Endocrinology Vol. 142, No. 6 2252-2259
Copyright © 2001 by The Endocrine Society
Adenovirus-Directed Expression of Functional Luteinizing Hormone (LH) Receptors in Undifferentiated Rat Granulosa Cells: Evidence for Differential Signaling through Follicle-Stimulating Hormone and LH Receptors1
Zourab Bebia,
Jeremy P. Somers,
Guoquan Liu,
Lynda Ihrig,
Andrew Shenker and
Anthony J. Zeleznik
Department of Cell Biology and Physiology (Z.B., J.P.S., L.I.,
A.J.Z.), University of Pittsburgh School of Medicine, Pittsburgh,
Pennsylvania 15261; and Department of Pediatrics, Northwestern
University Medical School (G.L., A.S.), Chicago, Illinois
60614
Address all correspondence and requests for reprints to: Anthony J. Zeleznik, Ph.D., Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, S-327 Biomedical Science Tower, 3500 Terrace Street, Pittsburgh, Pennsylvania 15261. E-mail:
zeleznik+{at}pitt.edu
 |
Abstract
|
|---|
This study was conducted to determine the feasibility of using
replication-defective adenovirus vectors to express receptors for LH.
Two vectors were constructed, one that directs the expression of
wild-type human LH receptor (LHr; AdRSVLHrwt) and another that directs
the expression of the constitutively activated D578H mutant human LH
receptor (AdRSVD578HLHr). When infected with AdRSVwtLHr and
AdRSVD578HLHr, COS-1 cells expressed LH/hCG-binding sites as reflected
by specific binding of [125I]hCG. To determine the
ability of the vectors to confer LH responsiveness, undifferentiated
rat granulosa cells, which possess only FSH receptors, were infected
with AdRSVwtLHr and AdRSVD578HLHr. Expression of the constitutively
activated D578H LHr increased basal (gonadotropin-independent) estrogen
and progesterone production. Expression of the wild-type LHr in
granulosa cells did not stimulate basal steroid production, but
conferred responsiveness to exogenous LH. For both wild-type LHr and
D578HLHr, the absolute levels of steroid production were dependent upon
the input of viral titers.
Using these vectors, we compared effects of FSH and LH receptor
activation in undifferentiated granulosa cells. Stimulation of
undifferentiated granulosa cells by FSH and D578HLHr, as well as
activation of wild-type LHr with LH resulted in comparable production
of progesterone. In contrast, estradiol production in cells stimulated
with FSH was greater than that in cells that expressed either D578H
receptors or wild-type LHr in the presence of LH. Analysis of messenger
RNAs (mRNAs) revealed that activations of FSH and the LH receptors were
comparable in the induction of
-inhibin and 3ßhydroxysteroid
dehydrogenase mRNAs. However, activation of FSH receptor led to
significantly greater expression of P450 aromatase and LHr mRNAs than
did activation of LHr. These results suggest that activation of FSH and
LH receptors in granulosa cells may differ with respect to activating
intracellular signaling pathways and stimulating gene expression.
 |
Introduction
|
|---|
FOLLICULAR DEVELOPMENT is dependent upon
the successive actions of FSH and LH. FSH, acting on immature early
antral follicles, stimulates the expression of aromatase as well as the
expression of the LH receptor (LHr). LH, acting on the FSH-stimulated
follicle, stimulates luteinization of the follicle and the production
of progesterone by the luteinizing granulosa cells (1, 2).
Both FSH and LH stimulate cAMP production by granulosa cells (3, 4). However, the differences in the responses of granulosa cells
to FSH and LH with respect to the pattern of steroid secretion
(estrogen vs. progesterone) as well as cellular
proliferation has led to the suggestion that there may be signaling
pathways in addition to cAMP that are used differentially by FSH and LH
(2, 5). A difficulty in comparing the responses of
granulosa cells to FSH and LH is that to analyze the actions of LH,
granulosa cells must first be stimulated by FSH to induce LH receptors.
Thus, it is uncertain whether any differences in the responses of
granulosa cells to FSH and LH receptor activation are due to
differences in intracellular signaling or whether they are due to
development-dependent, FSH-mediated changes in expression of
steroidogenic enzymes and other regulatory proteins involved in
granulosa cell differentiation.
For ongoing studies on regulation of the primate corpus luteum, we
developed adenovirus vectors that direct the expression of either the
wild-type human LHr or the constitutively activated D578H human LHr
(6), with the goal of using these for in vivo
studies in monkeys. To test the functionality of these vectors, we used
them to infect undifferentiated rat granulosa cells. Herein we show
that these vectors are able to confer LH responsiveness to immature
undifferentiated rat granulosa cells and moreover that there may be
differences in the responses of undifferentiated granulosa cells to
activation of FSH and LH receptors.
 |
Materials and Methods
|
|---|
Unless otherwise noted, all regents were purchased from
Sigma (St. Louis, MO). Human FSH (AFP-4161-B; 3205 IU
Second International Reference Preparation of FSH/mg, 225 IU Second
International Reference Preparation of LH/mg), human LH (AFP-0642-B;
4015 IU Second International Reference Preparation of LH/mg, <5 IU
Second International Reference Preparation of FSH/mg), and antiserum to
cAMP (lot CV-27) were provided by the National Hormone and Pituitary
Program, NIDDK, NIH.
Adenovirus shuttle vectors pAdRSVwtLHr-c-FLAG-NpA and pAdRSV D578H
LHr-c-FLAG-NpA were constructed identically. A 2147-bp insert
containing either the wtLHr or the D578H LHr-coding region fused
in-frame to a sequence encoding the FLAG epitope
(GACTACAAGGACGACGATGACAAG) upstream from the stop codon was excised
from the expression vectors pSG5wtLHr c-FLAG and pSG5 D578HLHr c-FLAG
by digestion with EcoRI (Promega Corp., Madison
WI) and subcloned by blunt end ligation into EcoRV-digested
adenovirus shuttle vector pAd5RSVK-NpA (gift from Dr. Beverly L.
Davidson, Department of Internal Medicine, University of Iowa College
of Medicine, Ames, IA). Addition of the C-terminal FLAG epitope has no
effect on the expression or functional activity of the wt and D578H
mutant receptor (our unpublished results).
Ten micrograms of either pAdRSVwtLHr-c-FLAG-NpA or pAdRSV D578H
LHr-c-FLAG-NpA were cotransfected with 10 µg of the plasmid pJM17, a
plasmid containing a circularized adenovirus type 5 (variant dl309)
genome (7), into the human embryonic kidney cell line 293
(8) using a calcium phosphate transfection system
according to the manufacturers instructions (Life Technologies, Inc., Gaithersburg, MD). Twenty-four hours later, the cells were
overlaid with semisolid medium consisting of 1.0% (wt/vol) GTG-low
melting point agarose (FMC Corp., Rockland, ME) in Dulbeccos Modified
Eagles Medium containing 4.5 g/liter glucose (Life Technologies, Inc.) and 3% FBS at 37 C in 5%
CO2. Fourteen days after transfection, plaques
exhibiting viral cytopathic effect were identified and collected. Cells
and virus from individual plaques were frozen on dry ice, thawed three
times, and further propagated in 293 cells. When the cells exhibited
complete viral cytopathic effect, the cells and medium were collected,
frozen on dry ice three times, and then centrifuged (1000 x
g, 4 C, 10 min) to remove cellular debris. Aliquots of virus
stocks were diluted 50- and 100-fold in lysis solution [0.1% SDS, 10
mM Tris-HCl (pH 7.4), and 1
mM EDTA] and incubated for 10 min at 56 C in a
shaking water bath. The OD of the samples was measured at 260 nm, and
the value obtained was used to calculate virus content using the
equation 1012 virus particles/ml/OD 260 U
(9). Adenoviruses were propagated by infecting 293 cells
with approximately 108 particles/ml in tissue
culture medium without serum. Infected cells were incubated until they
exhibited a nearly complete cytopathic effect and were processed as
described above. Virus stocks were prepared to a concentration of
5 x 1012 particles/ml as described above
and were diluted for use as indicated in Results.
[125I]hCG binding analysis
COS-1 cells, maintained in Dulbeccos Modified Eagles Medium
and 10% FBS, were infected with AdRSVwtLHr or AdRSV D578H LHr (5
x 1010 particles/ml). Seventy-two hours after
infection, cells were scraped from the culture dishes and resuspended
in PBS-0.1% BSA. [125I]hCG (CR 123) was
prepared to a specific activity of 60100 µCi/µg by the
chloramine-T method (10). Aliquots of COS-1 cells (50 µg
total cell protein) were incubated in duplicate with 1 x
105 cpm [125I]hCG in a
total volume of 250 µl for 6 h at room temperature in the
absence and presence of varying concentrations of unlabeled hFSH or
hLH. After incubation, cells were washed with 2 ml PBS-0.1% BSA and
centrifuged at 3000 x g for 30 min. The supernatant
was decanted, and cell-associated radioactivity was measured with a
-spectrometer.
Granulosa cell culture
All procedures were approved by the University of Pittsburgh
Institutional animal use and care committee. Immature female rats (20
or 25 days old) were purchased from Taconic Farms, Inc.
(Germantown, NY). Granulosa cells were collected from the ovaries by
puncturing follicles with a 25-gauge hypodermic needle, and cells were
expressed into medium 199 (M199; Life Technologies, Inc.)
containing 10% FBS. Granulosa cells were seeded into 6-well
(
106 cells/well) or 24-well (
2 x
105 cells/well) tissue culture plates and allowed
to attach overnight. The next morning, medium and unattached cells were
removed, and the granulosa cell monolayers were exposed to adenoviruses
in M199 without protein supplements for 2 h at 37 C with
occasional rocking. Medium was replaced with fresh M199 containing 1
mg/ml BSA. Twenty-four hours after exposure to adenoviruses, medium was
removed and replaced with M199 plus BSA also containing 50 ng/ml
testosterone alone or in combination with hFSH or hLH. Forty-eight
hours after the addition of hormones, tissue culture medium was
collected, boiled for 10 min to inactivate phosphodiesterases, and
stored at -20 C for subsequent RIAs. Total RNA was prepared from the
cell monolayers using RNAzol B (Tel-Test, Inc.,
Friendswood, TX) according to the manufacturers directions.
Messenger RNA (mRNA) analysis
Samples of total RNA (15 µg) were analyzed for mRNAs for
cytochrome P450 aromatase (P450arom), 3ß-hydroxysteroid dehydrogenase
(3ßHSD), the
-subunit of inhibin, and the LH receptor by
ribonuclease protection assay according to the instructions provided by
the supplier (Ambion, Inc., Austin, TX). Antisense RNA
probes were prepared using [32P]UTP from the
following complementary DNA inserts: P450arom (bp 10341295)
(11), rat LH receptor (bp 1622) (12),
-subunit of inhibin (bp 694-1095) (13), 3ßHSD (bp
453932) (14), and cyclophylin (bp 34142)
(15). Following electrophoresis (5% acrylamide containing
8 M urea), gels were dried and exposed to x-ray film for
1696 h. Densitometric analysis of protected RNA fragments was
performed using NIH Image (version 1.61). Densitometric signals from
individual bands were divided by the respective density for cyclophylin
to correct for differences in gel loading. For data presentation and
statistical analysis, all values for individual mRNAs are expressed in
relationship to the mean signal intensity of the respective mRNA in
response to stimulation by 100 ng/ml FSH.
RIA
Estradiol and progesterone concentrations in culture medium were
determined by RIAs as described previously (16). cAMP
concentrations in culture medium were analyzed by RIA using
[125I]cAMP-TME (20'-monosuccinlyl cAMP
tyrosine methyl ester) (17) and anti-cAMP in accordance
with the instructions provided by the National Hormone and Pituitary
Program.
Statistics
Results were assessed for statistical significance by AVOVA,
followed by comparison of group means with Fishers least significant
difference analysis (StatView version 4.5, Abacus Concepts, Berkeley,
CA).
 |
Results
|
|---|
Adenovirus-directed expression of wild-type and constitutively
activated D578H human LHr
COS-1 cells were infected with Ad RSVwtLHr and AdRSVD578HLHr, and
72 h later [125I]hCG binding was
assessed. As shown in Fig. 1
, functional LH/hCGbinding sites were expressed in cells infected
with both AdRSVwtLHr and AdRSVD578HLHr. Binding of
[125I]hCG was specific, as unlabeled hLH, but
not hFSH, effectively competed with [125I]hCG
for binding to ectopically expressed LH receptors.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1. Adenovirus vectors direct the expression of
[125I]hCG-binding sites in COS-1 cells. COS-1 cells were
infected with either AdRSVLHrwt or AdRSV D578HLHr at a titer of
5 x 1010 particles/ml. Seventy-two hours later
cells were scraped from culture dishes, and aliquots of cells ( 50 mg
cell protein) were incubated with 1 x 105 cpm
[125I]hCG in the presence or absence of increasing
amounts of unlabeled hFSH or LH. Free hormone was removed by
centrifugation, and cell-associated radioactivity was measured.
Untreated COS-1 cells did not exhibit [125I]hCG binding
above background levels. Results show means of duplicate incubations.
|
|
To determine whether the adenovirus vectors also confer LH
responsiveness, immature rat granulosa cells, which lack LH receptors,
were infected with various concentrations of AdRSVwtLHr and
AdRSVD578HLHr and incubated in medium 199 and 0.1% BSA for 24 h.
Granulosa cells infected with AdRSVwtLHr were then incubated for
48 h in the presence or absence of 100 ng/ml hLH, whereas cells
infected with AdRSVD578HLHr were incubated in the absence of LH for
48 h. As shown in Fig. 2
, immature
rat granulosa cells infected with AdRSVwtLHr did not exhibit enhanced
steroid production in the absence of hLH, but addition of hLH to the
medium led to the production of estrogen and progesterone. Exposure to
Ad RSV D578HLHr led to increased production of both estradiol and
progesterone by immature granulosa cells in the absence of stimulation
by hLH, as would be predicted by the LH-independent constitutive
activity of this mutant LH receptor. For both the wild-type and
constitutively activated LH receptors, the absolute levels of steroid
production were dependent upon the input viral titers, as
increases in progesterone and estradiol production were observed in
response to increases in exposure to both AdRSVwtLHr and
AdRSVD578HLHr.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 2. Replication-defective adenovirus vectors confer LH
responsiveness to undifferentiated rat granulosa cells.
Undifferentiated rat granulosa cells were plated overnight in the
medium 199 containing 10% FBS. The next morning medium and unattached
cells were removed, and monolayers were exposed to adenoviruses (LHr
wild-type or LHr D578H) for 2 h, after which the virus-containing
medium was removed and replaced with fresh medium 199 and 1 mg/ml BSA.
After 24 h, medium was replaced with fresh medium 199 and BSA, 50
ng/ml testosterone, and LH (100 ng/ml). Forty-eight hours later medium
was collected and analyzed for estradiol and progesterone content by
RIA. The 1:100 dilution of adenovirus corresponds to a viral titer of
5 x 1010 particles/ml. Results show the mean ±
1 SEM of three separate groups of granulosa cells.
|
|
Comparison of the steroidogenic responses of immature rat granulosa
cells to stimulation through the native FSH receptor and virus-directed
LH receptors
Undifferentiated granulosa cells were stimulated with FSH or were
infected with adenoviruses that direct the expression of wild-type or a
constitutively activated LH receptor to determine whether there are
differences in the responses of these cells to activation of FSH and LH
receptors. As shown in Fig. 3
, as
expected, both estrogen and progesterone production by undifferentiated
granulosa cells was stimulated by FSH, whereas these cells were
unresponsive to LH because they lack LH receptors. Infection of cells
with Ad RSVLHrwt did not affect basal steroidogenesis (as depicted by
the LHrwt-LH bars), but conferred LH responsiveness with respect to
both estrogen and progesterone production, as indicated by the LHrwt+LH
bars. The constitutively activated LHr stimulated estrogen and
progesterone production independently of gonadotropic stimulation.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3. Steroidogenic responses of undifferentiated
granulosa cells and those expressing wild-type and constitutively
activated D578H LH receptors. Undifferentiated rat granulosa cells were
plated overnight in medium 199 containing 10% FCS. The next morning
medium and unattached cells were removed, and monolayers were exposed
to medium alone or adenoviruses (LHr wild-type or LHr D578H) at a 1:100
dilution (5 x 1010 particles/ml) for 2 h, after
which the virus-containing medium was removed and replaced with fresh
medium 199 and 1 mg/ml BSA. After 24 h, medium was replaced with
fresh medium 199 and BSA, 50 ng/ml testosterone, and LH (100 ng/ml) or
FSH (100 ng/ml). Forty-eight hours later medium was collected and
analyzed for estradiol and progesterone content by RIA. Results show
the mean ± 1 SEM of three separate groups of
granulosa cells. The average total RNA content per well was 5.5 µg.
|
|
The extent of progesterone production was similar for cells stimulated
by FSH, for cells expressing the wild-type LHr and stimulated with LH,
and for cells expressing constitutively activated LHr. In each group,
progesterone production was significantly stimulated over control
values (P < 0.05), but there were no significant
differences between the extent of progesterone production between cells
stimulated by FSH, cells expressing the wild-type LHr and stimulated
with LH, and cells expressing the constitutively activated receptors
(P > 0.05). In contrast to the comparable production
rates of progesterone in response to either FSH or LH receptor
activation, there was a marked difference in the production of
estrogen. Granulosa cells expressing the wild-type LHr responded to LH
with increased estradiol production, whereas expression of the
constitutively activated D578HLHr resulted in a comparable increase in
estrogen production in the absence of LH. However, FSH stimulation
resulted in a substantially greater increase in estrogen production by
immature granulosa cells, which was significantly greater than that of
granulosa cells that expressed either the wild-type or the
constitutively activated LH receptors (P < 0. 05).
Comparison of mRNAs associated with granulosa cell differentiation
in response to stimulation through the native FSH receptor and
virus-directed LH receptors
After collection of medium from granulosa cells for the steroid
analysis shown in Fig 3
, total RNA was prepared from the cells and
analyzed for levels of mRNA for
-inhibin, 3ßHSD, LHr, and P450arom
by ribonuclease protection assays. As shown in Fig. 4
, stimulation of immature granulosa
cells by FSH resulted in a significant increase in
-inhibin,
3ßHSD, LHr, and P450arom mRNAs (P < 0.05) compared
to unstimulated cells. Likewise, granulosa cells expressing the
wild-type hLH receptor and stimulated by LH as well as granulosa cells
expressing the constitutively activated D578HLHr showed significant
increases in
-inhibin mRNA levels (P < 0.05).
However, cells expressing the wild-type LHr and stimulated by LH as
well as cells expressing the constitutively activated D578HLHr
exhibited a much weaker stimulation of 3ßHSD and P450arom compared to
FSH, whereas a detectable LHr mRNA fragment was not seen in RNA
prepared from these cells.
Comparison of cAMP production in response to stimulation through
the native FSH receptor and virus-directed LHr
Although the aforementioned results are suggestive that there may
be differences in the responses of immature rat granulosa cells to
activation of FSH and LH receptors subsequent analysis of cAMP levels
(Table 1
) revealed that although both
activation of the native FSH receptor as well as the recombinant LHr
stimulated cAMP production, there were differences in the absolute
amounts of cAMP produced in response to the individual treatments. In
particular, levels of cAMP were higher in cells stimulated by FSH than
in cells that expressed either the wild-type LHr or the constitutively
activated LH receptor.
View this table:
[in this window]
[in a new window]
|
Table 1. cAMP production by undifferentiated granulosa cells
and those expressing wild-type and constitutively activated LH D578H
receptors
|
|
Steroidogenic responses of immature rat granulosa cells to
activation of FSH and LH receptors that result in comparable levels of
cAMP production
In attempt to achieve comparable levels of cAMP production,
immature granulosa cells were stimulated with hFSH (25 and 100 ng/ml)
and varying concentrations of AdRSVD578HLHr. As shown in Table 2
, comparable levels of cAMP were
produced in response to 25 ng/ml FSH and AdRSVD578HLHr at a dilution of
1:150 and in response to FSH at 100 ng/ml and AdRSV D578H LHr at a
dilution of 1:100. Granulosa cells infected with AdRSVD578HLHr at an
input of 1:50 produced slightly greater amounts of cAMP than FSH at 100
ng/ml.
View this table:
[in this window]
[in a new window]
|
Table 2. Dose-dependent cAMP production by undifferentiated
granulosa cells stimulated with FSH or infected with AdRSVD578HLHr
|
|
Figure 5
illustrates estrogen and
progesterone production levels in this set of experiments. Progesterone
production was similar in response to activation of either FSH or LH
receptors. Mean estradiol levels were greater in response to FSH
stimulation compared with cells expressing the constitutively activated
LHr. However, these differences did not reach statistical significance
at the 0.05 level.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5. Dose-dependent steroid responses of granulosa
cells stimulated with FSH or transfected with constitutively activated
D578H LHr. Undifferentiated granulosa cells were exposed to either hFSH
(25 and 100 ng/ml) or AdRSV D578HLHr at 1:150, 1:100, and 1:50
dilutions. Forty-eight hours after the addition of FSH, medium was
collected for analysis of estradiol and progesterone. Results show the
mean ± 1 SEM of three separate groups of granulosa
cells. The average total RNA content per well was 7.0 µg.
|
|
Figure 6
illustrates that
-inhibin
mRNA levels were stimulated at all concentrations of FSH and all inputs
of AdRSVD578HLHr. Likewise, both stimulation by FSH and expression of
the constitutively activated LH receptor stimulated 3ßHSD mRNA
accumulation. At equivalent production rates of cAMP, FSH stimulation
led to a greater expression of P450arom than did expression of
D578HLHr. Similar to the results shown in Fig. 4
, AdRSVD578HLHr was
relatively ineffective in stimulating LHr mRNA. There were no
significant differences between FSH (25 or 100 ng/ml) and AdRSV
D578HLHr at 1:150 or 1:100 dilution on the expression of
-inhibin
mRNA. Likewise, there were no significant differences between FSH at 25
ng/ml and AdRSV D578HLHr at 1:150 or between FSH at 100 ng/ml and
AdRSVD578H LHr at 1:100 in the stimulation of 3ßHSD mRNA. FSH at 100
ng/ml was more effective than AdRSVD578HLHr at 1:150, 1:100, and 1:50
dilutions with respect to induction of P450arom and LHr mRNAs
(P < 0.05).
Comparison of responses of undifferentiated granulosa cells to FSH,
AdRSVD578HLHr, forskolin, and 8-bromo-cAMP (8BrcAMP)
To further investigate the apparent selective induction of LHr and
P450arom by FSH, we compared the effects of FSH, AdRSVD578HLHr, 10
µM FSK, and 0.5 mM 8BrcAMP on the expression
of mRNAs for
-inhibin, 3ßHSD, P450arom, and the LH receptor.
Results presented in Fig. 7
demonstrate
again that FSH stimulation selectively induces mRNAs for the LHr as
well as P450arom and that the responses of undifferentiated granulosa
cells to FSK and 8BrcAMP were similar to activation of the LH
receptor.

View larger version (85K):
[in this window]
[in a new window]
|
Figure 7. Comparison of responses of undifferentiated
granulosa cells to FSH, AdRSVD578HLHr, forskolin, and 8BrcAMP.
Undifferentiated rat granulosa cells were plated overnight in medium
199 containing 10% FCS. The next morning medium and unattached cells
were removed, and monolayers were exposed to medium alone or
AdRSVLHrD578H at 1:100 dilution (5 x 1010
particles/ml) for 2 h, after which the virus-containing medium was
removed and replaced with fresh medium 199 and 1 mg/ml BSA. After
24 h, medium was replaced with fresh medium 199 and BSA, 50 ng/ml
testosterone and FSH (100 ng/ml), forskolin (FSK; 10 µM),
or 8BrcAMP (0.5 mM). Forty-eight hours later total RNA was
prepared from the monolayers and analyzed for mRNAs by ribonuclease
protection assay.
|
|
Adenovirus-directed expression of ß-galactosidase does not affect
FSH-stimulated cAMP, steroidogenesis, or mRNA levels
In four separate groups of granulosa cells, basal cAMP production
was 0.1 ± 0.04 pmol/ml·48 h, which was increased to 20.62
± 4.26 pmol/ml·48 h by 100 ng/ml FSH. Infection of cells with
ADRSVß-gal did not affect either basal cAMP production (0.08 ±
0.03 pmol/ml·48 h) or FSH-stimulated cAMP production (18.76 ±
1.09 pmol/ml·48 h). Likewise, AdRSVß-gal did not affect
FSH-stimulated estradiol production (17.9 ± 3.75 vs.
15.57 ± 2.67 ng/ml·48 h) or progesterone production (8.16
± 1.58 vs. 7.42 ± 1.41 ng/ml·48 h) for noninfected
and infected cells, respectively. mRNAs for P450arom, LHr, 3ßHSD, and
-inhibin were similar for FSH-stimulated cells in the presence or
absence of AdRSVß-gal (data not shown).
 |
Discussion
|
|---|
Granulosa cells from immature follicles produce cAMP in response
to FSH, but not LH, due to their lack of LH receptors, whereas
granulosa cells from preovulatory follicles, which possess both FSH and
LH receptors, produce cAMP in response to both FSH and LH
(2). A long-standing question is why there are differences
in the effects of FSH and LH on granulosa cell function if both FSH and
LH act through the cAMP signaling system. The principal responses of
granulosa cells to FSH stimulation are the induction of aromatase and
LH receptors, which are responsible for the production of estrogen and
the ability of the follicle to ovulate and luteinize in response to the
midcycle LH surge (18, 19). The major physiological
response to LH is ovulation, luteinization, and the production of
progesterone. In addition, LH stimulation of granulosa cells results in
the suppression of aromatase as well as down-regulation of LH receptors
(20, 21). One hypothesis for these separate effects is
that LH appears to be more effective in stimulating cAMP production
than FSH and that differences in the responses to FSH and LH could be
due to differences in intracellular concentrations of cAMP generated by
the two hormones (22). Another possibility is that, in
addition to cAMP, other signaling pathways may be used by the
gonadotropins (5). An inherent problem in comparing the
responses of granulosa cells to FSH and LH is that to study LH
responsiveness, granulosa cells must first undergo FSH-mediated
differentiation, which, in addition to the induction of LH receptors,
is associated with major changes in steroidogenic enzymes
(2), accessory proteins involved in steroidogenesis
(23), as well as changes in the downstream protein kinase
A signaling system (24, 25). Thus, comparing the responses
of immature granulosa cells to FSH with the responses of differentiated
granulosa cells to LH could be confounded by the differences in the
state of differentiation of the cells.
We demonstrated previously that replication-defective adenovirus
vectors are able to efficiently direct the expression of recombinant
proteins in granulosa cells as more than 90% of granulosa cells in
primary culture exhibit adenovirus-directed expression of
ß-galactosidase and green fluorescent protein reporter genes without
adverse effects on cellular function (26). Because
virtually all cells in culture are infected by virus, direct analysis
of specific proteins on granulosa cell function can be assessed. In the
current study, using adenovirus vectors that direct the expression of
wild-type and a constitutively activated human LHr, we compared the
responses of immature rat granulosa cells to FSH and LH, thereby
eliminating the confounding variable of FSH-induced cellular
differentiation.
Our current findings indicate that activation of the FSH receptor
appeared to be more effective than activation of the LHr on the
induction of mRNAs for aromatase and the LHr, whereas both receptors
were similar with respect to stimulation of mRNAs encoding
-inhibin
and 3ßHSD. Functionally, the FSHr appeared to be more effective in
stimulating estrogen production, whereas progesterone production in
response to activation of FSH and LH receptors was comparable. The
differences in the responses to activation of FSH and LH did not appear
to be due to differences in the absolute levels of cAMP accumulation,
as adjusting the FSH concentrations and the concentrations of
AdRSVD578HLHr to produce comparable levels of cAMP still resulted in
the differential induction of aromatase and LHr mRNAs by FSH. Our
observation that the preferential induction of the LHr by FSH in the
presence of comparable levels of cAMP is in agreement with the previous
findings of Welsh et al. (27) that demonstrated
that FSH was more effective than forskolin in inducing LHr on immature
granulosa cells at concentrations of each that resulted in similar
production rates of cAMP and comparable levels of progesterone
production. Similarly, Davoren and Hsueh (28) demonstrated
that although FSH and vasoactive intestinal peptide stimulated
progesterone production comparably by immature granulosa cells, FSH was
more effective in inducing LHr. Thus, under a number of different
approaches the FSH receptor, which is the physiological regulator of
granulosa cell differentiation, appears to be more effective than other
agents that stimulate cAMP production in regulating the hallmark genes
involved in granulosa cell differentiation, P450 aromatase and the LHr.
Physiologically, this could protect the ovary from inappropriate
stimulation by other cAMP-stimulating agents such as catecholamines,
etc.
Preferential action of FSH on immature granulosa cells is not absolute,
in that activation of the wild-type LHr by LH as well as expression of
the constitutively activated LHr did result in the induction of
aromatase mRNA and estrogen production, albeit to an apparently lesser
extent than did FSH. Likewise, although of very low intensity, we did
observe protected fragments for the rat LHr in cells stimulated by
AdRSV D578HLHr. These observations indicate that the activation of FSH
and LH receptors does not result in unique responses of granulosa cells
to each receptor, but, rather, that there is overlap between the
activities of FSH and LH receptors. As documented in the literature,
this is also apparent in granulosa cells that have undergone
FSH-mediated differentiation. In these cells, substituting FSH with LH
maintained their differentiated phenotype (29).
Physiologically, this overlap may play a fundamental role in the
process of follicular selection as recent studies in humans and sheep
have shown that LH is able to maintain follicular development in the
presence of declining FSH concentrations (30, 31).
Finally, the observations that at appropriate dosages, recombinant FSH
in the absence of LH is able to stimulate follicular development,
ovulation, and luteinization in hypophysectomized rats indicates that
overlap in the activities of FSH and LH receptors can occur at all
stages of follicular growth (32).
The preferential ability of the FSHr to stimulate aromatase and LH
receptor expression, however, suggests that intracellular signaling
pathways may also be differentially activated by FSH and LH. On the one
hand, FSH may activate additional pathways compared to LH. On the other
hand, LH may activate pathways that are inhibitory to the actions of
FSH. Both FSH and LH have been shown to coactivate a number of
intracellular pathways including Ca2+
mobilization (33, 34), mitogen-activated protein kinase
(35, 36), and tyrosine kinase pathways (37, 38). Recently, FSH has been shown to activate the protein kinase
B pathway in a protein kinase-A independent fashion (39),
and Babu et al. identified a unique FSH receptor variant
that selectively stimulates the mitogen-activated protein kinase
pathway (40). One pathway that appears to be activated
preferentially by LH is phospholipase C (41, 42, 43).
Downstream targets of this signaling system include the protein kinase
C pathway, and pharmacological stimulation of the protein kinase C
pathway has been shown to antagonize the effects of FSH on granulosa
cell differentiation (44). In this regard, the D578H
mutant LHr that we ectopically expressed in immature granulosa cells
also confers constitutive activation of phospholipase C
(6). Finally, although we achieved comparable 48-h
production rates of cAMP in response to FSH and AdRSVD578HLHr, the
possibility that subtle differences in the time course of cAMP
production in response to FSH and LH receptor activation may have
resulted in differential regulation of target genes cannot be
excluded.
Many more genes than those studied in this report are influenced by FSH
and LH (2). The extent to which each may be regulated
(activated or repressed) by absolute levels of cAMP, different
intracellular signaling pathways, or combinations of both have yet to
be established. The strategy described in this report could provide a
novel approach to examining this question.
 |
Acknowledgments
|
|---|
We acknowledge Drs. Deborah Segaloff, Ian Mason, and Stephen G.
Hillier for providing complementary DNAs for this study. We also
acknowledge Dr. Talal El-Hefnawy for his suggestions for optimizing the
cAMP RIA, and Ms. Jessica Hudale for her help in constructing the
adenovirus vectors.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grants HD-16842 and HD-08610 (to
A.J.Z.), CA-78436 (to A.S.), and NIH Training Grants HD-07332 (to Z.B.)
and DK-07169 (to G.L.). 
Received September 11, 2000.
 |
References
|
|---|
-
Zeleznik AJ, Benyo DF 1994 Control of
follicular development, corpus luteum function, and recognition of
pregnancy in higher primates. In: Knobil E, Neill JD (eds) Physiology
of Reproduction, Ed 2. Raven Press, New York, vol 2:751782
-
Richards JS 1994 Hormonal control of gene
expression in the ovary. Endocr Rev 15:725751[CrossRef][Medline]
-
Adashi EY, Resnick CE 1986 3'5'-cyclic adenosine
monophosphate as an intracellular second messenger of luteinizing
hormone: application of forskolin criteria. J Cell Biochem 31:217228[CrossRef][Medline]
-
Richards JS, Jonassen JA, Rolfes AI, Kersey K, Reichert
Jr LE 1979 Adenosine 3',5'-monophosphate, luteinizing hormone
receptor, and progesterone during granulosa cell differentiation:
effects of estradiol and follicle-stimulating hormone. Endocrinology 104:765773[Medline]
-
Leung PC, Steele GL 1992 Intracellular signaling
in the gonads. Endocr Rev 13:476498[CrossRef][Medline]
-
Liu G, Duranteau L, Carol JC, Monroe J, Doyle DD,
Shenker A 1999 Leydig cell tumors caused by an activating mutation
of the gene encoding the luteinizing hormone receptor. N Engl
J Med 341:17311734[Free Full Text]
-
Gerard RD, Meidell RS 1994 Adenovirus vectors. In:
Rickwood D, Hames BD (eds) DNA Cloning 4: A Practical Approach, Ed 2.
Oxford University Press, Oxford, pp 285306
-
Graham FL, Smiley J, Russell WC, Nairn R 1977 Characteristics of a human cell line transformed by DNA from human
adenovirus type 5. J Gen Virol 36:5972[Abstract/Free Full Text]
-
Mittereder N, March L, Trapnell BC 1996 Evaluation
of the concentration and bioactivity of adenovirus vectors for gene
therapy. J Virol 70:74987509[Abstract]
-
Hunter WM, Greenwood FC 1962 Preparation of
iodine-131 labeled growth hormone of high specific activity. Nature 194:495496[CrossRef][Medline]
-
Hickey GJ, Krasnow JS, Beattie WG, Richards JS 1990 Aromatase cytochrome P450 in rat ovarian granulosa cells before and
after luteinization: adenosine 3',5'-monophosphate-dependent and
independent regulation. Cloning and sequencing of rat aromatase cDNA
and 5' genomic DNA. Mol Endocrinol 4:312[CrossRef][Medline]
-
McFarland KC, Sprengel R, Phillips HS, Kohler M,
Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropin-choriogonadotropin receptor: an unusual member of the G
protein-coupled receptor family. Science 245:494499[Abstract/Free Full Text]
-
Esch FS, Shimasaki S, Cooksey K, Mercado M, Mason AJ,
Ying SY, Ueno N, Ling N 1997 Complementary deoxyribonucleic acid
(cDNA) cloning and DNA sequence analysis of rat ovarian inhibins. Mol
Endocrinol 1:388396[CrossRef][Medline]
-
Lorence MC, Naville D, Graham-Lorence SE, Mack SO, Murry
BA, Trant JM, Mason JI 1991 3ß-Hydroxysteroid
dehydrogenase/
54-isomerase expression in rat
and characterization of the testis isoform. Mol Cell Endocrinol: 80:2131[CrossRef][Medline]
-
Danielson PE, Forss-Petter S, Brow MA, Calavetta L,
Douglass J, Milner RJ, Sutcliffe JG 1998 p1B15: a cDNA clone of
the rat mRNA encoding cyclophilin. DNA 7:261267
-
Zeleznik AJ, Resko JA 1980 Progesterone does not
inhibit gonadotropin-induced follicular maturation in the female rhesus
monkey. Endocrinology 106:18201826[Abstract]
-
Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. I. Preparation of antibodies
and iodinated cyclic nucleotides. J Biol Chem 247:11061113[Abstract/Free Full Text]
-
Zeleznik AJ, Midgley Jr AR, Reichert Jr LE 1974 Granulosa cell maturation in the rat: increased binding of human
chorionic gonadotropin following treatment with follicle stimulating
hormone in vivo. Endocrinology 95:818825[Medline]
-
Erickson GF, Hsueh AJ 1978 Stimulation of aromatase
activity by follicle stimulating hormone in rat granulosa cells
in vivo and in vitro. Endocrinology 102:12751282[Medline]
-
Hickey GJ, Chen SA, Besman MJ, Shively JE, Hall PF,
Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue
distribution, and content of aromatase cytochrome P450 messenger
ribonucleic acid and enzyme in rat ovarian follicles and corpora lutea:
relationship to estradiol biosynthesis. Endocrinology 122:14261436[Abstract]
-
Segaloff DL, Wang HY, Richards JS 1990 Hormonal
regulation of luteinizing hormone/chorionic gonadotropin receptor mRNA
in rat ovarian cells during follicular development and luteinization.
Mol Endocrinol 4:18561865[CrossRef][Medline]
-
Yong EL, Hillier SG, Turner M, Baird DT, Ng SC, Bongso
A, Ratnam SS 1994 Differential regulation of cholesterol
side-chain cleavage (P450scc) and aromatase (P450arom) enzyme mRNA
expression by gonadotropins and cyclic AMP in human granulosa cells. J
Mol Endocrinol 12:239249[Abstract/Free Full Text]
-
Silverman E, Eimerl S, Orly J 1999 CCAAT
enhancer-binding protein beta and GATA-4 binding regions within the
promoter of the steroidogenic acute regulatory protein (StAR) gene are
required for transcription in rat ovarian cells. J Biol Chem 274:1798717996[Abstract/Free Full Text]
-
Ratoosh SL, Lifka J, Hedin L, Jahsen T, Richards JS 1987 Hormonal regulation of the synthesis and mRNA content of the
regulatory subunit of cyclic AMP-dependent protein kinase type II in
cultured rat ovarian granulosa cells. J Biol Chem 262:73067313[Abstract/Free Full Text]
-
Carr DW, Cutler Jr RE, Cottom JE, Salvador LM, Fraser
IDC, Scott JD, Hunzicker-Dunn M 1999 Identification of
cAMP-dependent protein kinase holoenzymes in preantral and preovulatory
follicle enriched ovaries, and their association with A-kinase
anchoring proteins. Biochem J 344:613623
-
Somers JP, DeLoia JA, Zeleznik AJ 1999 Adenovirus-directed expression of a nonphosphorylatable mutant of CREB
(cAMP response element-binding protein) adversely affects the survival,
but not the differentiation, of rat granulosa cells. Mol Endocrinol 13:13641372[Abstract/Free Full Text]
-
Welsh Jr TH, Jia XC, Hsueh AJ 1984 Forskolin and
phosphodiesterase inhibitors stimulate rat granulosa cell
differentiation. Mol Cell Endocrinol 37:5160[CrossRef][Medline]
-
Davoren JB, Hsueh AJ 1985 Vasoactive intestinal
peptide: a novel stimulator of steroidogenesis by cultured rat
granulosa cells. Biol Reprod 33:3752[Abstract]
-
Piquette GN, LaPolt PS, Oikawa M, Hsueh AJ 1991 Regulation of luteinizing hormone receptor messenger ribonucleic acid
levels by gonadotropins, growth factors, and gonadotropin-releasing
hormone in cultured rat granulosa cells. Endocrinology 128:24492456[Abstract]
-
Sullivan MW, Stewart-Akers A, Krasnow JS, Berga SL,
Zeleznik AJ 1999 Ovarian responses in women to recombinant
follicle-stimulating hormone and luteinizing hormone (LH): a role for
LH in the final stages of follicular maturation. J Clin Endocrinol
Metab 84:228232[Abstract/Free Full Text]
-
Campbell BK, Dobson H, Baird DT, Scaramuzzi RJ 1999 Examination of the relative role of FSH and LH in the mechanism of
ovulatory follicle selection in sheep. J Reprod Fertil 117:355367[Abstract/Free Full Text]
-
Tapainen JS, Lapolt PS, Perlas E, Hsueh AJ 1993 Induction of ovarian follicle luteinization by recombinant
follicle-stimulating hormone. Endocrinology 133:28752880[Abstract]
-
Davis JS, Weakland LL, Farese RV, West LA 1987 Luteinizing hormone increases inositol trisphosphate and cytosolic free
Ca2+ in isolated bovine luteal cells. J Biol
Chem 262:85158521[Abstract/Free Full Text]
-
Flores JA, Leong DA, Veldhuis JD 1992 Is the
calcium signal induced by follicle-stimulating hormone in swine
granulosa cells mediated by adenosine
cyclic3',5'-monophosphate-dependent protein kinase? Endocrinology 130:18621866[Abstract]
-
Cameron MR, Foster JS, Bukovsky A, Wimalasena J 1996 Activation of mitogen-activated kinases by gonadotropins and
cyclic adenosine 5'-monophosphates in porcine granulosa cells. Biol
Reprod 55:111119[Abstract]
-
Das S, Maizels ET, DeManno D, St Clair E, Adam SA,
Hunzicker-Dunn M 1996 A stimulatory role of cyclic adenosine
3',5'-monophosphate in follicle-stimulating hormone-activated
mitogen-activated protein kinase signaling pathway in rat ovarian
granulosa cells. Endocrinology 137:967974[Abstract]
-
Shimamoto T, Yamoto M, Nakano R 1998 The role of
tyrosine kinase in gonadotropin-induced ovulation in the rat ovary. Eur
J Endocrinol 138:594600[Abstract]
-
Orly J, Rei Z, Greenberg NM, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating
hormone-induced granulosa cell differentiation: use of reverse
transcriptase-polymerase chain reaction assay for multiple messenger
ribonucleic acids. Endocrinology 134:23362346[Abstract]
-
Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone
GL, Richards JS 2000 Follicle-Stimulating hormone (FSH) stimulates
phosphorylation and activation of protein kinase B (PKB/Akt) and serum
and glucocorticoid-lnduced kinase (Sgk): evidence for A
kinase-independent signaling by FSH in granulosa cells. Mol Endocrinol 14:12831300[Abstract/Free Full Text]
-
Babu PS, Krishnamurthy H, Chedrese PJ, Sairam MR 2000 Activation of extracellular-regulated kinase pathways in ovarian
granulosa cells by the novel growth factor type 1 follicle-stimulating
hormone receptor. Role in hormone signaling and cell proliferation.
J Biol Chem 275:276152726[Abstract/Free Full Text]
-
Davis JS, Weakland LL, West LA, Farese RV 1986 Luteinizing hormone stimulates the formation of inositol trisphosphate
and cyclic AMP in rat granulosa cells. Evidence for phospholipase C
generated second messengers in the action of luteinizing hormone.
Biochem J 238:597604[Medline]
-
Gudermann T, Birnbaumer M, Birnbaumer L 1992 Evidence for dual coupling of the murine luteinizing hormone receptor
to adenylyl cyclase and phosphoinositide breakdown and
Ca2+ mobilization. J Biol Chem 267:44794488[Abstract/Free Full Text]
-
Kuhn B, Guderman T 1999 The luteinizing hormone
receptor activates phospholipase C via preferential coupling to
Gi2. Biochemistry 38:1249012498[CrossRef][Medline]
-
Shinohara O, Knecht M, Catt KJ 1985 Inhibition of
gonadotropin-induced granulosa cell differentiation by activation of
protein kinase C. Proc Natl Acad Sci USA 82:85188522[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. Escamilla-Hernandez, L. Little-Ihrig, K. E. Orwig, J. Yue, U. Chandran, and A. J. Zeleznik
Constitutively Active Protein Kinase A Qualitatively Mimics the Effects of Follicle-Stimulating Hormone on Granulosa Cell Differentiation
Mol. Endocrinol.,
August 1, 2008;
22(8):
1842 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Herrmann-Lavoie, C. V. Rao, and A. Akoum
Chorionic Gonadotropin Down-Regulates the Expression of the Decoy Inhibitory Interleukin 1 Receptor Type II in Human Endometrial Epithelial Cells
Endocrinology,
November 1, 2007;
148(11):
5377 - 5384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Saxena, R. Escamilla-Hernandez, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 and Steroidogenic Factor-1 Have Similar Actions on Rat Granulosa Cell Steroidogenesis
Endocrinology,
February 1, 2007;
148(2):
726 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Andric and M. Ascoli
A Delayed Gonadotropin-Dependent and Growth Factor-Mediated Activation of the Extracellular Signal-Regulated Kinase 1/2 Cascade Negatively Regulates Aromatase Expression in Granulosa Cells
Mol. Endocrinol.,
December 1, 2006;
20(12):
3308 - 3320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. N. Parakh, J. A. Hernandez, J. C. Grammer, J. Weck, M. Hunzicker-Dunn, A. J. Zeleznik, and J. H. Nilson
Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires beta-catenin
PNAS,
August 15, 2006;
103(33):
12435 - 12440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mihm, P.J. Baker, J.L.H. Ireland, G.W. Smith, P.M. Coussens, A.C.O. Evans, and J.J. Ireland
Molecular Evidence That Growth of Dominant Follicles Involves a Reduction in Follicle-Stimulating Hormone Dependence and an Increase in Luteinizing Hormone Dependence in Cattle
Biol Reprod,
June 1, 2006;
74(6):
1051 - 1059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. X. Donadeu and M. Ascoli
The Differential Effects of the Gonadotropin Receptors on Aromatase Expression in Primary Cultures of Immature Rat Granulosa Cells Are Highly Dependent on the Density of Receptors Expressed and the Activation of the Inositol Phosphate Cascade
Endocrinology,
September 1, 2005;
146(9):
3907 - 3916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.X. Lin, Z.M. Lei, and Ch.V. Rao
Dependence of Uterine Cyclooxygenase2 Expression on Luteinizing Hormone Signaling
Biol Reprod,
August 1, 2005;
73(2):
256 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Saxena, R. Safi, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 Stimulates the Progesterone Biosynthetic Pathway during Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology,
August 1, 2004;
145(8):
3821 - 3829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Allan, A. Garcia, J. Spaliviero, F.-P. Zhang, M. Jimenez, I. Huhtaniemi, and D. J. Handelsman
Complete Sertoli Cell Proliferation Induced by Follicle-Stimulating Hormone (FSH) Independently of Luteinizing Hormone Activity: Evidence from Genetic Models of Isolated FSH Action
Endocrinology,
April 1, 2004;
145(4):
1587 - 1593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Zeleznik, D. Saxena, and L. Little-Ihrig
Protein Kinase B Is Obligatory for Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology,
September 1, 2003;
144(9):
3985 - 3994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Conti
Specificity of the Cyclic Adenosine 3',5'-Monophosphate Signal in Granulosa Cell Function
Biol Reprod,
December 1, 2002;
67(6):
1653 - 1661.
[Abstract]
[Full Text]
[PDF]
|
 |
|