This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kimura, N. Articles by Kimura, N. Search for Related Content PubMed PubMed Citation Articles by Kimura, N. Articles by Kimura, N.

Characterization of 5'-Flanking Region of Rat Somatostatin Receptor sst2 Gene: Transcriptional Regulatory Elements and Activation by Pitx1 and Estrogen¹

Tokyo Metropolitan Institute for Neuroscience, Tokyo Metropolitan Organization for Medical Research (N.K., S.T., K.N.A.), Fuchu, Tokyo 183-8526; Department of Pathology, Tokai University School of Medicine (R.Y.O.), Isehara City, Kanagawa 259-1193; and Department of Gene Regulation and Protein Function, Tokyo Metropolitan Institute of Gerontology (Na.K.), Itabashi-ku, Tokyo 173-0015, Japan

Address all correspondence and requests for reprints to: Dr. Nobuko Kimura, Tokyo Metropolitan Institute for Neuroscience, Tokyo Metropolitan Organization for Medical Research, 2-6 Musashidai, Fuchu-shi, Tokyo 183-8526, Japan. E-mail address: kimura{at}tmin.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The sst2 somatostatin receptor mediates the inhibitory effects of somatostatin on secretive and proliferative processes. We previously showed that sst2 is one of the major subtypes expressed in the rat pituitary, and its messenger RNA level is up-regulated by chronic treatment with estrogen. To investigate the molecular mechanisms regulating sst2 gene expression, we cloned the upstream region (9.5 kb) from the translation initiation codon of the rat sst2 gene. It contained a single intron (5.0 kb) at the 5'-untranslated region, lacked TATA and CCAAT boxes, and had multiple transcriptional start sites. Transient transfection analysis with deleted mutants of a luciferase reporter construct showed that the promoter activity was regulated negatively and positively in the distal and proximal promoter regions, respectively. The promoter activity of each construct was more efficient in GH₃ pituitary cells than in nonpituitary cells. The construct (-77/+172/luc) containing a cAMP response element (CRE; -54/-47) provided maximum promoter activity, but a further 5'-deleted construct dramatically reduced the activity. Competitive gel shift and supershift assays indicated that Sp2 and Sp3 were bound to an Sp1 site (-40/-31), and activating transcription factor-2 and c-Jun were bound to a CRE site. Both Sp1 and CRE sites were essential for the full promoter activity. Overexpression of the pituitary homeoprotein Pitx1 activated the promoter activity of the -4066/+172/luc construct, and mapping analysis indicated the existence of two Pitx1 response sites, including the CRE site. Estrogen also increased the promoter activity of -77/+172/luc in GH₃ cells or in HeLa cells overexpressing both the estrogen receptor and c-Jun. These studies demonstrated the nature of the rat sst2 gene and the functional importance of both Sp1 and CRE sites in regulating sst2 gene expression and suggest that the CRE site mediates, at least partly, the promoter activity activated by Pitx1 or estrogen.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
SOMATOSTATIN (SRIF), a tetradecapeptide initially isolated as a hypothalamic GH release inhibitory hormone, is widely distributed throughout the brain and peripheral tissues, including endocrine and immune cells (1, 2). SRIF acts to regulate the secretion of a variety of hormones in hypothalamic-hypophyseal and gasteroenteropancreatic systems, modulates neurotransmission in the central nervous system, and exerts an antiproliferative effect in normal dividing cells and in tumor cells (2, 3, 4, 5). SRIF interacts with G protein-coupled somatostatin receptors (sst1–sst5) on the plasma membrane. They are encoded by five separate genes and expressed in either peripheral tissues or the central nervous system with a subtype-specific expression pattern (2, 4). The characteristics of the individual subtypes involved in specific biological actions have not yet been fully elucidated. Among five subtypes, the sst2 is known to be involved in the following biological actions. It not only inhibits the secretion of GH, glucagon, and gastric acid (2, 6, 7), but also suppresses T cell interferon- release in inflammatory cells (2, 8). GH-mediated negative feedback of GH release is transduced specifically through sst2 in mouse arcuate GHRH neurons (9). The sst2 is linked to the cytoskeleton via interaction with a PDZ domain of proteins in the nerve terminals and may regulate transmitter release (10). In particular, sst2 is highly expressed as a major subtype in malignant cells (2, 11). Despite these accumulated biological data for sst2, the molecular mechanism of sst2 gene expression remains poorly understood.

The messenger RNA (mRNA) expression of the sst2 gene is regulated during development in the brain and pituitary and is influenced by fasting and feeding (2, 12, 13, 14). SRIF and steroid hormones, such as estrogen and glucocorticoid, are able to alter transcription of the sst2 gene in pituitary cells and in tumor cell lines (2, 15, 16, 17, 18, 19). To gain insight into the transcriptional regulation of sst2 gene expression, it is essential to analyze the genomic structure and to characterize the promoter elements. However, the genomic structure of the sst2 gene is species specific. The human sst2 gene lacks an intron in the 5'-untranslated region (UTR) (19, 20, 21). In contrast, the murine sst2 gene contains three promoters with two introns in the 5'-UTR (22). In the human sst2 gene, cis-acting elements, E and TC boxes, and trans-acting factors, SL3-3 enhancer factor 2 (SEF-2) and c-myc intron binding protein 1 (MIBP1), are identified, and the factors are coexpressed in a tissue-specific manner (21, 23). Neither the cis-elements nor the trans-acting factors of the sst2 promoter in the rodent have been clearly identified.

We have demonstrated recently that sst2A, which is more expressed than the spliced variant sst2B, and sst5 are the major subtypes expressed in the normal rat pituitary (17). The mRNA expression of sst2 and sst5 is up- and down-regulated by chronic treatment with estrogen, respectively. In this paper to elucidate the genetic basis of transcriptional regulation in the rat pituitary, we isolated the 5'-flanking region of the rat sst2 gene, characterized its structure and function, and identified cis-acting elements as well as trans-acting transcription factors. We also investigated whether a pituitary-specific transcription factor Pit-1 (24, 25), pituitary homeoprotein Pitx1 (P-Otx/Ptx1) (26, 27, 28, 29, 30), or estrogen regulates the promoter activity of the rat sst2 gene. The present results demonstrated that the rat sst2 gene contains a single intron at 5'-UTR, that both Sp1 and cAMP response element (CRE) sites act as cis-acting elements at a proximal promoter region and are essential for full promoter activity, and that the trans-acting factors of these sites are Sp2 and/or Sp3 and activating transcription factor-2 (ATF-2) and c-Jun, respectively. The results also show that either Pitx1 or estrogen is capable of activating the promoter activity at least partly through the CRE site of the proximal promoter region of sst2.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oligonucleotides
Consensus oligonucleotides for Sp1, Ap1, and CRE-binding protein (CREB) were purchased from Promega Corp. (Madison, WI). The following oligonucleotides and double stranded oligonucleotides were obtained from BEX (Tokyo, Japan): S2-1, CTC TGT CTG GTT GGA GCC ATT GCT TGG (31); S2-2, GTA TCC ACA CTT GGC TCC CAT TGA ACT G (31); S2-3, CAG TAG CTC TCG GGC TCG CAG CTT CC (31); S2-4, CTC GCA GCT TCC CAG TCT GGC TCG TG (31); S2-5, TGG AGA GGG TAA TAC GGA TTG TGA C; S2-6, CAT CCA CCA GCA TCC AGA TCC GCT GA; S2-7, CAG CCA CCG GCA CGC TGG CGA (31); S2-8, GAA GCT GCG AGC CCG AGA GCT ACT (31); S2-9, CCT CCA TCT GTA CTG TCT CAT CAT GTC; S2-10 (intron), gac ggt acC AGC AGC ACA CAT GAA TAC AC; S2-11 (intron), gac gct agc TGC TCT TCA GTC CGC CTA GAA CCA; Pitx1-order 1, gac aag ctt gcg gcc gCA TGG ACG CCT TCA AGG GAG GCA TGA (26); Pitx1-reverse 1, gac act aGT CAG CTG TTG TAC TGG CAA GCG TTG AG (26); Pitx1-reverse 2, GTC GGA TGA CTC GCT GGC TGA GTT CTC (26); Pitx1-order 2, CAA CAA CCT CAC GGG CTC CTC GCT CAA CT (26); hPitx1-order, CAT GGA CGC CTT CAA GGG GGG CAT GA (26); hPitx1-reverse, TCA GCT GTT GTA CTG GCA CGC GTT GAG (26); rS2-order, CGG AGC AAC CAG TGG GGT AGG AGC (31); rS2-reverse, TCA GAT ACT GGT TTG GAG GTC TCC (31); mS2-order, CGG AGC AAC CAG TGG GGC AGG AGC (GenBank, M81832); and hS2-order, CGG AGC AAC CAG TGG GGG AGA AGC (GenBank, M81830).

Cloning of the 5'-flanking region of the rat sst2 gene
The 5'-flanking region of the sst2 gene was cloned from the Sprague Dawley rat by the PCR method for DNA walking (32). Five rat genomic libraries, which were prepared from genomic DNA digested with restriction enzymes (EcoRV, ScaI, DraI, PvuII, and SspI) and ligated to cassette adaptors with the cohesive ends, were provided in the Promoter Finder DNA walking kit (CLONTECH Laboratories, Inc., Palo Alto, CA). Using these genomic libraries as a template, the first PCR was conducted with a combination of sense primer (the adaptor primer-1; AP-1) and antisense primer [sst2 complementary DNA (cDNA) primer; S2-1 or S2-3], then nested PCR was performed with nested internal primers (AP-2 and sst2 cDNA primer; S2-2 or S2-4), according to the manufacturer’s instruction, except using La Taq DNA polymerase and GC buffer (Takara, Osaka, Japan). PCR products were subcloned into pBSKS (-) or pTA vector (Invitrogen, Carlsbad, CA) and were sequenced.

Rapid amplification of 5'-cDNA ends (5'-RACE)
The 5'-end of the rat sst2 cDNA was determined by two RACE methods. One of the RACE methods is a rapid amplification of cDNA 5'-ends (5'-RACE) using 5'-RACE-Ready cDNAs of rat brain (CLONTECH Laboratories, Inc.), antisense primers of sst2 cDNA (S2-1 for first PCR and S2-2 for second PCR), and the 5'-RACE-Ready cDNA Kit (CLONTECH Laboratories, Inc.), according to the manufacturer’s instructions. The other is the method of SMART (Switching Mechanism At 5' end of RNA Transcript) technology (33) using the SMART RACE cDNA Amplification Kit (CLONTECH Laboratories, Inc.). Briefly, the first strand of the cDNAs were synthesized from total RNA of the rat anterior pituitaries using a modified oligo(deoxythymidine) primer, SMART oligonucleotide, and Moloney murine leukemia virus reverse transcriptase (ReverTra Ace, Toyobo, Osaka, Japan) at 42 C, then were used in PCR reactions in the presence of the sense universal primer and the antisense primer of sst2 (S2-1). The PCR products were cloned into a pTA vector and analyzed by sequencing.

Ribonuclease (RNase) protection analysis
A DNA template (344 bp) used for the preparation of riboprobe was generated by PCR amplification using a sense primer (S2-6) and an antisense primer (S2-4) and subcloned into a pTAvector. A radiolabeled antisense transcript was generated using Riboprobe In Vitro Transcription Systems (Promega Corp.) and [-³²P]UTP (800 Ci/mmol; Amersham Pharmacia Biotech, Arlington Heights, IL). After purification of riboprobe using a 5% denaturing polyacrylamide gel, full-length probe was excised from the gel and eluted in a probe elution buffer. Total RNA (35–65 µg) from the anterior pituitary and brain were hybridized to approximately 5 x 10⁵ cpm of the riboprobe in hybridization buffer at 56 C for 40 h and then treated with RNase A/RNase T1 Mix (1.25 U/ml RNase A and 50 U/ml RNaseT1) at 4 C for 60 min, according to the instruction manual with the Ambion, Inc. RPA III kit (Ambion, Inc., Austin, TX). After the RNases were inactivated, the protected fragments were analyzed on a 6% denaturing polyacrylamide gel. A DNA sequence ladder obtained using the ³³P-Radiolabeled Terminator Cycle Sequencing Kit with dGTP Nucleotide Master Mix (Amersham Pharmacia Biotech) and an RNA marker generated using RNA Century Marker Template Set (Ambion, Inc.) were run as size markers. The gels were dried and analyzed using a FUJIX BioImaging Analyzer, BAS2000 (Fuji Photo Film Co., Ltd., Tokyo, Japan).

Reporter and expression plasmids
The full length of the 5'-flanking region fragment was cloned into a firefly luciferase reporter plasmid, pGL3-Basic (Promega Corp.). Deletion mutant plasmids were generated by either restriction enzyme sites or PCR. A fusion construct containing an intron region (114 bp of intron and 86 bp of exon 2) was produced from PCR products obtained with primers S2-10 and S2-11. Promoter regions of GH and PRL were obtained by PCR using rat genomic DNA (CLONTECH Laboratories, Inc.), then fused with the reporter gene (GH, -313/+12/luc; PRL, -1770/+34/luc). Control vector pGL3-CV(CMV) was generated by fusion of the pGL3-Basic vector and the cytomegalovirus (CMV) immediate early enhancer/promoter region of pRL-CMV (Promega Corp.). The Pit-1 (pRSV-Pit-1) and estrogen receptor (ER) expression (pSV2rER) vectors were gifts from Dr. R. A. Maurer and from Drs. M. Muramatsu and S. Koike, respectively. Pitx1 cDNA from the anterior pituitaries of 8-day-old neonatal rats was cloned by PCR with La Taq DNA polymerase, GC buffer, and the combination of primers, Pitx1-order 1 and Pitx1-reverse 1. The full-length of the rat pitx1-coding region was confirmed using the SMART RACE cDNA Amplification Kit. The cDNAs of human ATF-2 (GenBank, X15875) and rat c-jun (GenBank, X17163) were cloned from HeLa cells and GH₃ cells by PCR. Expression vectors of rat Pitx1, human ATF-2 (Arg²²³) and rat c-Jun (Ile¹⁶⁹,Ser²³⁶) were obtained by cloning into HindIII/SpeI- or SpeI/NotI-digested pRc-RSV (Invitrogen). All reporter constructs and expression vectors were confirmed by sequencing,and then purified using a plasmid preparation kit (QIAGEN, Chatsworth, CA).

Cell culture and transient transfection assays
Cell culture media and sera were purchased from Life Technologies, Inc. (Grand Island, NY). GH₃ and C6 glial tumor cells were grown in F-10 medium containing 2.5% FCS and 15% horse serum. Rat2, mouse neuroblastoma NS20Y, and HeLa cells were grown in DMEM containing 10% FCS. All cells were maintained in humidified 5% CO₂-95% air at 37 C. Two or 3 days after the cells (0.5–2 x 10⁵ cells/well) were plated onto 24-well tissue culture plate, cells were cotransfected with sst2 promoter-luciferase reporter gene constructs (300–561 ng), expression vectors (10–100 ng), and internal control vector pRL-CMV (0.15–0.2 ng) or pRL-TK (4–16 ng) using Lipofectamine Plus reagent (Life Technologies, Inc.) following the manufacturer’s recommendations. Plasmids expressing Renilla luciferase driven by the TK or CMV promoter (pRL-TK or pRL-CMV) were used as an internal control to normalize transfection efficiency. The activities of both firefly and Renilla luciferase were determined 24 h after transfection using Dual Luciferase Assay System reagents (Promega Corp.). Chemiluminescence measurements were made over 10-sec intervals in a luminometer (Lumat LB9501, Berthold, Germany). The results are expressed as the mean ± SE, and statistical analysis was performed by Student’s t test.

Site-directed mutagenesis of the sst2 promoter
Site-directed mutagenesis was used to mutate potential transcriptional elements in the proximal portion of the rat sst2 promoter. Two bases of cis-elements in the promoter-reporter gene construct were mutated by PCR using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). After 18 cycles of PCR using Pfu Turbo DNA polymerase at 95 C for 30 sec, 55 C for 1 min, and 68 C for 12 min, the parental, supercoiled, double stranded DNA was digested with DpnI, then the clones of site-directed mutants were confirmed by DNA sequencing.

Preparation of nuclear extracts and electrophoretic mobility shift assay
Nuclear extracts were prepared according to the method of Schreiber et al. with minor modification (34). The cells that were prewashed with PBS followed by buffer A [10 mM HEPES-KOH (pH 7.6), 15 mM KCl, 2 mM MgCl₂, 0.1 mM EDTA, 1 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonylfluoride (PMSF), and 10 µg/ml leupeptin], were resuspended in the equivalent of 10 packed cell volumes of buffer A containing 0.2% Igepal CA-630 (Sigma, St. Louis, MO). After collection of nuclear fractions by gentle centrifugation at 800 x g for 5 min, nuclei were washed with 20 vol buffer A containing 0.2 M sucrose. Nuclear proteins were extracted with 1.5 vol buffer B [50 mM HEPES-KOH (pH 7.9), 400 mM KCl, 10% glycerol, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, and 10 µg/ml leupeptin] at 4 C for 30 min by constant shaking. The protein concentration in the nuclear extracts was determined using the Bradford assay (Bio-Rad Laboratories, Inc., Richmond, CA). The probe for mobility shift assays was end-labeled with [-³²P]deoxy-CTP (3,000 Ci/mmol; Amersham Pharmacia Biotech), using the Klenow fragment of DNA polymerase. The binding reactions were carried out in a total volume of 9 µl containing 25 mM HEPES-KOH (pH 7.8), 2 µg poly(dI-dC)-poly(dI-dC), 60 mM KCl, 10% glycerol, 0.5 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 10 µg/ml leupeptin, 1 µg/ml pepstatin, 5 mM sodium orthovanadate, 6 mM MgCl₂, 0.05% Igepal CA-630, and 100 µg/ml BSA. Nuclear extracts (2.5–3.0 µg) were added to the reaction mixture and preincubated with or without DNA competitors at 4 C for 30 min. The labeled probes (5,000–15,000 cpm) were added, followed by incubation for 20 min at 22 C. The reaction mixture (3.0–4.5 µl) was loaded onto a 4% native polyacrylamide gel in 0.5 x TBE [44.5 mM Tris-HCl (pH 8.0), 44.5 mM boric acid, and 1 mM EDTA] and run at 150 V. The gels were dried and analyzed using BAS2000. In supershift experiments, antibodies (1.5 µg) were added to the reaction mixture before the probe. Incubation was performed for 20 min at 22 C, then overnight at 4 C. The antibodies against Sp1, Sp2, Sp3, Sp4, CREB, ATF-1, ATF-2, ATF-3, ATF-4, c-Jun, and c-Fos were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

RT-PCR and Northern blot analysis
Total RNA samples were isolated with TRIzol reagent (Life Technologies, Inc.) and used after the removal of contaminated DNA with deoxyribonuclease I, according to the manufacturer’s instructions. RT-PCR amplification was performed essentially as described previously (17). The following specific primers were used: primers for rat sst2 exon2 (rS2-order and rS2-reverse), primers for mouse sst2 exon2 (mS2-order and rS2-reverse), primers for human sst2 (hS2-order and rS2-reverse), primers for rat and mouse sst2 spanning intron/exon boundaries (S2-7 and S2-2), primers for rat and mouse Pitx1 (Pitx1-order1 and Pitx1-reverse1), and primers for human Pitx1 (hPitx1-order and hPitx1-reverse). Common primers for rat, mouse, and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 0.45 kb) were obtained from CLONTECH Laboratories, Inc. The cDNAs produced from 50 ng total RNA were amplified using specific primers of sst2, Pitx1, and GAPDH for 35, 35, and 25 cycles, respectively. PCR products of hsst2 and Pitx1 were confirmed from the nucleotide sequence or restriction digestion. No PCR products were observed in RNA samples that were not subjected to RT. Northern blot analysis was performed as described previously (35). In brief, the cDNA probe for sst2 was a 695-bp fragment corresponding to nucleotides 783-1477 of rat sst2 (31). Total RNA samples were fractionated by 1.2% agarose/formaldehyde gel and transferred to Nytran nylon membranes (Schleicher & Schuell Inc., Keene, NH). The filters were hybridized with an [-³²P]deoxy-CTP-labeled cDNA probe and analyzed using BAS2000.

Western blot analysis
After the cells were transfected with expression vectors and incubated for 24 h, cells were lysed in lysis buffer [65 mM Tris-HCl (pH 6.8), 3% SDS, 5% ß-mercaptoethanol, and 10% glycerol], and whole cell extracts were obtained. Cellular proteins (30 µg) were subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane using semidry blotting. Blocking was performed with 5% milk protein. Anti-Pitx1 antiserum was used after a 1:250 dilution (30). Alkaline phosphatase-conjugated antibodies were used as secondary antibodies and were stained by Western blue stabilized substrate for alkaline phosphatase (Promega Corp.).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of the 5'-flanking region and genomic structure of the rat sst2 gene
The 5'-flanking region of the rat sst2 gene was cloned using the PCR method for walking in uncloned genomic DNA (32). With the first walking, PCR product was obtained from DraI library (Fig. 1A). The clone was partly defective in the 5'-UTR of sst2 cDNA (clone S2-A, 1845 bp) (31); hence, a second DNA walking was performed (Fig. 1B). An approximately 4.2-kb PCR product from the ScaI library was cloned and sequenced (clone S2-B, 4238 bp). To analyze the intron sequence in the noncoding region, we obtained approximately 6- or 5.5-kb products from the PCR using the sense primer (S2-5 or S2-6) in the 5'-flanking region and the antisense primer (S2-1) in the coding region (Fig. 1C, lanes 1 and 2). Two PCR products of similar size were obtained with the sense primer (S2-7 or S2-8) in exon 1 and the antisense primer S2-1 (Fig. 1C, lanes 3 and 4). When the antisense primer (S2-9) in the first walking DNA sequence was used instead of S2-1, all PCR products showed reduced sizes of about 2 kb (lane 5–8). The pattern of restriction fragments generated from DraI digestion of the PCR products was mapped (Fig. 1C). After the PCR product f (lane 6) was cloned (clone S2-C, 3909 bp), the complete intron sequence was determined. A map of the upstream portion of the sst2 coding region is shown in Fig. 2A, and the sequences of the exons, the 5'-flanking regions, and the intron are summarized in Fig. 2B (DDBJ, Accession No. AB047297). Thus, the rat sst2 gene contains a single intron in the 5'-UTR, and the proximal promoter region contains GC-rich sequences and a CRE consensus sequence, but neither typical TATA nor CCAAT boxes (36).

View larger version (45K): [in this window] [in a new window]   Figure 1. Cloning of the 5'-flanking region of the rat sst2 gene by DNA walking and of an intron by PCR. A, DNA walking was performed using the sst2 cDNA antisense primers (S2-1 and S2-2) in the coding region. The product obtained from DraI library was cloned and sequenced (Clone S2-A, 1845 bp). B, The second DNA walking was performed using the specific antisense primers in the 5'-untranslated region (S2-3 and S2-4). The product obtained from ScaI library was cloned and sequenced (Clone S2-B, 4238 bp). C, To determine the size of an intron, PCR was performed using rat genomic DNA as a template and six primers. The antisense primers of S2-1 and S2-9 are specific for exon 2 and the intron, respectively. The sense primers of S2-5 and S2-6 are specific for the 5'-flanking region of exon 1, and S2-7 and S2-8 are specific for exon1. PCR products (a–h) were resolved on an ethidium bromide-agarose gel. The products a, b, c, and d were generated with the combination of sense primers of S2-5 to S2-8 and antisense primer of S2-1 (lanes 1–4). The products of e, f, g, and h were generated using antisense primer S2-9 instead of S2-1 (lanes 5–8). Products a–d were digested with restriction enzyme DraI (lanes 9–12). Product f was cloned and sequenced (Clone S2-C, 3909 bp).

View larger version (105K): [in this window] [in a new window]   Figure 2. Nucleotide sequence of the rat sst2 gene. A, Structural organization of the sst2 gene. Clones S2-A, S2-B, and S2-C were isolated and sequenced as shown in Fig. 1. B, Nucleotide sequence of exon (bold uppercase letters), the 5'-flanking region (uppercase letters), and the intron of 5'-UTR (lowercase letters) of the sst2 gene are shown. The nucleotide numbering on the left starts with +1 at the 5'-end of all transcription start sites. Sequence motifs discussed in the text are underlined. Restriction sites used for promoter deletion analysis are shown with double underlining. The nucleotide sequences for primers are underlined with a half-arrow. The translation start site ATG is boxed.

View larger version (45K): [in this window] [in a new window]   Figure 3. Determination of the transcription start site. A, For the transcription start site of the rat anterior pituitary, the 5'-end of cDNA of the sst2 gene was determined by the method of template switching and 5'-RACE. The total RNA from the rat anterior pituitaries was reverse transcribed, and PCR was performed using the SMART sense universal primer and the sst2-specific antisense primer (S2-1). For the transcription start site of the rat brain, 5'-RACE-ready cDNA from the rat brain was amplified using the antisense primer S2-1, and the second amplification was performed using the nested primer, S2-2. The PCR product was separated on ethidium bromide agarose gel. The 25 clones of PCR products from the anterior pituitary and the 31 clones from the brain were analyzed by sequencing. The nonspecific clones of longer RACE products were excluded. The 5'-end of start sites was at 387 bp upstream from the translation start site ATG. The start sites 377 and 369 bp upstream from the ATG site in the pituitary and 327 bp in the brain were abundant, and each site constituted approximately 20% of the total sequenced clones. B, RNase protection assays were performed on total RNA prepared from the pituitary (lane 2; 35 µg RNA) or the brain (lane 3; 65 µg). Yeast RNA (50 µg) was used as a negative control (lane 1). The DNA-sequencing ladder of the sst2 gene sequenced by primer S2-4 is shown as a reference on the left. The sizes of both the RNA standards (100 and 200 bp) and the locations of the several protected start sites are indicated by the numbers on the right. The position of the largest protected 172-bp fragment corresponds to 387 bp upstream from the translation start site ATG. C, Several transcription start sites identified by 5'-RACE in the anterior pituitary and the brain are indicated (* and , respectively). The start sites identified by RNase protection assay in both the pituitary and brain are also indicated (). The 5'-end of several transcription start sites was defined as +1. The nucleotide sequences for primers are underlined with a half-arrow.

View larger version (34K): [in this window] [in a new window]   Figure 4. Analysis of promoter activity of the 5'-flanking region of the rat sst2 gene in GH3 cells. The cells were transfected with plasmids containing a 5'-flanking region fused to the firefly luciferase reporter gene (-4066/+172/luc) together with a Renilla luciferase expression plasmid (pRL-CMV; 0.2 ng) as an internal control. The promoterless plasmid, pGL3-Basic, and plasmids containing the constructs of 5'-deleted fragments are shown in the left panels. , The 5'-flanking region; , exon 1. The relative luciferase activity for each construct, whose amounts were equal molecules of deleted mutants corresponding to 300 ng pGL3-Basic, was calculated relative to the activity of pGL3-Basic and plotted in the right panels. Each experiment was performed in quadruplicate or triplicate, and the data are given as the mean ± SE of six independent transfection experiments.

View larger version (40K): [in this window] [in a new window]   Figure 5. Promoter activity of the 5'-flanking region of exons 1 and 2 of the rat sst2 gene in various cells. A, The mRNA expression of sst2 in various cells was examined by RT-PCR. PCR amplification was performed using the specific primers of exon 2 (upper panel), primers spanning intron/exon boundaries (middle panel), and primers of GAPDH (bottom panel) as described in Materials and Methods. Total RNA from male rat pituitary (AP) was run as a control (lane 1). In mouse NS20Y cells and human HeLa cells, the specific primers corresponding to the rat exon 2 or rat exon 1/exon 2 were used. As the human sequence corresponding to rat exon 1 is unknown (19 20 21 ); thus, the data for the middle panel of lane 6 are not given. B, The plasmid containing the 5'-flanking region of exon 1 (-4066/+172/luc, -77/+172/luc), the plasmid containing the region from the intron to exon 2 (intron (114 bp)/exon 2 (86 bp)/luc), or the control plasmid containing CMV enhancer and immediate early promoter [pGL3-CV(CMV)] was transiently transfected into various cell lines as described in Fig. 4. Results are expressed as relative luciferase activity compared with the activity of pGL3-Basic (upper panel) and as a percentage of the activity of pGL3-CV(CMV) in each cell line (lower panel). Data are the mean ± SE from three independent transfection experiments.

Transcription factors binding to the promoter region of the sst2 gene
We analyzed the nuclear extract from GH₃ cells to identify nuclear proteins that bind putative Sp1 and CRE sites using an electrophoretic mobility shift assay (37, 38). The 106-bp probe (-77/+29) contained two putative Sp1 sites [Sp1(A) and Sp1(B) from the proximal site] and one putative CRE site (Fig. 6A). Three oligonucleotides (WT1, WT2, and WT3) corresponding to these sites were used as competitors. The probe bound to the GH₃ nuclear proteins to form complexes a and b (Fig. 6B). These nuclear protein-DNA complexes were competed by an Sp1 consensus oligonucleotide or WT2, but not by an AP2, a CREB consensus oligonucleotide, WT1, or WT3 (Fig. 6B). In the presence of a high concentration of WT2, the probe bound to nuclear proteins and formed complexes c, d, e, and f, which were effectively competed by either the CREB consensus oligonucleotide or WT3. An oligonucleotide MUT1 containing mutations of the Sp1(B) site within WT2 (GGGGCGTGGGGGTTCGTGGG) failed to compete with the probe. An oligonucleotide MUT2B mutated within the CRE site of WT3 (TGACGTCATGTGGTCA) did not bind to the probe, whereas the oligonucleotide MUT2A (TGACGTCATGACGTTG) partially bound to it. Complexes a and b supershifted by the addition of anti-Sp2 and anti-Sp3 antibodies, but not by anti-Sp1 or anti-Sp4 antibodies using GH₃ nuclear extract (Fig. 6C). Complex c was supershifted by antibodies for ATF-2 and c-Jun, but not by those for CREB, ATF-1, ATF-3, ATF-4, and c-Fos, suggesting that a heterodimer of ATF-2 and c-Jun binds to the CRE site. Complex f was also abolished with the antibody of ATF-2 (Fig. 6D). On the other hand, the nuclear extract from HeLa cells produced similar DNA-protein complexes, but not complexes d and e (Fig. 6, C and D). Similar results were obtained using the nuclear extract of NS20Y cells, except for complex d (data not shown). These results demonstrate that Sp2 and/or Sp3 bind to the Sp1(B) site and that both ATF-2 and c-Jun, probably as heterodimers, bind to the CRE site in the proximal promoter region of the rat sst2 gene.

View larger version (94K): [in this window] [in a new window]   Figure 6. Electrophoretic mobility shift assays of the proximal region of the rat sst2 gene promoter. A, The sequences of the probe for gel mobility shift assay and competitor DNAs are shown in upper and lower panels. Each double strand oligonucleotide of wild-type (WT1, WT2, and WT3) includes the indicated region of the sst2 gene promoter. Mutated double strand oligonucleotides (MUT1 and MUT2A and -2B) were synthesized to disrupt the possible Sp1- and CREB-binding sites, respectively. B, Gel mobility shift assays using the 32P-labeled probe (-77/+29) and nuclear extract from GH3 cells. Cold oligonucleotide of -77/+29 (8 ng) were used at a 100-fold molar excess level (lanes 2, 13, and 20). Twenty nanograms of consensus nucleotides (lanes 3–5, 14, and 21) and 1 ng (lanes 6, 8, 10, 15, 17, 22, 24, and 26) or 20 ng (lanes 7, 9, 11, 16, 18, 23, 25, and 27) of wild-type oligonucleotides or mutated oligonucleotides were added to the reaction mixture. The gel mobility shift assay for the CRE motif was performed in the presence of an excess amount of WT2 (40 ng; lanes 19–27). C, Gel mobility shift assay with nuclear extract from GH3 cells (lanes 1–6) and HeLa cells (lanes 7–8) in the presence of antibodies against members of the Sp1 family of transcription factors indicated in the panels. Incubations were performed as described in Materials and Methods. D, Gel mobility shift assay was performed in the presence of 40 ng WT2 using nuclear extract from GH3 cells (lanes 1–12) and HeLa cells (lanes 13–23) with antibodies against members of transcription factors that bind the CRE motif indicated in the panels.

View larger version (39K): [in this window] [in a new window]   Figure 7. Inhibitory effect of Sp1 and CRE site mutations on rat sst2 promoter activity. A schematic representation of the sst2 reporter constructs containing Sp1(B) and/or CRE sites is shown in the left panel. The mutated sites are indicated by X. These constructs (-77/+29/luc and -77/+172/luc) were transfected into GH3 and HeLa cells as indicated in Fig. 4. The relative luciferase activity of each construct is given as a percentage of the control value of the wild-type construct. Each experiment was performed in quadruplicate, and the data are given as the mean ± SE of three independent transfection experiments. **, P < 0.01; ***, P < 0.001 (compared with wild-type control).

View larger version (37K): [in this window] [in a new window]   Figure 8. Predicted amino acid sequence of rat Pitx1 protein and its expression in cultured cells. A, The predicted amino acid sequence was derived from cloned rat Pitx1 cDNA and was compared with those of other species: human (GenBank no. AF009650), mouse (24 ), chicken (GenBank no. AF069397). A dash shows a conserved residue, and a star shows a gap. The homeodomain is boxed. B, The expression of Pitx1 mRNA was detected by RT-PCR in the various cells indicated in the panel. C, The expression of Pitx1 protein was assessed by Western blotting. Whole extracts from male rat pituitary, GH3 cells, and HeLa cells with or without overexpression of Pitx1 were subjected to immunoblotting by antiserum against Pitx1. The molecular masses of the standards are indicated on the right.

View larger version (52K): [in this window] [in a new window]   Figure 9. Effect of overexpression of Pitx1 on the promoter activity of the rat sst2 gene. A, The plasmids (300 ng) containing promoters of sst2 and GH were cotransfected with various amounts of Pitx1 expression vector (pRc-RSV/Pitx1) or empty vector and with pRL-CMV (0.2 ng) as the internal control into HeLa cells. The relative luciferase activity was calculated relative to the activity of each promoter transfected with empty vector (pRc-RSV) as the fold activation. The data are given as the mean ± SE of four samples. The experiment was repeated twice with similar results. B, Analysis of the region required for activation of the rat sst2 promoter by Pitx1. Each construct (300 ng) was cotransfected with 50 ng pRc-RSV/Pitx1 or empty vector and with pRL-CMV (0.2 ng) into HeLa cells. The relative luciferase activity is shown as described above. The data are given as the mean ± SE of four samples. The experiment was repeated twice with similar results. C, Effect of mutation of the CRE site on the activation of promoter activity by Pitx1. Each of the wild-type and mutated constructs (300 ng) were cotransfected with 50 ng pRc-RSV/Pitx1 or empty vector and with pRL-CMV (0.2 ng) into HeLa cells. The relative luciferase activity is shown as described above. The data are given as the mean ± SE of six samples. The experiment was repeated with similar results. *, P < 0.05; ***, P < 0.001 (compared with wild-type control). D, Effect of overexpression of ATF2 and c-Jun on the activation of promoter activity by Pitx1. Each wild-type construct and the mutant of -77/+29/luc (300 ng) were cotransfected with 50 ng pRc-RSV/Pitx1, 50 ng pRc-RSV/ATF-2, and/or 50 ng pRc-RSV/c-Jun or with empty vector into HeLa cells. For normalization of transfection efficiency, 0.2 ng pRL-CMV (0.2 ng) was cotransfected. It should be noted that the Renilla luciferase activity of pRL-CMV increased approximately 6-fold by overexpression of c-Jun. The relative luciferase activity was calculated relative to that of promoterless plasmid pGL3-Basic. The data are given as the mean ± SE of four samples. The experiment was repeated twice with similar results.

View larger version (39K): [in this window] [in a new window]   Figure 10. Activation of promoter activity of the rat sst2 gene by estrogen. A, sst2 mRNA levels were activated by estrogen in GH3 cells. Northern blot analysis of total RNA (25 µg) from GH3 cells treated with 10-8 M estrogen (17ß-estradiol) for the indicated times was performed as described in Materials and Methods. The results for 2.8-kb (•) and 2.4-kb () transcripts of sst2 are shown as a percentage of the control value of untreated cells. Each point represents the mean ± SE of three experiments. B, Effects of estrogen on the promoter activity of the 5'-flanking region of the sst2 gene in GH3 cells. The cells were transiently cotransfected with 300 ng -4066/+172/luc or with 5'-deleted constructs and pRL-TK (16 ng) as an internal control (a). In b, the wild-type (WT) or mutant (MUT2B) construct of -77/+172/luc was transfected into GH3 cells. After transfection, cells were cultured in the medium (phenol red-free DMEM containing charcoal-treated sera) with or without 10-8 M 17ß-estradiol for 24 h. The relative luciferase activity of each construct in GH3 cells treated with estrogen () is given as a percentage of the activity in GH3 cells treated without estrogen (). The data are given as the mean ± SE of four samples (*, P < 0.05; **, P < 0.01; ***, P < 0.001). The experiment was repeated twice with similar results. C, Effects of overexpression of ATF-2 and c-Jun on estrogen responsiveness of the promoter activity in HeLa cells expressing ER. Each wild-type construct and the mutant of -77/+172/luc (300 ng) were cotransfected with 50 ng pRc-RSV/ATF-2, pRc-RSV/c-Jun, or empty vector in the presence of pSV2rER (50 ng) into HeLa cells. For normalization of transfection efficiency, 0.2 ng pRL-CMV (0.2 ng) was cotransfected. After transfection, cells were cultured in the medium (phenol red-free DMEM containing charcoal-treated serum) for 15 h, then in medium with or without 10-7 M 17ß-estradiol for 33 h. The relative luciferase activity was calculated relative to that of promoterless plasmid pGL3-Basic. The data are given as the mean ± SE of six samples (*, P < 0.01). The experiment was repeated twice with similar results.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The 5'-UTR of mouse sst2 gene is separated by two large introns whose sizes are greater than 25 kb (22). The first promoter in front of exon 1 is active only in AtT-20 tumor cells, but not in the pituitary and brain of the normal mouse, in which the second promoter located in exon 2 is used. Although functional analysis of three promoters of the mouse gene has not been fully performed, a CRE site has been identified within the second promoter (40). Considering the nucleotide sequence, the presence of the CRE site and the promoter used in the pituitary and brain, rat exon 1 corresponds to mouse exon 2 (Fig. 11).

View larger version (30K): [in this window] [in a new window]   Figure 11. Comparison of the known cis-acting elements and trans-acting factors of the rat, human, and mouse sst2 genes. The following sources were used to create the figure: rat (this study), human (19 21 23 ), and mouse (22 23 40 ).

We demonstrated that the upstream region adjacent to the rat sst2 exon2 resembled the sequence of 22 bp of the human sst2 promoter. Moreover, our finding that the activity of the intronic promoter of the intron/exon2/luc construct was higher in neuroblastoma cells NS20Y than in nonneuronal cells was compatible with the results for the human sst2 gene promoter (21, 23). In addition, the human sst2 gene has been shown to contain strong promoter activity in the region between 3.8 and 5.3 kb from the transcription start site, which mediates its transcriptional regulation by estrogen (19). These observations suggest that this distal region of the human gene might be another promoter region corresponding to the rat promoter region, as the genomic organization including exon-intron structures are conserved in many genes in general.

The sst2 gene was transcribed from multiple start sites, as has been observed frequently in TATA-less and GC-rich promoters (36, 41, 42). From the results by 5'-RACE and RNase protection analysis, we defined the 5'-end position of the several transcription start sites as +1. The abundant start site of 327 bp upstream from the ATG site using 5'-RACE-Ready cDNAs of the brain was different from the results by the RNase protection assay of the brain RNA. This abundant site may be due to an artifact, because the GC-rich 5'-UTR of mRNA might be not completely copied with reverse transcriptase. The present study shows that the major initiation sites of rat sst2 gene transcription obtained from the analysis using the 5'-RACE methods of SMART technology were similar to those sites by the method of RNase protection assay. The human sst2 gene has been reported to be transcribed at the different major start sites in various tissues, such as a neuroblastoma (21), a breast cancer cell line (19), and a pituitary adenoma (20), using RNase protection analysis.

The reporter assay of various deletion mutants demonstrated that expression of the sst2 gene requires the regions for negative and positive regulation in the 5'-flanking region. The negative regulation was observed not only in GH₃ pituitary cells, but also in nonpituitary cells, including Rat2, C6, NS20Y, and HeLa cells. The negative regulatory sites in the distal promoter region and the mechanism of the negative regulation are totally unknown at present and remain to be investigated in the future.

The promoter in front of mouse exon 3, which corresponds to the human sst2 gene promoter, has been shown to be used in the lung, kidney, and spleen (22). The rat counterpart promoter was also used in C6 glial tumor cells. However, the activity of intronic promoter was less than that of the exon 1 promoter. This discrepancy is unknown at present, but some enhancer may be missing in the construct used in this study. Unfortunately, however, we have not succeeded to obtain the plasmids with longer intron sequences fused with the reporter gene. This may be due in part to many CA repeats at the region upstream of the intron 114 bp used, which is known to show hypermutability (43).

The transcription factor Sp1, which is ubiquitously expressed in various cells, is expressed at a very low level in GH₃ cells (44). Sp2 and Sp3 bound to the Sp1(B) site in HeLa and NS20Y cells as well as Sp1-deficient GH₃ cells. Sp3 is suggested to be a stimulatory transcription factor and to be an inhibitory factor against the action of Sp1 (37). Our preliminary experiments in Sp1 family-negative Drosophila SL2 cells showed that Sp3 increased the rat sst2 promoter activity more effectively than Sp1 and Sp2 and that Sp2 repressed the sst2 transcription activated by Sp3. Thus, the transcription of the rat sst2 gene may be regulated by both Sp3 and Sp2.

The sst2 CRE is the consensus CRE palindrome (TGACGTCA). Single base changes in the consensus CRE palindrome sequence have been reported to influence the function dramatically in the tyrosine hydroxylase gene transcription that is transactivated by CREB (45). In contrast, two-base mutated oligonucleotides of sst2 CRE, MUT2A (TGACGTTG), only partially inhibited the function of the sst2 CRE site, but MUT2B (TGTGGTCA) abolished it completely. The sst2 CRE may be trans-activated by another CREB/ATF-2 family rather than CREB. In fact, both ATF-2 and c-Jun bound to the sst2 CRE site, despite the fact that several members of the CREB/ATF family exist in the cultured cells tested (46, 47).

The bicoid-related homeoprotein Pitx1 was cloned initially as a regulator of POMC gene expression in pituitary corticotropes and is known to be an essential factor for development of the pituitary, mandible, and hindlimb (24, 25). In the pituitary, Pitx1 is present throughout pituitary development and is expressed in all adult pituitary cell lineages and also in pituitary adenomas (25, 26, 27). This factor acts as the pan-pituitary activator of the transcription and activates the transcription of most pituitary hormones, including the glycoprotein hormone -subunit, LHß, FSHß, TSHß, and GH (25, 48). Pitx1 cooperates synergistically with and modulates transcriptional activity by cell-restricted factors, such as Pit-1, NeuroD1/PanI, and steroidogenic factor (SF-1). Pitx1 also synergistically increases transcriptional activity of the LHß gene with SF-1 through a protein-protein interaction, independently of its consensus sequence (49).

Pitx1 activated the promoter activities of the sst2 reporter constructs that contain no putative Pitx1 consensus sequence. As mutation of both the CRE and the Sp1(B) sites reduced the Pitx1 response, and neither ATF-2 nor c-Jun affected Pitx1 trans-activation, the Pitx1 may have interacted with one of the factors accumulating around the CRE site, such as CREB-binding protein (CBP/p300) (50). Further study will be needed to clarify the mechanism of transcriptional activation by Pitx1. Our present finding prompted us to speculate that Pitx1 may play a role in the development of pituitary and nonpituitary organs through trans-activation of genes containing not only a Pitx1 consensus element, but also the CRE site.

In addition to the CRE site of the sst2 gene, the 5'-flanking region encompassed a region of Pitx1 responsiveness. The distal region contained a single bicoid consensus sequence and several Pitx1-binding sites, but a specific binding site should be further established.

We have previously demonstrated that sst2 expression is increased by chronic treatment with estrogen in the pituitary (17). The present study showed that the robust increase in sst2 mRNA was observed after short-term treatment with estrogen. However, the transcriptional effect by estrogen on the promoter activity was weak in this study compared with the increase in cellular mRNA produced by estrogen. We have no data to explain this discrepancy. However, as the steady state level of mRNA reflects a balance between the rates of synthesis and degradation of the transcript, estrogen may act not only on the promoter activity but also on the stability of the sst2 mRNA at posttranscriptional level to result in the increased sst2 mRNA level (35, 51).

The present investigation provided the molecular basis of sst2 regulation by estrogen at the transcriptional level. Although no canonical estrogen response element (ERE) was identified in the proximal promoter region of the sst2 gene, estrogen activated promoter activity via the CRE site, but not the Sp1 site. In ER-negative HeLa cells, overexpression of c-Jun and ER induced estrogen responsiveness in sst2 promoter activity. Our observation was consistent with recent results showing that cyclin D1 promoter activity is stimulated by estrogen with the interaction between ER and c-Jun independently of ERE (52). On the other hand, it has been reported that c-Jun mRNA itself is induced by estrogen via ERE in the tissues, in which estrogen induces cell proliferation (53). As estrogen induces cell proliferation of mammotrophs, the effect of estrogen on sst2 gene expression may be amplified by the induced mRNA expression of c-Jun, which may interact with ER in the pituitary.

The sst2 receptor is expressed in the majority of tumors (2, 11). To date, SRIF analogs and radiolabeled analogs have been investigated for use in cancer therapy and for the diagnosis of tumors and their metastases. Thus, it is important from the aspects of physiological and pathological expression to elucidate the molecular mechanisms controlling sst2 gene expression. The present study revealed that both ATF-2 and c-Jun were required for full expression of the sst2 gene. The activity of these transcription factors is known to be activated through mitogen- and stress-activated protein kinase signal transduction (54). Therefore, the sst2 gene may be highly expressed under a tumorigenic environment, increasing the activated ATF-2 and c-Jun.

In this study we have characterized the upstream region from the ATG codon of the sst2 gene and determined the cis-elements and trans-acting factors that confer the full levels of sst2 promoter activity. Although transcription factors such as the Sp1 family, ATF-2, and c-Jun are ubiquitously expressed, expression of the sst2 gene is relatively restricted (3). Probably, cell- or tissue-specific transcription factors interact with ubiquitous factors and elicit their combined activity that regulates transcription in a tissue-specific manner. Thus, either pituitary-specific homeodomain protein Pitx1 or ER may regulate transcription of the sst2 gene at least in part through the CRE site in the rat pituitary.

	Acknowledgments

 
We acknowledge the generosity of Drs. R. A. Maurer (pRSV-Pit-1) and M. Muramatsu and S. Koike (pSV2rER) in providing the respective reagents.

	Footnotes

 
¹ This work was supported in part by a research grant from the Ministry of Education, Science, Sports, and Culture of Japan (10670075).

Received August 25, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Reichlin S 1983 Somatostatin. N Engl J Med 309:1495–1501[Medline]
2. Patel YC 1999 Somatostatin and its receptor family. Front Neuroendocrinol 20:157–198[CrossRef][Medline]
3. Epelbaum J 1986 Somatostatin in the central nervous system: physiology and pathological modifications. Prog Neurobiol 27:63–100[CrossRef][Medline]
4. Meyerhof W 1998 The elucidation of somatostatin receptor functions: a current view. Rev Physiol Biochem Pharmacol 133:55–108[Medline]
5. Lamberts SW, Krenning EP, Reubi JC 1991 The role of somatostatin and its analogs in the diagnosis and treatment of tumors. Endocr Rev 12:450–482[Medline]
6. Raynor K, Murphy WA, Coy DH, Taylor JE, Moreau JP, Yasuda K, Bell GI, Reisine T 1993 Cloned somatostatin receptors: Identification of subtype-selective peptides and demonstration of high affinity binding of linear peptides. Mol Pharmacol 43:838–844[Abstract]
7. Martinez V, Curi AP, Torkian B, Schaeffer JM, Wilkinson HA, Walsh JH, Tache Y 1998 High basal gastric acid secretion in somatostatin receptor subtype 2 knockout mice. Gastroenterology 114:1125–1132[CrossRef][Medline]
8. Elliott DE, Li J, Blum AM, Metwali A, Patel YC, Weinstock JV 1999 SSTR2A is the dominant somatostatin receptor subtype expressed by inflammatory cells, is widely expressed and directly regulates T cell IFN- release. Eur J Immunol 29:2454–2463[CrossRef][Medline]
9. Zheng H, Bailey A, Jiang MH, Honda K, Chen HY, Trumbauer ME, Van-der-Ploeg LH, Schaeffer JM, Leng G, Smith RG 1997 Somatostatin receptor subtype 2 knock out mice are refractory to growth hormone-negative feedback on arcuate neurons. Mol Encocrinol 11:1709–1717
10. Zitzer H, Honck HH, Bachner D, Richter D, Kreienkamp HJ 1999 Somatostatin receptor interacting protein defines a novel family of multidomain proteins present in human and rodent brain. J Biol Chem 274:32997–33001[Abstract/Free Full Text]
11. Reubi JC, Laissue JA 1995 Multiple actions of somatostatin in neoplastic disease. Trends Pharmacol Sci 16:110–115[CrossRef][Medline]
12. Wulfsen I, Meyerhof W, Fehr S, Richter D 1993 Expression patterns of rat somatostatin receptor genes in pre- and postnatal brain and pituitary. J Neurochem 61:1549–1552[Medline]
13. Reed DK, Korytko AI, Hipkin RW, Wehrenberg WB, Schonbrunn A, Cuttler L 1999 Pituitary somatostatin receptor sst1–5 expression during rat development: age-dependent expression of sst2. Endocrinology 140:4739–4744[Abstract/Free Full Text]
14. Bruno JF, Xu Y, Song J, Berelowitz M 1994 Pituitary and hypothalamic somatostatin receptor subtype messenger ribonucleic acid in the food-deprived and diabetic rat. Endocrinology 135:1787–1792[Abstract]
15. Bruno JF, Xu Y, Berelowitz M 1994 Somatostatin regulates somatostatin receptor subtype mRNA expression in GH₃ cells. Biochem Biophys Res Commun 202:1738–1743[CrossRef][Medline]
16. Xu Y, Song J, Berelowitz M, Bruno JF 1996 Estrogen regulates somatostatin receptor subtype 2 messenger ribonucleic acid expression in human breast cancer cells. Endocrinology 137:5634–5640[Abstract]
17. Kimura N, Tomizawa S, Arai KN, Kimura Na 1998 Chronic treatment with estrogen up-regulates expression of sst2 messenger ribonucleic acid (mRNA) but down-regulates expression of sst5 mRNA in rat pituitaries. Endocrinology 139:1573–1580[Abstract/Free Full Text]
18. Xu Y, Berelowitz M, Bruno JF 1995 Dexamethasone regulates somatostatin receptor subtype messenger ribonucleic acid expression in rat pituitary GH₄C₁ cells. Endocrinology 136:5070–5075[Abstract]
19. Xu Y, Berelowitz M, Bruno JF 1998 Characterization of the promoter region of the human somatostatin receptor subtype 2 gene and localization of sequences required for estrogen-responsiveness. Mol Cell Endocrinol 139:71–77[CrossRef][Medline]
20. Petersenn S, Rasch AC, Presch S, Beil FU, Schulte HM 1999 Genomic structure and transcriptional regulation of the human somatostatin receptor type 2. Mol Cell Endocrinol 157:75–85[CrossRef][Medline]
21. Pscherer A, Dorflinger U, Kirfel J, Gawlas K, Ruschoff J, Buettner R, Schule R 1996 The helix-loop-helix transcription factor SEF-2 regulates the activity of a novel initiator element in the promoter of the human somatostatin receptor II gene. EMBO J 15:6680–6690[Medline]
22. Kraus J, Woltje M, Schonwetter N, Hollt V 1998 Alternative promoter usage and tissue specific expression of the mouse somatostatin receptor 2 gene. FEBS Lett 428:165–170[CrossRef][Medline]
23. Dorflinger U, Pscherer A, Moser M, Rummele P, Schule R, Buettner R 1999 Activation of somatostatin receptor II expression by transcription factors MIBP1 and SEF-2 in the murine brain. Mol Cell Biol 19:3736–3747[Abstract/Free Full Text]
24. Rosenfeld MG, Bach I, Erkman L, Li P, Lin C, Lin S, McEvilly R, Ryan A, Rhodes S, Schonnemann M, Scully K 1996 Transcriptional control of cell phenotypes in the neuroendocrine system. Recent Prog Horm Res 51:217–238
25. Day RN, Koike S, Sakai M, Muramatsu M, Maurer RA 1990 Both Pit-1 and the estrogen receptor are required for estrogen responsiveness of the rat prolactin gene. Mol Endocrinol 4:1964–1971[Abstract]
26. Lamonerie T, Tremblay JJ, Lanctot C, Therrien M, Gauthier Y, Drouin J 1996 Ptx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opiomelanocortin gene. Genes Dev 10:1284–1295[Abstract/Free Full Text]
27. Szeto DP, Rodriguez-Esteban C, Ryan AK, O’Connell SM, Liu F, Kioussi C, Gleiberman AS, Izpisua-Belmonte JC, Rosenfeld MG 1999 Role of the bicoid-related homeodomain factor Pitx1 in specifying hindlimb morphogenesis and pituitary development. Genes Dev 13:484–494[Abstract/Free Full Text]
28. Tremblay JJ, Lanctot C, Drouin J 1998 The pan-pituitary activator of transcription, Ptx1 (pituitary homeobox 1), acts in synergy with SF-1 and Pit 1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol Endocrinol 12:428–441[Abstract/Free Full Text]
29. Pellegrini-Bouiller I, Manrique C, Gunz G, Grino M, Zamora AJ, Figarella-Branger D, Grisoli F, Jaquet P, Enjalbert A 1999 Expression of the members of the Ptx family of transcription factors in human pituitary adenomas. J Clin Endocrinol Metab 84:2212–2220[Abstract/Free Full Text]
30. Kurotani R, Tahara S, Sanno N, Teramoto A, Mellon PL, Inoue K, Yoshimura S, Osamura RY 1999 Expression of Ptx1 in the adult rat pituitary glands and pituitary cell lines: hormone-secreting cells and folliculo-stellate cells. Cell Tissue Res 298:55–61[CrossRef][Medline]
31. Kluxen FW, Bruns C, Lubbert H 1992 Expression cloning of a rat brain somatostatin receptor cDNA. Proc Natl Acad Sci USA 89:4618–4622[Abstract/Free Full Text]
32. Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA 1995 An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 23:1087–1088[Free Full Text]
33. Matz M, Shagin D, Bogdanova E, Britanova O, Lukyanov S, Diatckenko L, Chenchik A 1999 Amplification of cDNA ends based on template-switching effect and step-out PCR. Nucleic Acids Res 27:1558–1560[Abstract/Free Full Text]
34. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts,’ prepared from a small number cells. Nucleic Acids Res 17:6419[Free Full Text]