| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Otolaryngology (K.D., L.W., R.A.S.) and Medicine (J.S.L., D.V.F.), Cancer Research Center, Boston University School of Medicine, Boston, Massachusetts 02118
Address all correspondence and requests for reprints to: Remco A. Spanjaard, Ph.D., Boston University School of Medicine, Cancer Research Center, 715 Albany Street R903, Boston, Massachusetts 02118. E-mail: rspan{at}bu.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We previously showed that RA slows growth and induces reversible differentiation of S91 melanoma cells, which is a complex process accompanied by various specific RAR-mediated changes in gene regulation (8). Unfortunately, however, many other melanoma cell lines, such as A375 cells, are completely resistant to the effects of RA (8, 9), and RA has been found to be a disappointing therapeutic for this disease, even in combination with interferon (10, 11). The lack of insight into the mechanism of RA resistance of melanoma cells greatly hampers efforts to improve clinical protocols that use this drug.
In this report we investigated which factor(s) determines RA responsiveness and RA resistance, and the molecular basis of RA resistance in melanoma cells using S91 and A375 cells as contrasting models of RA responsiveness and RA resistance, respectively. Our research shows that both RA-resistant and RA-responsive cells appear to express the major determinants of RA signaling pathways, suggesting that RA resistance in A375 cells is not due to genetic mutations, but, rather, that RAR activity is repressed through an epigenetic mechanism.
One such potential mechanism is increased intracellular oxidative stress, which has been shown to negatively regulate the activity of several different transcription factors (12). Indeed, we observed an inverse correlation between RAR activity and basal intracellular ROS levels in melanoma cells. RA-resistant melanoma cells could be resensitized to RA by lowering oxidative stress levels, which are probably mediated by redox-dependent DNA-binding activity of RXR/RAR heterodimers. Manipulation of the basal cellular redox state may provide a new strategy for hormone treatment of seemingly hormone-resistant tumors, which may have previously unrecognized physiological and clinical consequences.
| Materials and Methods |
|---|
|
|
|---|
Proliferation assay
Cell were seeded at 6500 (S91) or 2500 (A375) cells/well when
maintained under normoxic conditions or 7500 (A375) cells/well for
hypoxic culture conditions 24 h before treatment in triplicate in
96-well plates and treated for 5 days with dimethylsulfoxide or 1
µM RA under normoxia (S91 and A375) or hypoxia (A375
only). On day 5, relative viable cell numbers were determined using the
CellTiter 96 AQueous Nonradioactive Cell
Proliferation Assay Kit (Promega Corp., Madison, WI) at
A490 nM as previously
described (8).
Transient transfections, plasmids, and Luc assays
S91, B16, and A375 cells were transfected by electroporation as
previously described (13), C32 cells were transfected by
Lipofectamine Plus according to the manufacturers instructions
(Life Technologies, Inc., Grand Island, NY) and were left
overnight before being transferred to hypoxic or hyperoxic conditions
as needed. Luc assays and normalization of Luc activity by protein
concentration were performed as previously described (13).
Reporter plasmids p-mouse mammary tumor virus-luciferase
(14) (to determine GR-mediated activity) and
pRARE3Luc (13) (to determine
RAR-mediated activity) have been described; the latter contains three
repeats of the RARE sequence GTAGGGTTCACCGAAAGTTCAC. Plasmid
RARELuc
is identical to RARE3Luc, but it contains the
sequence AGTTACTTATTGCTGAGGTCAAGTTA instead of the RARE repeats.
Northern blot and Western blot analyses
Total RNA isolation, Northern blot procedures, and preparation
of 32P-labeled complementary DNA probes were
performed as previously described (8, 13). Preparation of
whole cell extracts, immunoblotting procedures, and detection by
chemiluminescence (Amersham Pharmacia Biotech, Piscataway,
NY) were performed as previously described (8). Antibodies
were obtained from Santa Cruz, except for anti-steroid receptor
coactivator 1 (SRC-1) (Affinity BioReagents, Inc., Golden, CO).
ROS determinations
Cells were plated at a density of 2 x
105/6 cm dish, left untreated for 24 h, then
harvested, washed in PBS, and resuspended in 5 µg/ml
2',7'-dichlorodihydrofluorescein diacetate (Molecular Probes, Inc., Eugene, OR) in HBSS. Samples were incubated for 15 min at
room temperature and analyzed immediately using a FACScan flow
cytometer.
Electrophoretic mobility shift assay (EMSA) conditions
In vitro translated RXR
and RARß were obtained
through the TnT Quick Coupled Transcription/Translation kit according
to the manufacturers protocol (Promega Corp.).
Preparation of 32P end-labeled ßRARE-containing
oligonucleotide and EMSA conditions were previously described
(13), except that dithiothreitol was omitted from the
binding buffer.
| Results and Discussion |
|---|
|
|
|---|
|
and RAR
and virtually no
RARß. In the presence of RA, S91 cells showed the expected strong
induction of RARß and weaker up-regulation of RAR
, whereas in A375
cells again no RA-dependent effect was detectable. This suggests that
the difference in RA responsiveness is not due to major defects in RAR
expression levels between the two lines.
However, a number of corepressor and coactivator proteins have been
identified recently that mediate RAR-dependent gene regulation
(15, 16), and we decided to examine expression levels of
some representative factors. Whole cell extracts were made from cells
grown for 24 h in the absence or presence of RA, and expression
was detected by Western blot analysis. As shown in Fig. 1C
, S91 and
A375 cells express about equal levels of RXR
, the coactivator SRC-1,
and the corepressors mSin3A and HDAC-1 in an RA-independent fashion.
p300 could also be detected, whereas RXRß expression was extremely
low or absent in both lines (data not shown). These findings indicate
that major components required for ligand-dependent productive
RAR-signaling are present in the RA-resistant A375 cells despite the
functional inactivity of the RARs. Transfection studies with vectors
expressing individual RXR and/or RAR isoform complementary DNAs did not
restore RA responsiveness in A375 cells, further arguing against the
possibility of inactivating mutations in the endogenous RARs of these
cells (data not shown).
Earlier reports showed that the functional activity of several
important transcription factors, such as activating protein-1, nuclear
factor-
B, and the estrogen receptor, is regulated by the cellular
redox state. Reducing conditions promote DNA binding and
transcriptional activity, whereas oxidizing conditions cause inhibition
(12, 17, 18, 19). If RAR activity could be regulated in a
similar fashion, differences in the oxidative stress levels between S91
and A375 cells might engender differences in responsiveness to RA. To
test this hypothesis, we determined basal ROS levels of untreated S91
and A375 cells, as well as RA-responsive B16 and C32 melanoma cells as
an indicator of the intracellular redox state. Normally grown cells
were harvested and incubated with the peroxide-sensitive fluorescent
indicator 2',7'-dichlorodihydrofluorescein diacetate, and
fluorescence was determined by FACS analysis. As shown in Fig. 2
, A375 cells had substantially higher
ROS levels than S91 cells. B16 cells also had very low ROS levels,
whereas C32 cells had intermediate ROS levels. These results are at
least consistent with the hypothesis that RAR-dependent gene regulation
is impaired by high levels of oxidative stress in A375 cells.
|
RARELuc) showed
no inducible activity under any condition. Thus, in agreement with our
hypothesis, lowering of the oxidative stress levels rescued
RAR-dependent transcriptional activity in cells that are unresponsive
to RA under normoxic culture conditions.
|
Members of the nuclear hormone receptor superfamily share a highly
conserved DBD, and they may behave in a fashion similar to the RARs to
altered redox conditions in melanoma cells. As a representative, but
distinctly different, receptor we tested the redox dependence of
GR-mediated activity. A375 cells were transfected with the
dex-inducible mouse mammary tumor virus promoter linked to the Luc
gene, and induction of Luc activity in response to treatment was again
determined under normoxic or hypoxic culture conditions (Fig. 3B
).
Under normoxic culture conditions, a moderate induction level of
GR-mediated gene expression by dex was detected, indicating that
GR-mediated activity is somewhat less suppressed than RAR-mediated
activity in these cells. However, hypoxia again substantially increased
GR-dependent Luc induction, showing that both endogenous RAR and
GR-mediated functional activity increased under lower oxidative stress
levels. As expected, a similar effect of hypoxia was seen for phorbol
12-myristate 13-acetate-induced activating protein-1 activity
(data not shown).
Next, we examined whether the effects of different ROS levels on RAR
activity and gene expression would also have physiological
consequences, such as RA-dependent growth inhibition. A375 cells were
propagated in 96-well plates under normoxic or hypoxic conditions in
the absence or presence of RA, and after 5 days relative cell numbers
were determined by a colorimetric assay, in which
A490 nm directly correlates
with the number of viable cells (8). The absorbance values
of control cells were used to calculate the percent inhibition of
proliferation in RA-treated cells under normoxic and hypoxic
conditions, respectively (Fig. 3C
). Under normoxic conditions, A375
cells were highly resistant to RA and displayed less than 10% growth
inhibition. Under hypoxic conditions, however, RA-dependent inhibition
of A375 cell proliferation almost doubled to 20% at the highest
concentration of 1 µM RA tested, showing that these cells
could be resensitized to RA, consistent with our earlier results. On
the other hand, this effect is still less severe than that observed in
highly RA-responsive S91 and B16 cells (23) (data not
shown), but other, downstream events may limit RA-dependent growth
suppression in A375 cells. Unfortunately, the potentially additional
growth-suppressive effects of NAC could not be assessed due to the
reactivity of NAC with components of the MTS assay (data not
shown). Thus, reduced ROS levels in A375 cells increase RAR-dependent
gene regulation, which then results in increased sensitivity to
RA-mediated growth suppression.
Previous in vitro experiments showed that the DNA-binding
activity of estrogen receptors and GR is dependent on redox-sensitive
Cys residues in the DBD (12, 24, 25, 26), and we proposed that
the related RARs would behave analogously. The effects of oxidizing and
reducing buffer conditions on the DNA-binding activity of RXR/RAR
heterodimers was therefore determined. RARß and RXR
were
translated in vitro in a rabbit reticulocyte lysate system,
and their DNA-binding activity to a 32P
end-labeled oligonucleotide containing the ßRARE sequence was
detected by EMSA. RARß was chosen to represent this experiment
because this isoform gave more gel-shifted material per µl lysate
than RAR
or RAR
(data not shown). As shown in Fig. 4
, lysates containing only RARß or
RXR
showed no binding (lanes 1 and 2, respectively), but did
demonstrate DNA binding when mixed together through formation of
RXR
/RARß heterodimers (HD; lane 3). Addition of 250
mM
H2O2 during incubation
significantly reduced the amount of bound HD (lane 4). To change the
redox conditions during EMSA, we then used half the amount of RXR
and RARß lysate to dilute the reducing agents present in the
incubation buffer from the reticulocyte lysate, which resulted in
strongly diminished HD formation (lane 5). Conversely, addition of 10
mM 2-mercaptoethanol or dithiothreitol (lanes
6 and 7, respectively) to the buffer resulted in a marked increase in
HD-binding activity, restoring approximately full levels of binding
activity (compare to lane 3). Similar results were obtained with
in vitro translated RAR
and RAR
/RXR
HDs (data not
shown). These results demonstrate that oxidative conditions decrease,
whereas reducing conditions reversibly increase, the HD DNA-binding
activity of RARs. These effects of redox states on RAR DNA binding may
mediate the observed effects on the functional activity of these
receptors.
|
These findings have a number of potentially important implications in
both pathological and physiological circumstances. It is likely that
there are instances of apparent hormone resistance in certain tumors
that may be due to epigenetic changes in the intracellular redox
balance of the cells rather than being caused by mutations or deletions
in the receptor signaling pathways (28, 29, 30). Thus, it may
be promising to investigate the potential clinical effects of combining
antioxidants with hormone therapy in hormone-resistant tumors to
determine whether they can be resensitized via this strategy. Indeed,
our results suggest that tumors that are already hormone sensitive may
be rendered even more sensitive. Consistent with our results, Makishima
et al. (31) showed that 9-cis-RA
-tocopherol ester, which has antioxidant activity, enhanced
RA-dependent differentiation of acute promyelocytic leukemia cells.
The redox state of a cell may also change during normal development and differentiation of an organism (32), and the resulting modulation of RAR activity may provide a novel and previously unrecognized level of control of nuclear hormone receptor activity. Interestingly, antioxidants were shown to prevent, rather than increase, RA-induced apoptosis of embryonic stem cells (33), demonstrating that the cellular redox state controls a complex and cell type-dependent response to RA.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received November 8, 2000.
| References |
|---|
|
|
|---|
2b interferon and 13 cis retinoic acid in
patients with metastatic melanoma. Am J Clin Oncol 21:352354[CrossRef][Medline]
-2a in stage IV melanoma: a Southwest Oncology Group study. Cancer J
Sci Am 5:4147[Medline]
in
induction of differentiation and apoptosis of S91 melanoma cells.
J Biol Chem 272:1899018999
B binding activity by oxidation-reduction
in vitro. Proc Natl Acad Sci USA 88:43284332
-tocopherol ester (9-cis tretinoin
tocoferil). Blood 91:47154726This article has been cited by other articles:
![]() |
U. Yokoyama, Y. Sato, T. Akaike, S. Ishida, J. Sawada, T. Nagao, H. Quan, M. Jin, M. Iwamoto, S. Yokota, et al. Maternal vitamin A alters gene profiles and structural maturation of the rat ductus arteriosus Physiol Genomics, September 11, 2007; 31(1): 139 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ding, T. Jin, Z. Wang, and Y. Chen Catalase potentiates retinoic acid-induced THP-1 monocyte differentiation into macrophage through inhibition of peroxisome proliferator-activated receptor {gamma} J. Leukoc. Biol., June 1, 2007; 81(6): 1568 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kato, B. C. Salumbides, X.-F. Wang, D. Z. Qian, S. Williams, Y. Wei, T. B. Sanni, P. Atadja, and R. Pili Antitumor effect of the histone deacetylase inhibitor LAQ824 in combination with 13-cis-retinoic acid in human malignant melanoma Mol. Cancer Ther., January 1, 2007; 6(1): 70 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Selvaraj and K. C. Klasing Lutein and Eicosapentaenoic Acid Interact to Modify iNOS mRNA Levels through the PPAR{gamma}/RXR Pathway in Chickens and HD11 Cell Lines J. Nutr., June 1, 2006; 136(6): 1610 - 1616. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont Selenium, the Thyroid, and the Endocrine System Endocr. Rev., December 1, 2005; 26(7): 944 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Santos-Guzman, T. Arnhold, H. Nau, C. Wagner, S. H. Fahr, G. E. Mao, M. A. Caudill, J. C. Wang, S. M. Henning, M. E. Swendseid, et al. Antagonism of Hypervitaminosis A-Induced Anterior Neural Tube Closure Defects with a Methyl-Donor Deficiency in Murine Whole-Embryo Culture J. Nutr., November 1, 2003; 133(11): 3561 - 3570. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |