Endocrinology Vol. 142, No. 6 2569-2576
Copyright © 2001 by The Endocrine Society
Creation and Activity of COS-1 Cells Stably Expressing the F2 Fusion of the Human Cholesterol Side-Chain Cleavage Enzyme System1
Mei-Chuan Huang and
Walter L. Miller
Department of Pediatrics and the Metabolic Research Unit,
University of California, San Francisco, San Francisco, California
94143-0978
Address all correspondence and requests for reprints to: Prof. Walter L. Miller, Department of Pediatrics, Building MR-IV, Room 209, University of California San Francisco, San Francisco, California 94143-0978. E-mail: wlmlab{at}itsa.ucsf.edu
 |
Abstract
|
|---|
A fusion construct for the human cholesterol side-chain cleavage enzyme
system termed F2 (H2N-P450scc-adrenodoxin
reductase-adrenodoxin-COOH), was stably expressed in
nonsteroidogenic COS-1 cells. Multiple clones were obtained and
analyzed, identifying the clone COS-F2130 as the most active in
converting 22R-hydroxycholesterol (22R-OH-C) to pregnenolone. The F2
fusion construct was properly transcribed and translated in COS-F2130
cells, indicating that these cells did not proteolytically cleave the
F2 protein. Steroid analyses show that the COS-F2130 cells do not
convert appreciable quantities of pregnenolone to other steroids.
Isolated COS-F2130 mitochondria showed enhanced steroidogenesis when
incubated with biosynthetic N-62 StAR protein in vitro.
The cells were easily transfectable with StAR expression vectors,
showing that COS-F2130 cells exhibited both StAR-independent and
StAR-dependent activity. Transient expression of either full-length or
N-62 StAR stimulated steroidogenesis to approximately 45% of the
maximal steroidogenic capacity, as indicated by incubation with
22R-OH-C. Single, double, and triple transfections of individual
vectors expressing P450scc, adrenodoxin reductase, and adrenodoxin
demonstrated that the P450 moiety of the F2 fusion protein could only
receive electrons from the covalently linked adrenodoxin moiety, but
that free adrenodoxin reductase could foster activity of the fusion
enzyme. COS-F2130 cells provide a useful system for studying
steroidogenesis, as these are the only cells described to date that
convert cholesterol to pregnenolone but lack downstream enzymes that
catalyze other steroidogenic reactions.
 |
Introduction
|
|---|
THE FIRST and rate limiting step in the
biosynthesis of all steroid hormones is the conversion of cholesterol
to pregnenolone (1, 2, 3, 4, 5). This reaction is catalyzed by the
mitochondrial cholesterol side chain cleavage enzyme system, in which
electrons from NADPH are taken up by a flavoprotein, termed adrenodoxin
reductase (AdRed), which then passes the electrons to an iron-sulfur
protein termed adrenodoxin (Adx), which then passes them to
mitochondrial P450scc (5, 6, 7). One pair of electrons is
needed to catalyze each of the three successive steps required to
convert cholesterol to pregnenolone: 20
-hydroxylation,
22-hydroxylation and scission of the 20, 22 carbon-carbon bond
(2, 5). Because this reaction is rate-limiting and is the
principal site of hormonal regulation, it has been the subject of
extensive studies, which have revealed two modes of regulation: acute
and chronic. The acute regulation of steroidogenesis, e.g.
the induction of corticosteroid synthesis within minutes of a stress,
is at the level of movement of the cholesterol substrate into
mitochondria, which requires the steroidogenic acute regulatory protein
(StAR) (8, 9, 10). The chronic regulation of steroidogenesis,
i.e. the determination of net cellular steroidogenic
capacity, is at the level of the transcriptional regulation of the
various steroidogenic enzymes, particularly P450scc
(11, 12, 13). P450scc is thus the enzymatic regulatory step
because it is the slowest steroidogenic enzyme, turning over only one
mole of cholesterol per mole of enzyme per second
(14).
Studies of the conversion of cholesterol to pregnenolone remain
difficult and cumbersome for several reasons. First, the apparent
enzymology of P450scc in whole cells or in isolated mitochondria is
limited by the rate at which cholesterol enters mitochondria under the
influence of StAR-like factors. This problem can be circumvented by
using soluble hydroxysterols such as 20
-hydroxycholesterol or
22R-hydroxycholesterol (22R-OH-C) as substrate, as these bypass the
action of StAR (9, 15, 16, 17). Second, cholesterol
side chain cleavage activity is crucially dependent on the ratio of
adrenodoxin (but not adrenodoxin reductase) to P450scc, so that modest
increases in adrendoxin concentrations substantially increase the
apparent P450scc activity, as measured by pregnenolone production
(18, 19, 20). Similar data indicate that adrenodoxin
is limiting with other mitochondrial P450 systems (20, 21). This problem has been circumvented by the construction of a
fusion protein, termed F2, consisting of
H2N-P450scc-Adrenodoxin
Reductase-Adrenodoxin-COOH, which fixes the molar ratio of these
three proteins at 1:1:1 (19, 22). This same mitochondrial
fusion protein architecture has proven successful with P450c27 (vitamin
D-25-hydroxylase) (23), and P450c11ß
(steroid 11ß-hydroxylase) (24). The F2 fusion protein
has a higher Km but also has a higher Vmax when
compared with the cholesterol side chain cleavage system composed of
the three independent proteins, so that its catalytic efficiency is the
same (19). Despite these advances, it remains difficult to
study StAR activity because it requires cotransfection of F2 and StAR
constructs and because all naturally occurring cell systems that
contain the normal 3-component cholesterol side chain cleavage
system also contain other steroidogenic enzymes (e.g.
3ß-hydroxysteroid dehydrogenase, 3ßHSD) that metabolize
pregnenolone to other steroids. To circumvent these difficulties and to
facilitate the study of factors that foster intramitochondrial
cholesterol transfer, we stably expressed the F2 fusion of the
cholesterol side chain cleavage system in nonsteroidogenic COS-1 cells.
We have characterized these cell lines in detail, showing they are
useful, novel reagents for the study of steroidogenesis.
 |
Materials and Methods
|
|---|
Construction of the F2 stable expression vector
The F2 cDNA cassette (19) was excised from its pECE
expression vector (25) as a
KpnI-EcoRI fragment and cloned into the pcDNA3
cloning vector (Invitrogen) linearized with
KpnI and EcoRI, positioning the F2 construct so
it would be driven by the human cytomegalovirus (CMV) immediate early
promoter. The resulting construct is called F2-pcDNA3. The pcDNA3
cloning vector contains a Neomycin resistance gene (neo), thus allowing
clones carrying F2-pcDNA3 to survive under selection by G418
(Geneticin) (Life Technologies, Inc., Gaithersburg,
MD).
Stable transfection of COS-1 cells
COS-1 cells were maintained and propagated in DMEM containing
4.5 g glucose/liter, 10% FBS, and antibiotics. The F2-pcDNA3
vector was linearized with PvuI, and subconfluent COS-1
cells were stably transfected with 12 µg of this DNA in 10-cm tissue
culture dishes using lipofectamine (Life Technologies, Inc.). Single clones were generated by limiting dilution into a
selection medium containing 600 µg/ml G418, 48 h after
transfection. The resulting individual colonies were picked and
transferred to 2.2-cm 12-well plates (Becton Dickinson and Co., Franklin Lakes, NJ) for propagation, then later to 3.4-cm
6-well plates for enzymatic assay. These clones were tested for
enzymatic assay by incubating cells for 24 h with 5
µM (12.5 µg/ml) 22R-OH-C (Sigma,
St. Louis, MO) added as an exogenous substrate to each stable cell line
grown in 6-well plates containing 1x106 cells.
Media were collected and pregnenolone was determined by RIA (ICN Pharmaceuticals, Inc., Costa Mesa, CA) to identify clones
expressing cholesterol side chain cleavage activity.
Transient transfection of COS-F2130 cells
Transient transfection of COS-F2130 cells was performed using
FuGENE 6 (Roche Molecular Biochemicals, Indianapolis,
IN). The pECE-based vectors individually expressing human P450scc
(pEscc) (26), adrenodoxin (pEAdx) (26), and
the active form of adrenodoxin reductase
(pEAR18-) (27) have been
described.
RT-PCR
Total RNA was isolated from COS-1, COS-F2 stable clones no. 87
and 130 and NCI-H295A cells (28, 29, 30). cDNA was synthesized
using reverse transcriptase Superscript II (Life Technologies, Inc.), and PCR was performed using 0.4 µg of cDNA with primers
for human P450scc, Adx, AdRed, or GAPDH for 25 cycles of amplification.
The sequences of the primers and the PCR conditions used were as
described by Harikrishna et al. (19). Primers
used for spanning the P450scc/AdRed junction of F2 were scc no. 1 and
AR no. 6 (19), and those for spanning the AdRed/Adx
junction were AR no. 5 and Adx no. 10 (19). The primers
used for human P450scc were 5'GATGCCATCTAC-CAGATGTT3' for sense and
5'CTCTGAAGTTCTCCAGCATA3' for antisense to produce a 750-bp fragment.
The primers for AdRed were no. 6 and no. 7 to yield a 200-bp fragment
and for Adx no. 9 and no. 10 to yield a 371-bp fragment
(19). The 502-bp human GAPDH sequence was amplified using
primers and conditions as described (31).
Western immunoblotting
For immunoblotting, 45 µg of mitochondrial proteins were
separated on an SDS 6.5% polyacrylamide gel, transferred to a
polyvinylidene difluoride membrane (Millipore Corp.),
blocked in a buffer containing 25 mM Tris, 154
mM NaCl, 0.05% Triton X-100 and 5% nonfat dry milk at 20
C for 1 h, incubated with antisera to human P450scc or AdRed
(32) for 60 min in the same buffer, washed, then incubated
with goat antirabbit IgG conjugated with horseradish peroxidase
(Roche Molecular Biochemicals) for 60 min. The membrane
was washed for 3060 min and the antigen-antibody complexes were
detected by ECL (Amersham Pharmacia Biotech, Arlington
Heights, IL).
TLC
Cultured COS-1 and COS-F2130 cells were incubated with 40,000
cpm [14C] pregnenolone (NEN Life Science Products, Boston, MA) for various times. A 0.4 ml aliquot of
culture medium was extracted with ethylacetate/isooctane (1:1),
concentrated by evaporation, dissolved in 20 µl methylene chloride,
and analyzed by TLC in chloroform/ethylacetate (3:1) (33)
using Whatman PE SIL G/UV silica gel plates
(Whatman, Maidstone, UK). Mitochondria (10 µg protein)
from COS-F2130 and COS-1 cells were incubated with 40,000 cpm
[14C] pregnenolone (NEN Life Science Products) and 1 µM pregnenolone in the presence of
mitochondrial buffer as described (34) in a volume of 250
µl. After 0 or 1 h incubation, steroids were analyzed by TLC as
described for whole cells.
Mitochondrial assay of StAR activity
Mitochondria were isolated from mouse Leydig MA-10 or COS-F2
stable cells as described (34). Cells were harvested and
centrifuged at 500 g, the pellet was frozen at -20 C for 15 min,
and washed with buffer containing 0.25 M sucrose, 1
mM EGTA, 10 mM HEPES
(N-2-hydroxyethyl-piperazine-N'-2-ethanesulfonic
acid), pH 7.4, 0.1% BSA, 1 mM dithiothreitol and
a protease inhibitor mixture (Roche Molecular Biochemicals) containing Leupeptin (1
µM), pefabloc SC (0.44
mM), aprotinin (0.010.3
µM), and 1 mM EDTA
(35). The washed pellet was homogenized by 15 strokes of a
Tenbroeck tissue grinder (Corning, Inc., Corning, NY). The homogenate was cleared of debris at 1,500 x
g for 10 min, following which the mitochondria were pelleted
at 10,000 x g for 10 min. The crude mitochondrial
pellet was washed twice with the same buffer to produce the enriched
mitochondrial fraction. These purified mitochondria were used
immediately or stored at -70 C. Mitochondrial assays were carried out
with 2 µg of mitochondrial protein incubated in the absence or
presence of purified recombinant StAR proteins (kindly provided by Dr.
Himanshu Bose from our laboratory) at 37 C for 60 min with a total
volume of 50 µl as described (34). Mitochondrial assays
using mitochondria form MA-10 cells, but not other cells, included
trilostane (kindly provided by Dr. Jerome F. Strauss III, University of
Pennsylvania, Philadelphia, PA), an inhibitor of 3ß-HSD, at a final
concentration of 250 ng/ml. The amount of pregnenolone produced by
isolated mitochondria was measured by immunoassay.
 |
Results
|
|---|
Identification of F2/COS-1 stable clones by enzymatic assay
To produce stable cell lines, the linearized F2 cDNA construct in
the pcDNA3 expression vector (F2-pcDNA3) was transfected into COS-1
cells, and single clones were selected using G418. A total of 55
surviving clones were screened for P450scc activity by measuring the
conversion of 22R-hydroxycholesterol (22R-OH-C) to pregnenolone.
22R-OH-C is a soluble hydroxysterol that readily enters mitochondria
without the action of StAR, and hence is a commonly used indicator for
maximal steroidogenic capacity (9, 15, 16, 34). 22R-OH-C
was used at a concentration of 5 µM, which is above the
2.8 µM Km for the F2 fusion protein (19).
Among the 55 G418-resistant clones, 6 had low activity, secreting less
than 20 ng of pregnenolone per ml medium per 24 h; 3 had medium
activity, producing 2050 ng/ml medium/24 h, and 9 had high activity,
producing > 50 ng/ml medium/24 h. Thirty-seven additional clones
that made less than 5 ng pregnenolone/ml medium/24 h were eliminated,
as this was not greater than the RIA background of 23 ng seen in
COS-1 cells or in medium alone. We chose four clones for further study:
clone no. 130, which was the most active; clone no. 87, which had
intermediate activity; clone no. 71, which had low activity; and clone
no. 211, which was a control harboring an empty pcDNA3 vector. The
active cell lines are designated COS-F2130, and COS-F287. Figure 1
shows the activities (on a log scale)
of these four clones and of COS-1 cells in the presence or absence of 5
µM 22R-OH-C. A small amount of pregnenolone was produced
by COS-F2130 and -87 in the absence of 22R-OH-C, showing
StAR-independent steroidogenesis from endogenous cholesterol substrate.
The morphology and growth rate of these cell lines varied. At low
dilution, COS-F2130 cells were more angular, tended to spread out and
grew more slowly than COS-1 cells. However, upon reaching confluency,
the various cell lines became indistinguishable.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1. Steroidogenic activity of stable clones. Single
clones of COS-1 cells carrying the stably transfected F2 construct were
selected with 600 µg/ml G418. Clones were identified by incubation
with 5 µM of 22R-hydroxylcholesterol (22R-OH-C) for
24 h; the activities of four representative clones (from a total
of 55) are shown. Pregnenolone was also produced by cells from clones
no. 130 and no. 87 that were not incubated with 22R-OH-C,
indicating the use of endogenous cholesterol. The low levels of
pregnenolone apparently produced by clone no. 211 harboring an empty
vector and untransfected COS-1 cells correspond to the assay
background, determined by RIA of the medium alone without exposure to
cells, and shown as a line parallel to the x-axis. The
data shown here are means ± SEM of three experiments,
each performed in duplicate; note that the y-axis is
shown as a log scale.
|
|
Expression of F2 in the stable clones
To determine if the F2 RNA was transcribed properly, we prepared
RNA from COS-F2130, COS-F287, NCI-H295A and COS-1 cells and
performed RT-PCR (Fig. 2
).
Oligonucleotide primers for P450scc, AdRed, and Adx produced PCR
products of the expected sizes. Low levels of endogenous AdRed and Adx
(but not P450scc) were detected in COS-1 cells, consistent with the
ubiquitous expression of Adx and AdRed (27, 36). Paired
primers spanning the junctions P450scc/AdRed and AdRed/Adx were also
used to ensure the proper transcription of the F2 construct (Fig. 2
).
As expected, only COS-F2130 and COS-F287 cells yielded the properly
transcribed products with P450scc/AdRed or AdRed/Adx primers; these
products of the engineered F2 fusion protein were not seen in NCI-H295A
or COS-1 cells.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 2. Transcription of F2 in the stable clones. The
proper transcription of F2 was demonstrated by RT-PCR using primers
flanking the junctions of P450scc-AR or AR-Adx. cDNA was prepared from
4 µg of RNA from each cell line and 5 µl of the cDNA product from
the RT reaction was amplified for 25 cycles with the primer pairs
indicated. The GAPDH amplification shows that the RNA samples were
intact and that approximately equal amounts of RNA were present in each
sample. The amplifications with oligonucleotides within the sequences
of P450scc, Adx, and AdRed show that each is present in clones 87 and
130 and in NCI-H295A cells; minimal levels of Adx and AdRed are seen in
COS-1 cells but no P450scc is seen. Amplification with P450scc/AdRed
and AdRed/Adx pairs shows that the fusion sequence is expressed in
clones 87 and 130, but not in COS-1 or NCI-H295A cells. (-) designates
no template control for PCR.
|
|
To determine if this RNA was translated into the F2 fusion protein, we
performed Western blotting of mitochondrial protein from COS-F2130,
COS-F287, COS-1, and NCI-H295A cells (Fig. 3
). The expected 121-kDa F2 fusion
protein was readily detected in COS-F2130 cells using antisera to
either P450scc or AdRed, but could only be seen in COS-F287 cells
when the films were overexposed (not shown). By contrast, only the
monomeric 60 kDa P450scc and 54 kDa AdRed were detected in NCI-H295A
cells. As expected, COS-1 cells had a low level of endogenous AdRed but
no P450scc (19, 26, 27). The level of F2 fusion protein
expression in COS-F2130 was about 10-fold greater than that in
COS-F287, consistent with the activity data in Fig. 1
. Thus, the
stably transfected COS-1 cells express the expected sizes of F2 mRNA
and protein, and this mRNA and protein are not subject to rapid
enzymatic degradation.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Western blots. Mitochondrial proteins from
COS-F2130, COS-F287, COS-1, and NCI-H295A cells were displayed on
6.5% polyacrylamide SDS gels, transferred to nitrocellulose, and
probed with antisera to human P450scc (left) or AdRed
(right). The expected 121-kDa band corresponding to the
full-length F2 protein is readily seen in COS-F2130 cells and barely
seen in COS-F287 cells, and is detected with antisera to both P450scc
and AdRed. The expected 60-kDa P450scc band is seen in control
NCI-H295A cells but COS-1 cells do not contain either F2 or free
P450scc protein. The 54- kDa AdRed protein was expressed in all
cell lines examined. Molecular size markers are shown in kDa.
|
|
Steroid metabolism in COS-F2130 cells
The COS-F2130 cell line was identified by its ability to produce
large amounts of pregnenolone (Fig. 1
). To determine whether
pregnenolone is the final steroidal product in COS-F2130 cells, we
added [14C] pregnenolone to COS-1 and
COS-F2130 cells and examined the resulting steroids by TLC and
phosphorimager analysis (Fig. 4
). Whole
COS-1 and COS-F2130 cells convert 0.7% of the radiolabeled
pregnenolone to progesterone after 1 h and 2.5% after 5 h,
probably using the type I 3ßHSD found at low levels in most
extraglandular tissues, including the kidney (37).
Mitochondria isolated from COS-1 or COS-F2130 cells converted 0.1%
of the radiolabeled pregnenolone to progesterone after 1 h, but
mitochondria from MA-10 cells converted 6% of the incubated
pregnenolone to progesterone and another unidentified product in 1
h, consistent with the presence of type II 3ßHSD in MA-10 cell
mitochondria (38). Thus COS-F2130 cells provide a unique
steroidogenic environment in which pregnenolone is the overwhelmingly
predominant final product.

View larger version (85K):
[in this window]
[in a new window]
|
Figure 4. Steroidogenesis in COS-F2130 cells. Whole
COS-F2130 and COS-1 cells (left) and mitochondria
isolated from COS-F2130, COS-1 and MA-10 cells (right)
were incubated with [14C] pregnenolone for the times
indicated and the resulting steroidal products were analyzed by TLC.
The migration of reagent grade [14C] progesterone and
[14C] pregnenolone are shown at the left. The
phosphorimager quantitation of the conversions of pregnenolone to
progesterone are provided in the Results.
|
|
Steroidogenic activity of isolated mitochondria from the stable
clones
We and others have used mitochondria from isolated steroidogenic
cells to assay the capacity of various proteins (e.g. StAR
and MLN64) to foster steroidogenesis by increasing the flow of
cholesterol from the outer to inner mitochondrial membrane (34, 39, 40, 41). However, because 3ßHSD is present in mitochondria as
well as in cytoplasm (38), such assays are complicated by
having unknown quantities of the pregnenolone product converted to
other steroids that are not detected by the pregnenolone immunoassay.
The presence of the F2 protein in nonsteroidogenic COS-1 cells provides
a unique steroidogenic cell system in which pregnenolone is the final
steroidal product, as COS-1 cells lack downstream steroidogenic
enzymes. Thus, we examined the suitability of isolated mitochondria
from COS-F2130 cells for assays of StAR activity in vitro.
In the absence of StAR protein, mitochondria from steroidogenic cells
will produce small amounts of pregnenolone from the cholesterol
preexisting in the mitochondria. Under these conditions, mitochondria
from COS-F2130 cells produced 0.56 ng of pregnenolone per µg
mitochondrial protein, compared with 1.82 ng by mitochondria from MA-10
cells, 0.13 ng by COS-F287 cells, and 0.09 ng by clone no. 71. The
level of pregnenolone assayed from mitochondria of clone no. 211 or
COS-1 cells was indistinguishable from the background measured in
buffer alone without exposure to mitochondria (Fig. 5
). Thus, mitochondria from COS-F2130
cells possessed the highest steroidogenic capacity among the COS-F2
stable clones, but this was only about one third of the activity seen
with MA-10 mitochondria.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5. Steroidogenic activity of isolated mitochondria.
Mitochondria (2 µg protein) from MA-10, COS-F2 clones no. 130, no.
87, no. 71, no. 211, and COS-1 cells were incubated at 37 C for 60 min
without added substrate, and the amount of pregnenolone produced from
their endogenous cholesterol stores was measured by RIA. COS-F2130
cells exhibited greater steroidogenic capacity than the other stable
cell lines, but less than MA-10 cells. The assay background shown as a
line parallel to the x-axis was determined as buffer
alone in the absence of mitochondria. Results are means ±
SEM from eight independent experiments for MA-10 and
COS-F2130 mitochondria; six experiments for COS-F287 and no. 71,
and four experiments for no. 211 and COS-1 mitochondria, each performed
in duplicate.
|
|
Mitochondria from COS-F2130 cells were then incubated with
10-8 M to
10-5 M StAR
protein. Purified recombinant 6His-tagged N-62 StAR was biologically
active and stimulated steroidogenesis in mitochondria from both
COS-F2130 and MA-10 cells in a dose-dependent manner, but the MA-10
mitochondria produced a steeper, clearer, and more robust response,
consistent with their greater level of basal steroidogenesis (Fig. 6
). Compared with a buffer blank,
10-8 M N-62
StAR protein stimulated steroidogenesis 7.4 ± 1.2 fold in
mitochondria from MA-10 cells and 4.2 ± 0.2-fold in mitochondria
from COS-F2130 cells. When incubated with
10-8 M N-62
StAR, mitochondria from MA-10 cells produced 9.6 ± 1.0 ng
pregnenolone and mitochondria from COS-F2130 cells produced 2.2
± 0.3 ng pregnenolone.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 6. In vitro assay of StAR activity.
Bacterially expressed human 6His-tag N-62 StAR protein was incubated
with 2 µg of mitochondria from MA-10 or COS-F2130 cells, and the
amount of pregnenolone produced from endogenous mitochondrial
cholesterol was measured by RIA. The data are shown as a percentage of
the control values for mitochondria from each cell type incubated with
buffer alone. Data are means ± SEM from five
experiments, each performed singly or in duplicate.
|
|
Transient expression of StAR in COS-F2130 cells
COS-1 cells transiently transfected with the vector expressing the
F2 fusion protein are widely used in the study of StAR action (9, 34, 40, 41, 42, 43, 44, 45, 46, 47). To determine whether COS-F2130 cells can exhibit
an acute steroidogenic response, we transiently transfected these cells
with expression vectors for N-62 StAR or full-length StAR and measured
pregnenolone synthesis. Western blotting using StAR antibody
(48) confirmed the expression of StAR in COS-F2130 cells
transfected with the N-62 StAR expression vector, but not with mock
transfection (not shown). Transient transfection of COS-F2130 cells
with expression vectors for N-62 StAR and full-length StAR enhanced
steroidogenesis to a similar extent, producing 20-fold more
pregnenolone than empty vector or mock transfection (Fig. 7
). Furthermore, pregnenolone synthesis
fostered by N-62 StAR or full-length StAR using endogenous cholesterol
is 45% of the maximal steroidogenic capacity, as indicated by
incubation with 22R-OH-C, consistent with previous observations
(34). COS-F2130 cells from different passages gave same
degree of pregnenolone synthesis, indicating that this clonal cell line
is stable.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 7. Steroidogenic activity of COS-F2130 cells
transfected with expression vectors for StAR. COS-F2130 cells mock
transfected or transfected with empty vector produce low levels of
pregnenolone; when these cells are incubated with 22R-OH-C,
pregnenolone production is increased substantially (set at 100% in
this figure). Cells transfected with vectors for full-length (FL) StAR
or for N-62 StAR have about 4550% of maximal activity, showing the
increased flow of cholesterol into mitochondria. By contrast, COS-1
cells, with or without StAR transfection, produce no pregnenolone. Data
with COS-F2130 cells (five left bars) are mean ±
SEM of six experiments, each performed in duplicate; data
with COS-1 cells (four right bars) are means ±
SEM of four experiments, each performed in triplicate.
|
|
Function of the AdRed and Adx moieties in the F2 fusion
protein
The limiting factor in the activity of the P450scc system is the
availability of Adx (18, 19, 24). To examine the adequacy
of each component of the side chain cleavage system in COS-F2130
cells, increasing amounts (0.01, 0.1, 1.0, 3.0 µg) of expression
vectors for Adx, P450scc and AdRed were transiently transfected into
these cells. As expected, transfection of COS-F2130 cells with the
vector expressing Adx did not increase the activity of the F2 protein
expressed by these cells (Fig. 8A
), as we
have previously shown that the Adx moiety in the F2 fusion protein
supplies electrons directly to the P450scc moiety, because mutation
of the Adx moiety in F2 ablates activity (22). Also as
expected, transfection of COS-F2130 cells with a vector expressing
P450scc increased activity, as the free P450scc produced by this vector
should be catalytically active, receiving electrons from the free Adx
and AdRed endogenously produced by COS-1 cells. Surprisingly,
transfection of COS-F2130 cells with the vector expressing AdRed
increased activity, suggesting that free AdRed can donate electrons to
the Adx moiety of the F2 fusion protein. This is consistent with our
previous observation that mutation of the AdRed moiety in F2 did not
reduce activity (22) and suggests that a major source of
electrons donated to the Adx moiety of F2 is free AdRed rather than the
AdRed moiety of F2. As expected, free Adx fostered the activity of free
P450scc substantially, but AdRed fostered activity only minimally when
vectors for the two proteins were transfected together, and triple
transfection did not increase pregnenolone production further, again
showing that it is the Adx moiety that is limiting (Fig. 8B
). Thus, the
level of P450scc activity achieved by the F2 fusion protein in
COS-F2130 cells is substantially less than that achieved in triple
transfection. Hence the catalytically active F2 protein appears to be
expressed at relatively low levels compared with the level of protein
expression possible in transient transfection.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 8. Transfection of COS-F2130 cells with expression
vectors for Adx, P450scc or AdRed. A, Transfection with 0.01, 0.1, 1
and 3 µg of the pEAdx vector expressing adrenodoxin did not increase
the basal level of pregnenolone produced by COS-F2130 cells, but
transfection with the same amounts of the pEscc vector expressing human
P450scc or the pEAR18- vector expressing human AdRed
increased steroidogenesis in a dose-dependent fashion. Results are the
means ± SEM from four separate transfections
performed in duplicate or triplicate. B, Transfection of 1 µg of
pEAdx, pEscc or pEAR18- alone or in combination with each
other into COS-F2130 cells. Bluescript was added to keep DNA amount
constant at 3 µg in each transfection in both panels. Mock, empty
vector (pECE) or bluescript alone were included as controls and
pregnenolone they produced was similar to COS-F2130 cells alone. The
data are means ± SEM from three separate
transfections, each performed in duplicate or triplicate.
|
|
 |
Discussion
|
|---|
We have established a functional new cell line termed COS-F2130,
consisting of COS-1 cells expressing a stably integrated vector for the
F2 fusion protein of the human cholesterol side chain cleavage system.
The only steroidogenic enzyme this cell line expresses is the P450scc
system, and not any of the downstream enzymes in the steroidogenic
pathway, so that pregnenolone is the final steroid produced.
COS-F2130 cells exhibit both StAR-dependent and StAR-independent
steroidogenesis, and hence should prove useful in studies of StAR and
StAR-like proteins.
Studies with the mitochondrial electron-transport proteins in
COS-F2130 cells showed that the Adx moiety of F2 supplies electrons
directly to the P450scc moiety, but that free AdRed, instead of the
AdRed moiety of F2, enhances the activity of the fusion enzyme by
donating electrons to the Adx moiety of F2. Transient expression of
free P450scc enhances steroidogenesis by receiving electrons from
endogenous free Adx and AdRed. These data confirm that the Adx moiety
is the limiting factor for P450scc in COS-F2130 cells, as free Adx
significantly promotes P450scc activity and cotransfections of all the
three components do not produce more pregnenolone than Adx-P450scc
cotransfections. It is possible that P450scc and other mitochondrial
P450 enzymes have a broader range of electron donors than the AdRed/Adx
system. A fusion protein termed F4, comprising
H2N-P450scc-oxidoreductase-COOH is catalytically
active, receiving electrons from the P450 oxidoreductase normally found
in the endoplasmic reticulum (22).
Mitochondrial (type I) cytochrome P450 enzymes receive electrons from
NADPH via an electron transport chain consisting of a flavopotein
(AdRed) and an iron-sulfur protein (Adx); by contrast, microsomal (type
II) P450 enzymes receive electrons from NADPH directly via the
flavoprotein P450 oxidoreductase (OR), without requiring an iron-sulfur
intermediate (5). A naturally occurring fusion protein of
a type II P450 has been described in Bacillus megaterium
(49, 50), leading to the successful adaptation of this
naturally occurring H2N-P450-OR-COOH architecture
to numerous artificial fusion proteins of type II P450 enzymes
(51, 52, 53, 54, 55). However, no naturally occurring fusion proteins
of type I P450 enzymes have been described, and the observation that
the same surface of Adx interacts with both the P450 and the AdRed
moieties indicated that type II P450 enzymes do not form a ternary
complex (24, 56, 57, 58), suggesting that fusion proteins of
the three components of mitochondrial P450 system should be inert.
Nevertheless, several such type II fusion proteins have been built
using various P450 moieties and various architectures (19, 22, 23, 24). It has been suggested that fusion proteins of the F2
architecture (19) are catalytically active because
the carboxy-terminal Adx moiety is free to rotate about the linking
hinge peptide, permitting the same surface of Adx alternately to
interact with the P450 and AdRed moieties (57, 58).
However, this has not been demonstrated experimentally, and the
catalytic activity of proteins with the architectures
H2N-P450scc-Adx-AdRed-COOH (19, 22),
H2N-P450scc-OR-COOH (22), and
H2N-P45011ß-AdRed-Adx-COOH (24)
appears to be inconsistent with this explanation. Mutagenesis of the
Adx moiety in F2 eliminated activity, but mutagenesis of the AdRed
moiety did not (22). Using COS-F2130 cells, we have now
confirmed our earlier work with Adx mutagenesis (22)
showing that the F2 P450 moiety receives electrons only from the fused
F2 moiety and cannot receive electrons from free Adx, even when it is
overexpressed. Furthermore, our current data show that overexpression
of free AdRed does support increased F2 enzymatic activity, indicating
that free AdRed can donate electrons to the fused Adx moiety of F2. As
mutagenesis of the fused AdRed moiety of F2 did not reduce activity,
the current data would suggest that free AdRed is the principal source
of electrons employed by F2 fusion proteins.
 |
Acknowledgments
|
|---|
We thank Dr. Himanshu S. Bose for the recombinant N-62 StAR
protein, Dr. Maengseok Song for his valuable discussions, Dr. Ningwu
Huang for the GAPDH primers, and Dr. Jerome F. Strauss III for the
trilostane.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grants DK-37922, DK-42154, and
HD-34449 (to W.L.M.). 
Received December 18, 2000.
 |
References
|
|---|
-
Stone D, Hechter O 1955 Studies on ACTH action
in perfused bovine adrenals: aspects of progesterone as an intermediary
in cortico-steroidogenesis. Arch Biochem Biophys 54:121128[CrossRef]
-
Lambeth JD, Pember SO 1983 Cytochrome
P-450scc-adrenodoxin complex: reduction properties of the
substrate-associated cytochrome and relation of the reduction states of
heme and iron-sulfur centers to association of the proteins. J
Biol Chem 258:55965602[Free Full Text]
-
Privalle CT, Crivello JF, Jefcoate CR 1983 Regulation of intramitochondrial cholesterol transfer to side-chain
cleavage cytochrome P-450 in rat adrenal gland. Proc Natl Acad Sci USA 80:702706[Abstract/Free Full Text]
-
Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara
BC 1987 ACTH regulation of cholesterol movement in isolated
adrenal cells. J Steroid Biochem 27:721729[CrossRef][Medline]
-
Miller WL 1988 Molecular biology of steroid
hormone synthesis. Endocr Rev 9:295318[CrossRef][Medline]
-
Lambeth JD, Seybert D, Kamin H 1979 Ionic effects
on adrenal steroidogenic electron transport: the role of adrenodoxin as
an electron shuttle. J Biol Chem 254:72557264[Abstract/Free Full Text]
-
Hanukoglu I, Jefcoate CR 1980 Mitochondrial
cytochrome P-450scc: mechanism of electron transport by adrenodoxin.
J Biol Chem 255:30573061[Free Full Text]
-
Clark BJ, Wells J, King SR, Stocco DM 1994 The
purification, cloning and expression of a novel luteinizing
hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor
cells. Characterization of the steroidogenic acute regulatory protein
(StAR). J Biol Chem 269:2831428322[Abstract/Free Full Text]
-
Lin D, Sugawara T, Strauss III JF, Clark BJ, Stocco DM,
Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute
regulatory protein in adrenal and gonadal steroidogenesis. Science 267:18281831[Abstract/Free Full Text]
-
Stocco DM, Clark BJ 1996 Regulation of the acute
production of steroids in steroidogenic cells. Endocr Rev 17:221244[CrossRef][Medline]
-
Waterman MR, Simpson ER 1989 Regulation of steroid
hydroxylase gene expression is multifactorial in nature. Recent Prog
Horm Res 45:533566
-
Moore CCD, Miller WL 1991 The role of
transcriptional regulation in steroid hormone biosynthesis. J Steroid
Biochem Mol Biol 40:517525[CrossRef][Medline]
-
Hum DW, Miller WL 1993 Transcriptional regulation
of human genes for steroidogenic enzymes. Clin Chem 39:333340[Abstract]
-
Morisaki M, Duque C, Ikekawa H, Shikita M 1980 Substrate specificity of adrenocoritcal cytochrome P450. I. Effect of
structural modification of cholesterol side chain on pregnenolone
production. J Steroid Biochem 13:545550[CrossRef][Medline]
-
Jefcoate CR, Simpson ER, Boyd GS 1974 Spectral
properties of rat adrenal-mitochondrial cytochrome P-450.
Eur J Biochem 42:539551[Medline]
-
Toaff ME, Schleyer H, Strauss III JF 1982 Metabolism of 25-hydroxycholesterol by rat luteal mitochondria and
dispersed cells. Endocrinology 111:17851790[Abstract]
-
Stocco DM, Clark BJ, Lin D, Sugawara T, Strauss III JF,
Miller WL 1996 Characterization of the protein responsible for the
acute regulation of steroidogenesis in mouse Leydig tumor cells. In:
Desjardins C (ed) Cellular and Molecular Regulation of Testicular
Cells. Springer-Verlag, New York, pp 311336
-
Zuber MX, Mason JI, Simpson ER, Waterman MR 1988 Simultaneous transfection of COS-1 cells with mitochondrial and
microsomal steroid hydroxylases: incorporation of a steroidogenic
pathway into non-steroidogenic cells. Proc Natl Acad Sci USA 85:699703[Abstract/Free Full Text]
-
Harikrishna JA, Black SM, Szklarz GD, Miller WL 1993 Construction and function of fusion enzymes of the human
cytochrome P450scc system. DNA Cell Biol 12:371379[Medline]
-
Cao P, Bernhardt R 1999 Interaction of CYP11B1
(cytochrome P-45011ß) with CYP11A1 (cytochrome
P-450scc) in COS-1 cells. Eur J Biochem 262:720726[Medline]
-
Itoh S, Iemura O, Yoshimura T, Tsujikawa K, Yamada E,
Nonaka Y, Okamoto M, Mimura T, Kohama Y 1997 Simultaneous
expression of ferredoxin, ferredoxin reductase and P450 in COS7 cells.
Biochim Biophys Acta 1318:284290[Medline]
-
Black SM, Harikrishna JA, Szklarz GD, Miller WL 1994 The mitochondrial environment is required for activity of the
cholesterol side-chain cleavage enzyme, cytochrome P450scc. Proc Natl
Acad Sci USA 91:72477251[Abstract/Free Full Text]
-
Dilworth FJ, Black SM, Guo YD, Miller WL, Jones G 1996 Construction of a P450c27 fusion enzymea useful tool for
analysis of vitamin D3-25-hydroxylase activity.
Biochem J 320:267271
-
Cao P, Bulow H, Dumas B, Bernhardt R 2000 Construction and characterization of a catalytic fusion protein system:
P-45011ß-adrenodoxin reductase-adrenodoxin.
Biochim Biophys Acta 1476:253264[CrossRef][Medline]
-
Ellis L, Clauser E, Morgan DO, Edery M, Roth RA, Rutter
WJ 1986 Replacement of insulin receptor tyrosine residues 1162 and
1163 compromises insulin-stimulated kinase activity and uptake of
2-deoxyglucose. Cell 45:721732[CrossRef][Medline]
-
Brentano ST, Miller WL 1992 Regulation of human
P450scc and adrenodoxin mRNAs in JEG-3 cytotrophoblast cells.
Endocrinology 131:30103018[Abstract]
-
Brentano ST, Black SM, Lin D, Miller WL 1992 cAMP
post-transcriptionally diminishes the abundance of adrenodoxin
reductase mRNA. Proc Natl Acad Sci USA 89:40994103[Abstract/Free Full Text]
-
Gazdar AF, Oie HK, Shackleton CH, Chen TR, Triche TJ,
Myers CE, Chrousos GP, Brennan MF, Stein CA, LaRocca RV 1990 Establishment and characterization of a human adrenocortical carcinoma
cell line that expresses multiple pathways of steroid biosynthesis.
Cancer Res 50:54885496[Abstract/Free Full Text]
-
Staels B, Hum DW, Miller WL 1993 Regulation of
steroidogenesis in NCI-H295 cells: a cellular model of the human fetal
adrenal. Mol Endocrinol 7:423433[Abstract]
-
Rodriguez H, Hum DW, Staels B, Miller WL 1997 Transcription of the human genes for cytochrome P450scc and P450c17 is
regulated differently in human adrenal NCI-H295 cells than in mouse
adrenal Y1 cells. J Clin Endocrinol Metab 82:365371[Abstract/Free Full Text]
-
Huang N, Miller W 2000 Cloning of factors related
to HIV-inducible LBP proteins that regulate steroidogenic
factor-1-independent human placental transcription of the cholesterol
side-chain cleavage enzyme, P450scc. J Biol Chem 275:28522858[Abstract/Free Full Text]
-
Black SM, Szklarz GD, Harikrishna JA, Lin D, Wolf CR,
Miller WL 1993 Regulation of proteins of the cholesterol
side-chain cleavage system in Y-1 and JEG-3 cells. Endocrinology 132:539545[Abstract]
-
Lin D, Black SM, Nagahama Y, Miller WL 1993 Steroid
17
-hydroxylase and 17,20 lyase activities of P450c17: contributions
of serine106 and P450 reductase. Endocrinology 132:24982506[Abstract]
-
Bose HS, Whittal RM, Huang MC, Baldwin MA, Miller
WL 2000 N-218 MLN64, a protein with StAR-like steroidogenic
activity is folded and cleaved similarly to StAR. Biochemistry 39:1172211731[CrossRef][Medline]
-
Rickwood D, Wilson MT, Darly-Usmar VM 1987 Isolation and characterization of intact mitochondria. In: Darly-Usmar
VM, Rickwood D, Wilson MT (eds) Mitochondria: A Practical Approach. IRL
Press, Washington, DC, pp 116
-
Picado-Leonard J, Voutilainen R, Kao L, Chung B, Strauss
III JF, Miller WL 1988 Human adrenodoxin: cloning of three cDNAs
and cycloheximide enhancement in JEG-3 cells. J Biol Chem 263:32403244[Abstract/Free Full Text]
-
Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R,
Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie
F 1996 Molecular biology and genetics of the 3ß-hydroxysteroid
dehydrogenase/
5-
4 isomerase gene family. J Endocrinol [Suppl]
150:S189S207
-
Cherradi N, Rossier MF, Vallotton MB, Timberg R,
Friedberg I, Orly J, Wang XJ, Stocco DM, Capponi AM 1997 Submitochondrial distribution of three key steroidogenic proteins
(steroidogenic acute regulatory protein and cytochrome P450scc and
3ß-hydroxysteroid dehydrogenase isomerase enzymes) upon stimulation
by intracellular calcium in adrenal glomerulosa cells. J Biol Chem 272:78997907[Abstract/Free Full Text]
-
King SR, Ronen-Fuhrmann T, Timberg R, Clark BJ, Orly J,
Stocco DM 1995 Steroid production after in vitro transcription,
translation, and mitochondrial processing of protein products of
complementary deoxyribonucleic acid for steroidogenic acute regulatory
protein. Endocrinology 136:51655176[Abstract]
-
Arakane F, Kallen CB, Watari H, Foster JA, Sepuri NBV,
Pain D, Stayrook SE, Lewis M, Gerton GL, Strauss III JF 1998 The
mechanism of action of steroidogenic acute regulatory protein (StAR):
StAR acts on the outside of mitochondria to stimulate steroidogenesis.
J Biol Chem 273:1633916345[Abstract/Free Full Text]
-
Kallen CB, Billheimer JT, Summers SA, Stayrook SE, Lewis
M, Strauss III JF 1998 Steroidogenic acute regulatory protein
(StAR) is a sterol transfer protein. J Biol Chem 273:2628526288[Abstract/Free Full Text]
-
Sugawara T, Holt JA, Driscoll D, Strauss III JF, Lin D,
Miller WL, Patterson D, Clancy KP, Hart IM, Clark BJ, Stocco DM 1995 Human steroidogenic acute regulatory protein (StAR): functional
activity in COS-1 cells, tissue-specific expression, and mapping of the
structural gene to 8p11.2 and an expressed pseudogene to chromosome 13.
Proc Natl Acad Sci USA 92:47784782[Abstract/Free Full Text]
-
Arakane F, Sugawara T, Nishino H, Liu Z, Holt JA, Pain
D, Stocco DM, Miller WL, Strauss III JF 1996 Steroidogenic acute
regulatory protein (StAR) retains activity in the absence of its
mitochondrial targeting sequence: implications for the mechanism of
StAR action. Proc Natl Acad Sci USA 93:1373113736[Abstract/Free Full Text]
-
Fujieda K, Tajima T, Nakae J, Sageshima S, Tachibana K,
Suwa S, Sugawara T, Strauss III JF 1997 Spontaneous puberty in
46,XX subjects with congenital lipoid adrenal hypreplasia. J Clin
Invest 99:12651271[Medline]
-
Nakae J, Tajima T, Sugawara T, Arakane F, Hanaki K,
Hotsubo T, Igarashi N, Igarashi Y, Ishii T, Koda N, Kondo T, Kohno H,
Nakagawa Y, Tachibana K, Takeshima Y, Tsubouchi K, Strauss III JF,
Fujieda K 1997 Analysis of the steroidogenic acute regulatory
protein (StAR) gene in Japanese patients with congenital lipoid adrenal
hyerplasia. Hum Mol Genet 6:571576[Abstract/Free Full Text]
-
Wang X, Liu Z, Eimerl S, Weiss AM, Orly J, Stocco
DM 1998 Effect of truncated forms of the steroidogenic acute
regulatory (StAR) protein on intramitochondrial cholesterol transfer.
Endocrinology 139:39033912[Abstract/Free Full Text]
-
Katsumata N, Kawada Y, Yamamoto Y, Noda M, Nimura A,
Horikawa R, Tanaka T 1999 A novel compound heterozygous mutation
in the steroidogenic acute regulatory protein gene in a patient with
congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 84:39833987[Abstract/Free Full Text]
-
Bose HS, Whittal RM, Baldwin MA, Miller WL 1999 The
active form of the steroidogenic acute regulatory protein, StAR,
appears to be a molten globule. Proc Natl Acad Sci USA 96:72507255[Abstract/Free Full Text]
-
Narhi LO, Fulco AJ 1986 Characterization of a
catalytically self-sufficient 119,000-dalton P450 monooxygenase induced
by barbiturates in Bacillus megaterium. J Biol Chem 261:71607169[Abstract/Free Full Text]
-
Narhi LO, Fulco AJ 1987 Identification and
characterization of two functional domains in cytochrome P-450BM-3, a
catalytically self-sufficient monooxygenase induced by barbiturates in
Bacillus megaterium. J Biol Chem 262:66836690[Abstract/Free Full Text]
-
Murakami H, Yabusaki Y, Sakaki T, Shibata M, Ohkawa
H 1987 A genetically engineered P450 monooxygenase: construction
of the functional fused enzyme between rat cytochrome P450c and
NADPH-cytochrome P450 reductase. DNA 6:189197[Medline]
-
Yabusaki Y, Murakami H, Ohkawa H 1988 Primary
structure of Saccharomyces cerevisiae NADPH-cytochrome P450
reductase deduced from nucleotide sequence of its cloned gene. J
Biochem 103:10041010[Abstract/Free Full Text]
-
Sakaki T, Shibata M, Yabusaki Y, Murakami H, Ohkawa
H 1990 Expression of bovine cytochrome P450c21 and its fused
enzymes with yeast NADPH-cytochrome P450 reductase in
Saccaromyces cerevisiae. DNA Cell Biol 9:603614[Medline]
-
Shibata M, Sakaki T, Yabusaki Y, Murakami H, Ohkawa
H 1990 Genetically engineered P450 monoxygenases: construction of
bovine P450c 17/yeast reductase fused enzymes. DNA Cell Biol 9:2736[Medline]
-
Fisher CW, Shet MS, Caudle DL, Martin-Wixtrom CA,
Estabrook RW 1992 High-level expression in Escherichia coli of
enzymatically active fusion proteins containing the domains of
mammalian cytochromes P450 and NADPH-P450 reductase flavoprotein. Proc
Natl Acad Sci USA 89:1081710821[Abstract/Free Full Text]
-
Hanukoglu I, Suh BS, Himmelhoch S, Amsterdam A 1990 Induction and mitochondrial localization of cytochrome P450scc system
enzymes in normal and transformed ovarian granulosa cells. J Cell
Biol 111:13731381[Abstract/Free Full Text]
-
Coghlan VM, Vickery LE 1991 Site-specific mutations
in human ferredoxin that affect binding to ferredoxin reductase and
cytochrome P450scc. J Biol Chem 266:1860618612[Abstract/Free Full Text]
-
Coghlan VM, Vickery LE 1992 Electrostatic
interactions stabilizing ferredoxin electron transfer complexes:
disruption by "conservative" mutations. J Biol Chem 267:89328935[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. Liu, M. B. Rone, and V. Papadopoulos
Protein-Protein Interactions Mediate Mitochondrial Cholesterol Transport and Steroid Biosynthesis
J. Biol. Chem.,
December 15, 2006;
281(50):
38879 - 38893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Tuckey, H. S. Bose, I. Czerwionka, and W. L. Miller
Molten Globule Structure and Steroidogenic Activity of N-218 MLN64 in Human Placental Mitochondria
Endocrinology,
April 1, 2004;
145(4):
1700 - 1707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Tuckey, M. J. Headlam, H. S. Bose, and W. L. Miller
Transfer of Cholesterol between Phospholipid Vesicles Mediated by the Steroidogenic Acute Regulatory Protein (StAR)
J. Biol. Chem.,
November 27, 2002;
277(49):
47123 - 47128.
[Abstract]
[Full Text]
[PDF]
|
 |
|