHß gene expression are responsible at least in part for species differences in the FSH secretory response to orchidectomy.

We proposed previously that the exaggerated postcastration rise in circulating FSH concentrations and FSHß mRNA levels in the adult male monkey resulted from a major contribution of testicular inhibin to the negative feedback regulation of FSH secretion in this species (9). That hypothesis was based on the observations that in adult male monkeys (9), but not adult male rats (10, 11), immunoneutralization of circulating inhibin increased FSH secretion, and that immunoactive levels of circulating testicular inhibin in adult rats were relatively low (11). It is now known, however, that circulating levels of inhibin B, the major form of testicular inhibin (12, 13, 14, 15), are similar in adult male rats (14, 15) and monkeys (13, 16). Thus, other factors may contribute to the species difference in the testicular regulation of FSHß gene expression.

In this regard, FSHß mRNA levels in rats are selectively regulated by peptide hormones produced in the pituitary, most notably activin (17) and follistatin (FS) (17, 18, 19), which increase and decrease FSHß gene expression, respectively. Whereas activin/inhibin ßB mRNA levels appear to be unchanged after orchidectomy in rats (20), longitudinal studies reveal that FS mRNA levels rise progressively to reach values 20-fold higher than those of intact males by 21 days postorchidectomy (21). Therefore, it is possible that the major increase in FS gene expression after orchidectomy in the rat may underlie the dynamics of the corresponding changes in FSHß mRNA levels, which increase 2- to 3-fold to reach peak values at 7 days postcastration, but decline thereafter to approach intact control values by week 4 (7).

If this idea is correct, then it is reasonable to propose that the FS response after orchidectomy in adulthood may be less robust in the monkey than in the rat. To test this hypothesis, FS mRNA levels were measured in the pituitary glands of adult male rhesus monkeys 6 weeks after castration or sham surgery. Prior limited experiments suggested that pituitary activin/inhibin ßB mRNA may be reduced by orchidectomy in the monkey (6). To substantiate these earlier results, activin/inhibin ßB mRNA levels were also determined in the present study. Finally, because there is no published information on pituitary GnRH receptor (GnRH-R) expression after removal of the testes in primates, GnRH-R mRNA was also studied. The animals described herein were also used to examine the influence of castration on hypothalamic GnRH gene expression, as reported previously (22).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Ten adult male (age, 8–16 yr; 10–15 kg BW) rhesus monkeys (Macaca mulatta) were used in this study according to a protocol previously described (22) and approved by the University of Pittsburgh institutional animal care and use committee. In brief, blood samples were collected by femoral venipuncture while monkeys were sedated with ketamine hydrochloride. Five animals were bilaterally orchidectomized, and five others were subjected to sham surgery under sodium pentobarbital anesthesia. On day 41, animals were deeply anesthetized with sodium pentobarbital, and a craniotomy was performed to remove the pituitary gland postmortem. The anterior pituitary was separated from the neural lobe and frozen at -70 C.

RNA preparation
Total RNA was prepared using RNAzol, followed by precipitation with isopropanol, washing with ethanol, and solubilization in diethylpyrocarbonate-treated water. RNA integrity was verified by visualizing ethidium bromide-stained 28S and 18S ribosomal RNA fractionated on agarose gels, and the amount of RNA was determined by measuring the OD at 260 nm. Aliquots of the same RNA preparations were used for Northern analysis, quantitative RT-PCR, and ribonuclease (RNase) protection assays.

FS mRNA
Total FS mRNA levels (FS315 + FS288) were determined with a quantitative RT-PCR assay using a synthesized competitive template (CT) RNA (23). A nonrelated sequence was introduced into the midregion of CT by the recombinant PCR procedure to distinguish its PCR product from the native sequence product after gel electrophoresis.

For the quantitative RT-PCR assay, a constant amount of sample RNA (~800 ng) was combined with decreasing amounts of the CT RNA (32,000, 4,000, 500, and 62.5 fg) and amplified using the Titan One Tube RT-PCR System using the following primers: sense, GGAAGCTTTGGAAGTCCAGTACCAAGGC; antisense, ATCCAATAGATCTG-CCCAGC. The underlined sequence represents the HindIII restriction site. An aliquot of each RT-PCR product was fractionated on a 1.5% MetaPhor agarose gel. The OD of the bands was corrected for differences in length (base pairs) between the native and CT RNA-derived PCR products, that is 241/284 = 0.849. The percentage of native product in each RT-PCR reaction was determined using the following equation: %Native = ODNative/(ODCT x 0.849 + ODNative) x 100. A regression line with the equation: y = A x log10 (x) + B was generated for each set of four RT-PCR reactions by plotting the %Native vs. the log10 CT (fg/reaction). When this equation is solved for y = 0.5 (half the DNA was the native product), x is equal to the amount of native mRNA in the sample. RNA from monkey adrenal, thyroid, and ovary was run as positive controls.

Activin/inhibin ßB mRNA
Activin/inhibin ßB mRNA levels were measured by RNase protection assay using procedures described previously (24). The human ßB- inhibin complementary DNA (cDNA), a 627-bp BamHI/EcoRI fragment (Genentech, Inc., South San Francisco, CA) was subcloned into pGEM3Z, and a 116-bp rat cyclophilin cDNA (Dr. J. L. Roberts, Mount Sinai Medical Center, New York, NY) was subcloned into pGEM3Z. The vectors were linearized with HindIII, and the antisense riboprobes were synthesized with T7 RNA polymerase. Pituitary RNA (15 µg) and 32P-labeled activin/inhibin ßB (300,000 cpm) and cyclophilin (15,000 cpm) were allowed to hybridize in solution overnight at 45 C. RNA was then digested with 40 µg/ml RNase A and 2 µg/ml RNase T1 for 1 h at 32 C. Protected hybrids were extracted with phenol/chloroform, precipitated with ethanol, denatured, and subjected to electrophoresis on 6% polyacrylamide-8 M urea gels. The image of each gel was acquired by a GS 525 Molecular Imager (Bio-Rad Laboratories, Inc., Hercules, CA), and volume analysis of each band was performed using Molecular Analyst software (Bio-Rad Laboratories, Inc.). The intensity of the activin/inhibin ßB band was normalized to that of the cyclophilin band in the same sample.

Gonadotropin subunit mRNAs
Gonadotropin subunit gene expression was studied by Northern analysis using cynomolgus monkey cDNA probes from Drs. Christie Kelton and Scott Chappel as described previously (6). Aliquots (10 µg) of total RNA were subjected to electrophoresis in 1.2% agarose-formaldehyde gels. cDNA inserts were cloned into the PstI site of pBR322. Purified cDNA inserts were labeled by the random primer method with [{alpha}-32P]deoxy-CTP (~3000 Ci/mmol; NEN Life Science Products, Boston, MA) to a specific activity of 9.1–16.8 x 108 cpm/µg. Labeled probes were added to the hybridization solutions at a concentration of approximately 5 ng/ml for 48–72 h. Membranes were rehybridized without stripping to a cDNA for rat cyclophilin (from Dr. James Douglass, Research Institute of Scripps Clinic, La Jolla, CA) to correct for differences in total RNA loaded onto the gel and to monitor transfer efficiency.

GnRH-R mRNA
GnRH-R mRNA levels were determined by rehybridizing the membrane used to measure the gonadotropin subunit mRNAs to a human GnRH-R RNA probe synthesized using the MAXIscript In Vitro Transcription Kits (Ambion, Inc., Austin, TX). The template cDNA for the human GnRH-R was a gift from Dr. S. C. Sealfon (Mount Sinai Medical Center). The GnRH-R signal was expressed relative to the previously established cyclophilin mRNA levels.

Data analysis
Results are presented as the mean ± SEM. Differences between mean values in intact and castrated animals were analyzed using Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
FS mRNA was detectable in the pituitary of the male monkey with the sensitive RT-PCR-based assay (Fig. 1Go). In pituitaries from both the intact and castrate monkeys, the major transcript (460 bp) corresponded to FS-315, with a weak band corresponding to FS-288 (729 bp). When total pituitary FS mRNA levels (FS315 + FS288) were determined, no effect of castration was found (Fig. 1Go).



View larger version (46K):
[in this window]
[in a new window]
  		Figure 1. Top, FS mRNA expression in monkey anterior pituitary and other tissues. One microgram of total RNA was reverse transcribed, and the RT products were amplified by 27 cycles of PCR. PCR products were subjected to electrophoresis on a 2% MetaPhor agarose gel stained with ethidium bromide. Arrows and arrowheads indicate RT-PCR products corresponding to FS-315 (460 bp) and FS-288 (729 bp), respectively. Lane 1, 100-bp DNA ladder; lane 2, anterior pituitary from an intact male monkey; lane 3, anterior pituitary from a castrate male monkey; lane 4, thyroid from intact male; lane 5, adrenal from intact male; lane 6, ovary. Similar results were observed using RNA samples from other animals. Bottom, Mean FS mRNA levels in the anterior pituitary from intact and orchidectomized adult monkeys (n = 5/group). Error bars represent the SEM.

 
Figure 2Go is an image of the RNase protection gel, in which total pituitary RNA was hybridized to activin/inhibin ßB and cyclophilin riboprobes. When the intensity of the inhibin/activin ßB protected fragment was normalized to the cyclophilin mRNA hybrid, no difference was found between mRNA levels in the pituitary glands from intact and orchidectomized monkeys (Fig. 2Go).



View larger version (50K):
[in this window]
[in a new window]
  		Figure 2. Effects of castration on activin/inhibin ßB mRNA levels in the anterior pituitary of adult male rhesus monkeys. The gel was exposed in a Bio-Rad Laboratories, Inc., CS molecular imaging screen for 45 h. The intensity of the inhibin/activin ßB band was normalized to the intensity of the cyclophilin band for the same sample. The bar graph summarizes the results from five animals per group. Error bars represent the SEM.

 
Northern analysis of GnRH-R mRNA levels revealed that a 5 kb sequence was most abundant in all samples, but at least four additional mRNA species were detected (Fig. 3Go). Orchidectomy produced a 1.7-fold increase in the 5-kb mRNA (P < 0.01), and all transcripts appeared to increase similarly with castration (Fig. 3Go).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 3. Northern blot analysis of GnRH-R mRNA in the anterior pituitary glands of intact and orchidectomized adult monkeys. Each lane represents 10 µg total RNA, and the autoradiogram was exposed for 17 h. The lower panel shows the quantitation of the 5-kb mRNA. *, P < 0.01. Error bars represent the SEM.

 
As reported previously (22), bilateral orchidectomy resulted in a 100-fold increase in plasma concentrations of FSH and a 60-fold rise in those of LH compared with values in sham-castrated monkeys (Table 1Go). Pituitary gonadotropin subunit mRNA levels also increased after orchidectomy (P < 0.01), but the magnitude of the change in expression of the various genes was strikingly dissimilar. As shown in Fig. 4Go, FSHß mRNA levels were 21-fold higher in orchidectomized than in intact males, whereas LHß and {alpha}-subunit mRNA levels increased only 2.1- and 1.7-fold, respectively.


View this table:
[in this window]
[in a new window]
  		Table 1. Plasma FSH and LH levels in intact and orchidectomized adult monkeys

 


View larger version (20K):
[in this window]
[in a new window]
  		Figure 4. Gonadotropin subunit mRNA levels in the anterior pituitary glands of intact and castrated adult male rhesus monkeys (n = 5/group). *, P < 0.01. Error bars represent the SEM.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The results of this study are consistent with the hypothesis that species differences in the postcastration rise in FSHß gene expression and FSH secretion in adult males result at least in part from corresponding differences in the paracrine regulation of FSHß gene expression by pituitary FS. According to this idea, in adult rats FS mRNA levels rise progressively after orchidectomy (21) and thereby limit the increase in FSHß mRNA levels and FSH secretion. On the other hand, in the male monkey there is no postcastration increase in FS mRNA, thereby permitting FSHß gene expression and FSH secretion to increase markedly when testicular negative feedback by inhibin B is disrupted by orchidectomy. Although the change in FS gene expression observed in the present study was unremarkable, the concomitant changes in the expression of the peptide have yet to be confirmed. FS, presumably inhibits FSHß gene expression either by binding to and neutralizing the action of activin on the gonadotroph (25) or through a direct effect (26).

What accounts for the species difference in pituitary FS gene expression after orchidectomy? Although all pituitary cell types in the rat seem to express FS (27), indirect evidence implicates the gonadotrophs as the major source of FS in this species. First, pituitary FS mRNA levels are increased by GnRH and activin and are decreased by inhibin and testosterone (28). Second, the postcastration rise in FS gene expression in male rats may be blocked by treatment with a GnRH-R antagonist (20). On the other hand, in the monkey, studies of primary pituitary cell cultures indicate that folliculo-stellate cells are the major source of FS mRNA (29), and in the human, FS protein has been detected only in somatotrophs (30). Therefore, limited expression of FS in the primate gonadotrophs might explain the lack of a robust increase in FS mRNA after orchidectomy.

Although earlier data obtained in two monkeys suggested that activin/inhibin ßB mRNA levels may be reduced by orchidectomy (6), in the present study, with five monkeys in each experimental group, values were similar in intact and orchidectomized animals. Thus, we conclude that, as in rats (20), a change in activin B is not directly involved in mediating the testicular regulation in FSHß gene expression and FSH secretion in primates. It is to be noted, however, that ovariectomy in the rat elicits an increase in pituitary activin/inhibin ßB mRNA levels (20). The situation in the female primate has not been examined.

The present findings indicate that the postcastration rise in FSHß mRNA expression is comparable in magnitude to the increase in circulating FSH concentrations, whereas plasma LH levels rise disproportionately relative to the increase in LHß mRNA. This finding also holds for rodents (31, 32). These relationships imply that the secretion of FSH may be more dependent on transcription than that of LH and may explain the larger fraction of FSH that is released between episodes of gonadotropin secretion from rat pituitary cells in response to pulses of GnRH (33) and from the in situ pituitary in ovariectomized ewes (34). It should be noted, however, that in our earlier study (6) a discordance between plasma LH concentrations and LHß mRNA levels was not observed. In that study the pituitaries from intact animals were removed in the course of transphenoidal hypophysectomy, whereas those from castrates were harvested rapidly after craniotomy. In addition, plasma LH concentrations were measured with a heterologous assay. Therefore, experimental design may be responsible for the differing results of the two studies. The relatively small percent rise in pituitary {alpha}-subunit mRNA levels that followed orchidectomy in this and the earlier study is likely to reflect in part the additional expression of {alpha}-subunit in thyrotrophs, which would not be expected to change after orchidectomy.

Multiple GnRH-R mRNAs were found in the pituitary of the male monkey, as has previously been described for man (35) and other species (36, 37, 38). Southern blotting indicates the existence of a single human GnRH-R gene (35), and analysis by PCR suggests that individual transcripts contain a full-length coding sequence and result from either different transcription start sites or alternate splicing due to multiple polyadenylation signals at the 3'-end of the gene (37, 39). The 5-kb form was most abundant in the monkey, and all forms were increased after castration. Whether the postcastration increase in GnRH-R transcripts in the pituitary of the male monkey results from enhanced GnRH secretion, as in rats (40), and whether activin is necessary for such an action of GnRH (41) will require further study.

In summary, these results reinforce the view that the paracrine regulation of FSHß gene expression and FSH secretion is different in primates and rats. In the male monkey, neither activin/inhibin ßB nor FS mRNA appears to be under testicular control; therefore, the role of these paracrine factors in the feedback control of FSH in the male primate is likely to be only permissive.


   Acknowledgments
 
The authors acknowledge the expert technical assistance provided by Ms. Joyce Szczepanski, Mr. Dushan Ghooray, and Mr. Robert L. Friedman. We thank the staff of the Primate and Assay Cores of the Center for Research in Reproductive Physiology, University of Pittsburgh. Immunoassay reagents were provided by Dr. A. F. Parlow and the National Hormone and Pituitary Program, NIDDK.


   Footnotes
 
1 This work was supported by NIH Grants HD-19546 and HD-36034 (to S.J.W.) and HD-08610 and HD-16851 (to T.M.P.). Back

2 Present address: Department of Urology and Reproductive Medicine, Graduate School, Tokyo Medical and Dental University, Yushima 1–5-45, Bunkyo-ku, Tokyo 113-8519, Japan. Back

Received December 11, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Swerdloff RS, Walsh PC, Jacobs HS, Odell WD 1971 Serum LH and FSH during sexual maturation in the male rat: effect of castration and cryptorchidism. Endocrinology 88:120–128[Medline]
  2. Negro-Vilar A, Ojeda SR, McCann SM 1973 Evidence for changes in sensitivity to testosterone negative feedback on gonadotropin release during sexual development in the male rat. Endocrinology 93:729–735[Medline]
  3. Kumar TR, Fairchild-Huntress V, Low MJ 1992 Gonadotrope-specific expression of the human follicle-stimulating hormone ß-subunit gene in pituitaries of transgenic mice. Mol Endocrinol 6:81–90[Abstract]
  4. Lindzey J, Wetsel WC, Couse JF, Stoker T, Cooper R, Korach KS 1998 Effects of castration and chronic steroid treatments on hypothalamic gonadotropin-releasing hormone content and pituitary gonadotropins in male wild-type and estrogen receptor-{alpha} knockout mice. Endocrinology 139:4092–4101[Abstract/Free Full Text]
  5. Plant TM, Hess DL, Hotchkiss J, Knobil E 1978 Testosterone and the control of gonadotropin secretion in the male rhesus monkey (Macaca mulatta). Endocrinology 103:535–541[Medline]
  6. Attardi B, Marshall GR, Zorub DS, Winters SJ, Miklos J, Plant TM 1992 Effects of orchidectomy on gonadotropin and inhibin subunit messenger ribonucleic acids in the pituitary of the rhesus monkey (Macaca mulatta). Endocrinology 130:1238–1244[Abstract]
  7. Gharib SD, Wierman ME, Badger TM, Chin WW 1987 Sex steroid hormone regulation of follicle-stimulating hormone subunit messenger ribonucleic acid (mRNA) levels in the rat. J Clin Invest 80:294–299
  8. Rodin DA, Abbot SD, Saade G, Clayton RN 1990 Comparison of the pretranslational regulation of FSH synthesis by gonadal steroids in rats and mice. J Mol Endocrinol 4:159–167[Abstract/Free Full Text]
  9. Medhamurthy R, Culler MD, Gay VL, Negro-Vilar A, Plant TM 1991 Evidence that inhibin plays a major role in the regulation follicle-stimulating hormone in the fully adult male rhesus monkey (Macaca mulatta). Endocrinology 129:389–395[Abstract]
  10. Culler MD, Negro-Vilar A 1988 Passive immunoneutralization of endogenous inhibin: sex-related differences in the role of inhibin during development. Mol Cell Endocrinol 58:263–273[CrossRef][Medline]
  11. Rivier C, Cajander S, Vaughan J, Hsueh AJW, Vale W 1988 Age-dependent changes in physiological action, content, and immunostaining of inhibin in male rats. Endocrinology 123:120–126[Abstract]
  12. Illingworth PJ, Groome NP, Byrd W, Rainey WE, McNeilly AS, Mather JP, Bremner WJ 1996 Inhibin-B: a likely candidate for the physiologically important form of inhibin in men. J Clin Endocrinol Metab 81:1321–1325[Abstract]
  13. Plant TM, Padmanabhan V, Ramaswamy S, McConnell DS, Winters SJ, Groome N, Midgley Jr AR, McNeilly AS 1997 Circulating concentrations of dimeric inhibin A and B in the male rhesus monkey (Macaca mulatta). J Clin Endocrinol Metab 82:2617–2621[Abstract/Free Full Text]
  14. Woodruff TK, Besecke LM, Groome NP, Draper LB, Schwatz NB, Weiss J 1993 Inhibin A and inhibin B are inversely correlated to follicle-stimulating hormone, yet are discordant during the follicular phase of the rat estrus cycle, and inhibin A is expressed in sexually dimorphic manner. Endocrinology 137:5463–5467[Abstract]
  15. Sharpe RM, Turner KJ, McKinnell C, Groome NP, Atanassova N, Millar MR, Buchanan DI, Occk PS 1999 Inhibin B levels in plasma of the male rat from birth to adulthood: effect of experimental manipulation of Sertoli cell number. J Androl 20:94–101[Abstract/Free Full Text]
  16. Winters SJ, Plant TM 1999 Partial characterization of circulating inhibin-B and pro-{alpha}C during development in the male rhesus monkey. Endocrinology 140:5497–5504[Abstract/Free Full Text]
  17. Corrigan AZ, Bilezikjian LM, Carroll RS, Bald LN, Schmelzer CH, Fendly BM, Mason AJ, Chin WW, Schwall RH, Vale W 1991 Evidence for an autocrine role of activin B within rat anterior pituitary cultures. Endocrinology 128:1682–1684[Abstract]
  18. Carroll RS, Corrigan AZ, Gharib SD, Vale W, Chin WW 1989 Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol 3:1969–1989[CrossRef][Medline]
  19. Inouye S, Guo Y, DePaolo L, Shimonaka M, Ling N 1991 Recombinant expression of human follistatin with 315 and 288 amino acids: chemical and biological comparison with native porcine follistatin. Endocrinology 129:815–822[Abstract]
  20. Dalkin AC, Haisenleder DJ, Gilrain JT, Aylor K, Yasin M, Marshall JC 1998 Regulation of pituitary follistatin and inhibin/activin subunit messenger ribonucleic acids (mRNAs) in male and female rats: evidence for inhibin regulation of follistatin mRNA in females. Endocrinology 139:2818–2823[Abstract/Free Full Text]
  21. Kaiser UB, Chin WW 1993 Regulation of follistatin messenger ribonucleic acid levels in the rat pituitary. J Clin Invest 91:2523–2531
  22. El Majdoubi M, Ramaswamy S, Sahu A, Plant TM 2000 Effects of orchidectomy on levels of the mRNAs encoding gonadotropin-releasing hormone and other hypothalamic peptides in the adult male rhesus monkey (Macaca mulatta). J Neuroendocrinol 12:167–176[CrossRef][Medline]
  23. Kawakami S, Fujii Y, Winters SJ 2001 Follistatin production by skin fibroblasts, and its regulation by dexamethasone. Mol Cell Endocrinol 172:157–167[CrossRef][Medline]
  24. El Majdoubi M, Sahu A, Plant TM 1998 Effect of estrogen on hypothalamic transforming growth factor {alpha} and gonadotropin-releasing hormone gene expression in the female rhesus monkey. Neuroendocrinol 67:228–35[CrossRef][Medline]
  25. Nakamura T, Takio K, Eto Y, Shibai H, Titani K, Sugino H 1990 Activin-binding protein from rat ovary is follistatin. Science 247:836–838[Abstract/Free Full Text]
  26. Hashimoto O, Nakamura T, Shoji T, Shimasaki S, Hayashi Y, Sugino H 1997 A novel role of follistatin, an activin-binding protein, in the inhibition of activin action in rat pituitary cells. J Biol Chem 272:13835–13842[Abstract/Free Full Text]
  27. Lee B, Unabia G, Childs G 1993 Expression of follistatin mRNA by somatotropes and mammotrophs early in the rat estrous cycle. J Histochem Cytochem 41:955–960[Abstract]
  28. Bilezikjian LM, Corrigan AZ, Bount AL, Vale WW 1996 Pituitary follistatin and inhibin subunit messenger ribonucleic acid levels are differentially regulated by local and hormonal factors. Endocrinology 137:4277–4284[Abstract]
  29. Kawakami S, Winters SJ Regulation of FSH and follistatin in cultured pituitary cells from adult male rhesus monkeys. 81st Annual Meeting of The Endocrine Society, San Diego, CA, 1999, p 283 (Abstract)
  30. Wada M, Shintani Y, Kosaka M, Sano T, Hizawa K, Saito S 1996 Immunohistochemical localization of activin A and follistatin in human tissues. Endocr J 43:375–385[Medline]
  31. Farnworth PG 1995 Gonadotropin secretion revisited. How many ways can FSH leave a gonadotroph. J Endocrinol 145:387–395[Abstract/Free Full Text]
  32. Winters SJ 1996 Relationship between gonadotropin subunit messenger ribonucleic acid levels and plasma gonadotropin concentrations in intact and orchidectomized adult rats. Biol Reprod 55:828–832[Abstract]
  33. Kitahara S, Winters SJ, Attardi A, Oshima H, Troen P 1990 Effects of castration on luteinizing hormone and follicle-stimulating hormone secretion by pituitary cells from male rats. Endocrinology 126:2642–2649[Abstract]
  34. Padmanabhan V, McFadden K, Mauger DT, Karsch FJ, Midgley Jr AR 1997 Neuroendocrine control of follicle-stimulating hormone (FSH) secretion. I. Direct evidence for separate episodic and basal components of FSH secretion. Endocrinology 138:424–432[Abstract/Free Full Text]
  35. Kakar SS 1997 Molecular structure of the human gonadotropin-releasing hormone receptor gene. Eur J Endocrinol 137:183–192[Abstract]
  36. Tustsmi M, Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan CA, Dong K, Gillo BM, Sealfon SC 1992 Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 6:1163–1169[Abstract]
  37. Kakar SS, Grantham K, Musgrove LC, Devor D, Sellers JC, Neill JD 1994 Rat gonadotropin-releasing hormone (GnRH) receptor: tissue expression and hormonal regulation of its mRNA. Mol Cell Endocrinol 101:151–157[CrossRef][Medline]
  38. Wu JC, Sealfon SC, Miller WL 1994 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134:1846–1850[Abstract]
  39. Zhou W, Sealfon SC 1994 Structure of the mouse gonadotropin-releasing hormone receptor gene: variant transcripts generated by alternate processing. DNA and Cell Biol 13:605–614[Medline]
  40. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1993 Regulation of rat pituitary gonadotropin-releasing hormone receptor mRNA levels in vivo and in vitro. Endocrinology 133:931–934[Abstract]
  41. Fernandez-Vazquez G, Kaiser U, Albarracin CT, Chin WW 1996 Transcriptional activation of the gonadotropin-releasing hormone receptor by activin. Mol Endocrinol 10:356–366[Abstract]



This article has been cited by other articles:


Home page
 J AndrolHome page
E. Prabagaran, U. C. Hegde, S. B. Moodbidri, A. H. Bandivdekar, and V. P. Raghavan
Postnatal Expression and Androgen Regulation of HOXBES2 Homeoprotein in Rat Epididymis
J Androl, September 1, 2007; 28(5): 755 - 771.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
L L Burger, D J Haisenleder, A C Dalkin, and J C Marshall
Regulation of gonadotropin subunit gene transcription
J. Mol. Endocrinol., December 1, 2004; 33(3): 559 - 584.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
R. R. Manjithaya and R. R. Dighe
The 3' Untranslated Region of Bovine Follicle-Stimulating Hormone {beta} Messenger RNA Downregulates Reporter Expression: Involvement of AU-Rich Elements and Transfactors
Biol Reprod, October 1, 2004; 71(4): 1158 - 1166.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
S. J Winters and J. P Moore
Intra-pituitary regulation of gonadotrophs in male rodents and primates
Reproduction, July 1, 2004; 128(1): 13 - 23.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Kawakami, Y. Fujii, Y. Okada, and S. J. Winters
Paracrine Regulation of FSH by Follistatin in Folliculostellate Cell-Enriched Primate Pituitary Cell Cultures
Endocrinology, June 1, 2002; 143(6): 2250 - 2258.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
T. M. Plant and G. R. Marshall
The Functional Significance of FSH in Spermatogenesis and the Control of Its Secretion in Male Primates
Endocr. Rev., December 1, 2001; 22(6): 764 - 786.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winters, S. J.
Right arrow Articles by Plant, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Winters, S. J.
Right arrow Articles by Plant, T. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals