| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Activation Has Coordinate Effects on Gene Expression in Multiple Insulin-Sensitive Tissues
Departments of Molecular Endocrinology (J.M.W., S.A.K.), Metabolic Diseases (W.W.H., K.K.B., W.K.G.), Discovery Genetics (S.S.S.), and Medicinal Chemistry (T.M.W.), Glaxo Wellcome Inc., Research and Development, Research Triangle Park, North Carolina 27709; and CuraGen Corp. (T.A.M., R.K.R.), New Haven, Connecticut 06511
Address all correspondence and requests for reprints to: Dr. Steven A. Kliewer, Glaxo Wellcome Inc. Research and Development, Venture 118, 5 Moore Drive, Research Triangle Park, North Carolina 27709. E-mail: sak15922{at}glaxowellcome.com
| Abstract |
|---|
|
|
|---|
(PPAR
) agonists,
including the glitazone class of drugs, are insulin sensitizers that
reduce glucose and lipid levels in patients with type 2 diabetes
mellitus. To more fully understand the molecular mechanisms underlying
their therapeutic actions, we have characterized the effects of the
potent, tyrosine-based PPAR
ligand GW1929 on serum glucose and lipid
parameters and gene expression in Zucker diabetic fatty rats. In
time-course studies, GW1929 treatment decreased circulating FFA levels
before reducing glucose and triglyceride levels. We used a
comprehensive and unbiased messenger RNA profiling technique to
identify genes regulated either directly or indirectly by PPAR
in
epididymal white adipose tissue, interscapular brown adipose
tissue, liver, and soleus skeletal muscle. PPAR
activation
stimulated the expression of a large number of genes involved in
lipogenesis and fatty acid metabolism in both white adipose tissue and
brown adipose tissue. In muscle, PPAR
agonist treatment decreased
the expression of pyruvate dehydrogenase kinase 4, which represses
oxidative glucose metabolism, and also decreased the expression of
genes involved in fatty acid transport and oxidation. These changes
suggest a molecular basis for PPAR
-mediated increases in glucose
utilization in muscle. In liver, PPAR
activation coordinately
decreased the expression of genes involved in gluconeogenesis. We
conclude from these studies that the antidiabetic actions of PPAR
agonists are probably the consequence of 1) their effects on FFA
levels, and 2), their coordinate effects on gene expression in multiple
insulin-sensitive tissues. | Introduction |
|---|
|
|
|---|
The glitazones mediate their therapeutic effects by binding and
activating peroxisome proliferator-activated receptor
(PPAR
), a
member of the nuclear hormone receptor family of ligand-activated
transcription factors (1, 2, 5). Recently, potent
nonglitazone PPAR
ligands such as the tyrosine analogs GI262570 and
GW1929 have also been shown to enhance insulin sensitivity in humans
and rodent models of type 2 diabetes (6, 7, 8). PPAR
is
highly expressed in adipose tissue and plays a pivotal role in fat cell
differentiation (1, 9). PPAR
regulates gene expression
by binding as a heterodimer with the 9-cis retinoic acid
receptors (RXRs) to DNA response elements comprised of two copies of
the consensus nuclear receptor half-site sequence AGGTCA organized as a
direct repeat (DR) and separated by a single nucleotide spacer, a
so-called DR-1 motif. PPAR
response elements have been identified in
the regulatory regions of several genes involved in fatty acid and
carbohydrate metabolism (10). In addition to the synthetic
glitazones and tyrosine analogs, PPAR
is activated by various
naturally occurring polyunsaturated fatty acids and polyunsaturated
fatty acid metabolites (2, 5). Thus, PPAR
may represent
a molecular link between fatty acids and insulin sensitivity.
Although the antidiabetic actions of PPAR
agonists are well
established, the mechanism underlying the pharmacological activities of
these drugs has remained obscure. How does activation of PPAR
, which
is highly expressed in fat cells, result in therapeutic effects in
muscle and liver? There are several plausible explanations involving
either direct or indirect effects on muscle and liver (1, 2). To better understand the mechanism by which PPAR
activation improves insulin sensitivity, we have identified genes
regulated by the selective, tyrosine-based PPAR
agonist GW1929 in
major insulin-sensitive tissues, including epididymal white adipose
tissue (WAT), interscapular brown adipose tissue (BAT), soleus skeletal
muscle, and liver of Zucker diabetic fatty (ZDF) rats.
PPAR
-regulated genes were identified using an unbiased and
comprehensive messenger RNA (mRNA) profiling technique, called
GeneCalling (11). In this technique, complementary DNA
(cDNA) fragments representing differentially expressed genes are
identified by comparing the length of each fragment against a sequence
database. The identities of differentially expressed genes are
confirmed by competitive PCR using gene-specific oligonucleotides. Our
results demonstrate that PPAR
activation has coordinate effects on
genes regulating important metabolic pathways in WAT, BAT, skeletal
muscle, and liver.
| Materials and Methods |
|---|
|
|
|---|
Experimental animals and protocols
All procedures performed were in compliance with the Animal
Welfare Act and USDA regulations and were approved by the Glaxo Wellcome Inc., institutional animal care and use committee.
Animals were housed at 72 F and 50% relative humidity with a 12-h
light, 12-h dark cycle, and fed chow diet (Formulab Diet 5008, PMI
Feeds, Inc., Richmond, IN). Age-matched (9 weeks) and glucose-matched
male ZDF rats (Genetic Models, Inc., Indianapolis, IN)
were gavaged twice daily for the indicated periods of time with either
vehicle (0.05 M n-methylglucamine) or GW1929
(5.0 mg/kg). Glucose, triglycerides, and FFAs were measured as
previously described (7).
Biochemical assays
Serum triglyceride and FFA levels were determined using a
Technicon AXON automated chemistry analyzer (Bayer Corp., Tarrytown,
NY) as previously described (7). Serum triglyceride
concentrations were measured using Bayer Corp.
reagents and Axon method SM42148K94. FFA concentrations were measured
using Waco FFA C test kit 99075401 (Waco, Neuss, Germany). Plasma
glucose measurements were made with a glucose analyzer (model 2700,
YSI, Inc., Yellow Springs, OH).
GeneCalling differential gene expression methodology
Genes that were differentially expressed in GW1929-
vs. vehicle-treated ZDF rats were identified by GeneCalling
technology essentially as previously described (11) using
96 different pairs of endonucleases and mRNA prepared from WAT, BAT,
skeletal muscle, and liver. All genes that were determined to be
regulated 1.5-fold or more by treatment were confirmed by competitive
PCR using gene-specific oligonucleotides as previously described
(11).
Real-time quantitative PCR (RTQ-PCR)
RTQ-PCR was performed using an ABI PRISM 7700 Sequence Detection
System instrument and software (PE Applied Biosystems,
Foster City, CA) as previously described (12, 13) with
minor modifications. Briefly, the expression levels of selected genes
were compared between tissues from either vehicle- or GW1929-treated
animals using RNA pooled from each treatment group (three animals per
group). Pooled RNA samples were normalized for comparison by
determining 18S ribosomal RNA levels by RTQ-PCR. Expression levels of
selected genes were determined by generating a seven-point serial
standard curve (each point performed in triplicate) using
vehicle-treated RNA for each gene, with the final assay concentration
ranging from 1.6100 ng total RNA/25 µl reaction. This curve was
used to calculate the amount of target gene mRNA in vehicle and treated
sample based on RTQ-PCR performed with 25 ng total RNA/25-µl reaction
(reactions performed in quintuplicate). Primer/probe sequences
used were as follows: glycerol-3-phosphate acyltransferase: forward,
CGAAGGAGGCTGATCGCA; reverse, ATGATAGCGCAGGACTTGCTG; probe,
ACCTGGCGGAGCACATTCTCTTC-ACC; ketoacyl-coenzyme A (ketoacyl-CoA)
thiolase: forward, ACTCTGCCGACCGTCTGG; reverse,
GAACGCAGTGCATATTTATCCTGT; probe, TGCTGCCTTTGCTGTTT-CTCGAATGG;
heart fatty acid-binding protein (hFABP): forward,
CAAGTCGGTCGTGACACTGG; reverse, CCTGCCCGTCCCACTTC; probe,
CGGAGGCAAACTGGTCCATGTGC; peroxisomal enoyl-CoA isomerase: forward,
CTTCTTGTGAGGAGTCTTGCCA; reverse, CGCAATCATGAGCTTTGTTACC; probe,
TGTCGTGGACTTCACAGCTTTGGCTTT; carnitine/acylcarnitine carrier
protein: forward, TTGGGATCCGTGGCTTCTAC; reverse,
ATCCCACTGGCAGGAACATC; probe, AGGGACTGCGCTCACTCTCATGCG; long chain
enoyl CoA hydratase: forward, CTCCAAGGACACCACAGCGT; reverse,
TTGACCACAATGATGACC-TTCC; probe, TGCCGTGGCCGTGGGTCTC; and
phosphoenolpyruvate carboxykinase (PEPCK): forward,
TGAGGAAGTTTGTGGAAGGCA; reverse, GCCGTCGCAGATGTGAATATACT;
probe, TGCCCAGCTGTGCCAGCCA. Results are expressed as the fold change by
determining the ratio of calculated units of RNA in treated compared
with vehicle groups. ANOVA was used to evaluate statistical
significance.
Generation of cDNA probes
cDNA fragments encoding rat pyruvate dehydrogenase kinase 4
(PDK4; 423 bp) or hFABP (397 bp) were amplified by PCR from 250 ng rat
heart cDNA (CLONTECH Laboratories, Inc., Palo Alto, CA)
using the following PCR primer pairs: PDK4,
5'-CCAATCCACATCGTGTACGTTCC-3' (coding strand) and
5'-TGCGGAAACAAGAGTCCACACACATTC-3' (noncoding strand); and hFABP,
5'-ATGGCGGACGCCTTTGTCGGTAC-3' (coding strand) and
5'-TCACGTTCTCGTAAGTCCGAGTG-3' (noncoding strand). A 544-bp cDNA
fragment encoding a portion of rat PEPCK was amplified by PCR from 250
ng rat liver cDNA (CLONTECH Laboratories, Inc., Palo Alto,
CA) using the primer pair 5'-TCTACGAAGCTCTCAGCTGGCAG-3' (coding strand)
and 5'-TTACATCTGGCTGATTCTCTGTTTC-3' (noncoding strand). Fragments were
labeled with [32P]deoxy-CTP using the MegaPrime
random primers labeling system according to the manufacturers
protocol (Amersham Pharmacia Biotech, Aylesbury, UK).
RNA preparation and Northern blot analysis
Total RNA from liver, WAT, and soleus muscle was prepared from
ZDF rats using TRIzol reagent according to the manufacturers protocol
(Life Technologies, Inc., Gaithersburg, MD), resolved on a
1% agarose/formaldehyde gel, and transferred to a nylon membrane.
After UV cross-linking, filters were prehybridized at 68 C in
Express-Hyb (CLONTECH Laboratories, Inc.) for 60 min,
followed by hybridization to specific 32P-labeled
cDNA probes at a concentration of 1 x 106
cpm/ml for 2 h at 68 C. Filters were washed twice in 2 x SSC
(standard saline citrate)/0.1% SDS for 20 min, followed by a single
wash in 0.1 x SSC/0.1% SDS at 60 C and exposed to storage
phosphor screens for several hours. Northern blots were stripped and
reprobed with ß-actin for normalization. Image analysis and
quantitation from the phosphor screen were performed on a Storm optical
scanner using the ImageQuant software package (Molecular Dynamics, Inc., Sunnyvale, CA).
| Results |
|---|
|
|
|---|
agonist GW1929 in insulin-sensitive tissues
agonist, ZDF rats
were treated for 7 days with either GW1929 or vehicle alone. GW1929 is
a tyrosine-based, nonthiazolidinedione PPAR
agonist that activates
PPAR
in vitro with a half-maximal effective concentration
of about 10 nM. GW1929 is more than 1000-fold
selective for PPAR
relative to either PPAR
or PPAR
(6, 7). As expected, GW1929 treatment resulted in marked decreases
in serum glucose, triglyceride, and FFA levels (Table 1
is much more highly expressed in WAT and BAT than in either
liver or skeletal muscle. Genes with known function that were
identified in this study as regulated 1.5-fold or more by GW1929 are
listed in Table 2
|
|
|
|
(14, 15). Glycogen synthase
expression was also markedly increased by GW1929 treatment (Table 2
GW1929 treatment stimulated the expression of genes involved in
different aspects of fatty acid metabolism in WAT, including
lipoprotein catabolism (lipoprotein lipase; Table 2
, line 24),
fatty acid transport (CD36, fatty acid transport protein, and hFABP;
Table 2
, lines 2527), and fatty acid oxidation
(e.g. carnitine palmitoyltransferase I, short-chain and
long-chain acyl-CoA dehydrogenases, and monoglyceride lipase; Table 2
,
lines 1218 and 20, 21, 23). Several of these genes, including
CD36, lipoprotein lipase, and fatty acid transport protein, were
previously shown to be regulated by glitazones (15, 16, 17).
In agreement with a previous study (18), uncoupling
protein 3 (UCP3) expression was also increased by PPAR
agonist
treatment (Table 2
, line 16). Although its precise function is
unknown, UCP3 expression increases under physiological conditions that
raise FFA levels (19). A recent report showed that
overexpression of UCP3 in the skeletal muscle of mice resulted in the
dissipation of energy (20). Taken together, these changes
in gene expression suggest that increased uptake, storage, and
oxidation of fatty acids in WAT contribute to the marked hypolipidemic
actions of GW1929. We note that expression of the adipocyte fatty
acid-binding protein (aP2), which is directly regulated by PPAR
during adipocyte differentiation and highly expressed in mature fat
cells (21, 22), was only modestly (1.6-fold) increased in
WAT by GW1929 treatment (Table 2
, line 28), whereas expression
of hFABP, which is expressed in a wide variety of tissues
(23), was dramatically stimulated (Table 2
, line
27). Interestingly, GW1929 treatment increased expression of the
transcription factor adipocyte determination and differentiation
factor-1/sterol regulatory element-binding protein-1c (ADD1/SREBP1c)
2.2-fold in WAT (Table 2
, line 65). ADD1/SREBP1c is a
transcription factor that cooperates with PPAR
in promoting
adipocyte differentiation in vitro. Moreover, ADD1/SREBP1c
regulates several genes involved in lipogenesis in mature adipocytes
and may play a broad role in mediating the actions of insulin on genes
involved in lipid and carbohydrate metabolism (24, 25).
GW1929 treatment also induced expression of the rat ortholog of
insulin-induced growth response protein (CL-6; Table 2
, line
45). Although its function is not known, insulin-induced growth
response protein is highly induced in the liver after insulin treatment
and is also known to be expressed in cultured fibroblasts and
adipocytes (26, 27). The induction of CL-6 suggests that
PPAR
activation is potentiating the actions of insulin in WAT.
Expression of several genes was decreased by GW1929 in WAT, including
phosphodiesterase I,
-crystalin, and the contrapsin-like and C1
protease inhibitors (Table 2
, lines 4649). We note that tumor
necrosis factor-
and leptin, which were previously shown to be
inhibited by glitazones (28, 29, 30), were not regulated
1.5-fold or more in WAT or other tissues in this study (data not
shown). This may reflect differences in the animal model, the treatment
regimen, or the PPAR
agonists employed.
BAT
Overall, the pattern of gene regulation by GW1929 in interscapular
BAT was very similar to that seen in WAT, with changes occurring in the
expression of genes involved in lipogenesis and fatty acid transport
and oxidation (Table 2
). These data demonstrate that PPAR
agonists
regulate many common genes in BAT and WAT. Only a few genes were
differentially regulated by GW1929 in BAT relative to WAT. For example,
mitochondrial long chain enoyl-CoA hydratase (Table 2
, line 20)
and PDK4 (Table 2
, line 33), which were modestly up-regulated by
GW1929 in WAT, were down-regulated in BAT. The expression of several
genes that were unaffected by treatment in WAT was decreased in BAT,
including creatine kinase and myoglobin (Table 2
, lines 50 and
51). The significance of these differences between adipose
tissue depots is unclear. However, as BAT and WAT subserve distinct
physiological roles, the finding that there are differences in their
gene expression patterns is not surprising.
Liver
In contrast to WAT and BAT, roughly equal numbers of genes were
up-regulated and down-regulated in liver by GW1929 (Table 2
). Notably,
GW1929 treatment resulted in decreases in the expression of PEPCK,
pyruvate carboxylase, and glucose-6-phosphatase (Table 2
, lines
2931), which are required for hepatic gluconeogenesis. PEPCK
expression was previously shown to be reduced by glitazones in cultured
rat hepatocytes (31) and in streptozotocin-treated rats
(32). These changes in gene expression suggest a molecular
basis for the finding that PPAR
agonists reduce hepatic glucose
production in vivo (33, 34). GW1929 treatment
also decreased the expression of several genes involved in fatty acid
oxidation (Table 2
, lines 14 and 1921) and HMG-CoA synthase
(Table 2
, line 42), which encodes the enzyme responsible for the
rate-limiting step in ketogenesis. The formation of ketone bodies is
decreased by PPAR
agonists in rodent models of insulin resistance
(35). In contrast, GW1929 treatment increased the
expression of several genes involved in lipogenesis (Table 2
, lines 2,
5, 8, and 10) and increased hepatic expression of glucokinase
(Table 2
, line 38), which catalyzes a key step in glucose
metabolism.
Skeletal muscle
In contrast to the other tissues, most of the genes regulated by
GW1929 in skeletal muscle showed decreased expression (Table 2
).
Notably, expression of PDK4 was decreased about 8-fold by GW1929
treatment (Table 2
, line 33). As PDK4 phosphorylates and
inactivates the PDH complex, thus inhibiting oxidative glucose
metabolism, this finding suggests a molecular basis for increased
glucose utilization in muscle of PPAR
agonist-treated animals. In
agreement with this observation, PDH activity was recently shown to be
reduced in ZDF rats and to be restored by troglitazone
treatment (36). GW1929 treatment also resulted in a
coordinate repression of 10 genes involved in fatty acid transport and
oxidation (Table 2
, lines 13, 1622, 26, and 27), suggesting a
decrease in the utilization of fatty acids for energy in the muscle of
treated animals. In agreement with a previous study performed with
pioglitazone (37), UCP3 expression was
decreased by PPAR
agonist treatment (Table 2
, line 16). As
expression of both PDK4 and UCP3 is stimulated by physiological
conditions that increase FFA levels (19, 38), the data
suggest that GW1929 treatment decreases fatty acid levels in muscle.
Expression of aP2 was modestly increased (1.8-fold) in skeletal muscle
(Table 2
, line 28). It is not clear whether this reflects
changes in aP2 expression in myocytes or in adipocytes present in the
soleus muscle tissue. Expression of aP2 can be induced by PPAR
agonists in cultured muscle cells (39, 40), but it is not
known whether this trans-differentiation occurs in
vivo. Taken together, the gene expression data suggest an increase
in glucose utilization and a decrease in fatty acid utilization in the
muscle of PPAR
agonist-treated animals.
GW1929 has opposing effects on gene expression in WAT and muscle
The GeneCalling analysis revealed that many of the same genes
involved in fatty acid transport and oxidation showed increased
expression in WAT and BAT and decreased expression in skeletal muscle
in response to GW1929 treatment (Table 2
). We confirmed the
differential regulation of several of these genes by RTQ-PCR analysis
using RNA derived from WAT or skeletal muscle. As expected, the
expression of glycerol-3-phosphate acyltransferase,
ketoacyl-CoA-thiolase, hFABP, peroxisomal enoyl-CoA isomerase,
carnitine/acylcarnitine carrier protein, and long-chain enoyl-CoA
hydratase was significantly increased in WAT and decreased in muscle by
GW1929 (Fig. 1
). The magnitudes of these changes roughly paralleled
those seen in the GeneCalling analysis (Fig. 1
and Table 2
). These data
provide strong evidence that PPAR
activation differentially
modulates fatty acid metabolism in WAT and muscle.
Time course for the tissue-specific effects of GW1929
We sought to determine the kinetics with which GW1929 affected
serum glucose and lipid levels and gene expression in different
insulin-sensitive tissues. ZDF rats were treated with either GW1929 or
vehicle alone for 6 h, 24 h, or 7 days to distinguish early
effects from secondary effects. Clinical parameters were measured, and
total RNA was prepared from WAT, liver, and muscle at each time point.
A statistically significant decrease in FFA levels was observed at
24 h, although a more modest decrease was seen at the 6 h
point (Table 3
). Changes in serum glucose
and triglyceride levels were seen only at 7 days (Table 3
). These data
demonstrate that PPAR
agonist-induced decreases in FFA levels
precede those in glucose and triglyceride levels, suggesting that
decreases in FFA levels may be important for the insulin-sensitizing
actions of PPAR
agonists.
|
activation and precede the decreases in serum triglyceride and glucose
levels. However, the time lag between these early events and decreases
in serum glucose levels suggests that other factors may be critical for
the improvement in insulin sensitization. The time-course results raise
the interesting possibility that the effects of GW1929 on PDK4
expression are due to direct activation of PPAR
in muscle rather
than being a secondary effect of PPAR
activation in adipose tissue.
However, as PDK4 is known to be regulated by fatty acids
(38), we cannot rule out the possibility that regulation
of its expression is secondary to effects on FFA levels. In this
regard, the most dramatic regulation of PDK4, hFABP, and PEPCK was
observed at the 7 day point (Fig. 2| Discussion |
|---|
|
|
|---|
agonists in the treatment of
insulin resistance and type 2 diabetes is now firmly established.
However, the mechanism underlying the glucose- and lipid-lowering
actions of PPAR
agonists has remained obscure. In this report we
have used an unbiased and comprehensive mRNA profiling technique to
systematically identify genes regulated by a potent PPAR
agonist in
four insulin-responsive tissues. Most of the PPAR
-regulated genes
that were identified in this study fall into key metabolic pathways
involved in carbohydrate and/or lipid homeostasis. As might be expected
based on its expression levels, we found that PPAR
regulates many
more genes in adipose tissue than in either liver or muscle.
Nevertheless, the gene expression data reveal that PPAR
activation
has coordinate effects on fundamental metabolic pathways in each of
these tissues, including glucose and fatty acid metabolism in skeletal
muscle and gluconeogenesis in the liver (Fig. 3
|
-regulated genes have been identified in muscle that
can readily account for the increase in glucose disposal effected by
PPAR
ligands. In this report we show that GW1929 treatment results
in a marked decrease in PDK4 expression in muscle. PDK4 phosphorylates
and inactivates the PDH complex, which catalyzes the first irreversible
step in oxidative glucose metabolism. Thus, decreases in PDK4 levels
would be expected to result in increases in glucose oxidation. A recent
study showed that PDH activity in soleus muscle was reduced in ZDF rats
relative to that in their lean littermates and was restored to normal
levels by troglitazone treatment (36). PDK
activity is increased in response to fatty acids and has been proposed
to play a primary role in the development of insulin resistance in
obese individuals (41). Notably, PDK4 expression in
skeletal muscle has been shown to positively correlate with plasma
insulin concentrations and to negatively correlate with
insulin-mediated glucose uptake in nondiabetic Pima Indians, a
population with a high prevalence of type 2 diabetes associated with
obesity (42). Thus, the inhibition of PDK4 expression may
represent an important mechanism by which PPAR
agonists enhance
glucose utilization in muscle.
In addition to its effects on PDK4 expression, GW1929 treatment
resulted in a coordinate decrease in the expression of a number of
genes involved in fatty acid transport and oxidation in muscle. These
data are consistent with a decreased reliance on fatty acids and an
increased reliance on glucose as an energy source in muscle.
Strikingly, expression of these same genes was increased in adipose
tissue in response to GW1929, suggesting that PPAR
activation
promotes a flux of fatty acids into adipose tissue and away from muscle
(Fig. 3
). In this regard, two recent studies showed that glitazone
treatment decreased triglyceride levels in the skeletal muscle of ZDF
rats (36, 43). Repartitioning of fatty acids from muscle
to adipose tissue might be expected to enhance insulin sensitivity
based on the Randle cycle, in which fatty acids and glucose compete for
use as energy substrate in muscle (41). FFAs are also
known to stimulate glucose production in the liver (41, 44). Hence, a flux of fatty acids away from liver might also
account for the decreases that we observed in the expression of PEPCK,
pyruvate carboxylase, and glucose-6-phosphatase (Fig. 3
).
Do PPAR
agonists regulate gene expression in muscle and liver by
direct receptor activation or by more indirect means, such as altering
metabolite levels? In time-course studies, we found that PPAR
agonist-induced decreases in FFA levels preceded drops in glucose and
triglyceride levels (Table 3
). These data suggest that decreases in FFA
levels may be important for the insulin-sensitizing actions of PPAR
agonists. However, the time lag between the decreases in FFA and
glucose levels suggests that other factors are likely to be important
in insulin sensitization. Interestingly, the expression of PDK4, which
we used as a marker of changes in gene expression in muscle, was
decreased as early as 24 h posttreatment (Fig. 2
). These changes
preceded those in serum triglyceride and glucose levels but occurred at
roughly the same time as the decreases in FFA levels. Thus, the effects
of GW1929 on the expression of PDK4 and other genes in muscle may be
secondary to changes in circulating FFA concentrations. It is important
to note, however, that our studies do not rule out direct effects of
PPAR
agonists on muscle. Several studies have shown that the PPAR
protein is present in human and rodent muscle (45, 46),
and troglitazone has been reported to regulate gene
expression and enhance glucose utilization in human muscle cultures
(40, 47). Moreover, troglitazone was shown to
improve insulin sensitivity in mice that had been engineered to lack
adipose tissue (48), demonstrating that PPAR
agonists
can affect metabolism in the absence or near absence of fat. Conclusive
evidence that PPAR
agonists mediate effects directly on muscle is
likely to require gene knockout animals in which the PPAR
gene has
been disrupted in specific tissues. We note that in our time-course
studies, PEPCK expression in liver was altered only at the 7 day point,
suggesting that its regulation may be secondary to changes in FFAs or
other metabolites.
In conclusion, we have demonstrated that PPAR
regulates genes
involved in key metabolic pathways in adipose tissue, muscle, and
liver. In muscle, PPAR
activation decreased the expression of PDK4
and a series of genes involved in fatty acid metabolism. These changes
are likely to account in part for the enhancement of glucose
utilization mediated by PPAR
agonists. In liver, PPAR
activation
reduced the expression of three genes involved in gluconeogenesis,
which is likely to account for the effects of PPAR
agonists on
hepatic glucose production. Thus, the therapeutic actions of PPAR
agonists represent their coordinate effects in multiple,
insulin-sensitive tissues.
| Acknowledgments |
|---|
Received September 19, 2000.
| References |
|---|
|
|
|---|
agonists. I. Discovery of a novel series of potent antihyperglycemic
and antihyperlipidemic agents. J Med Chem 41:50205036[CrossRef][Medline]
reverses the diabetic phenotype of
the Zucker diabetic fatty rat. Diabetes 48:14151424[Abstract]
agonist, improves metabolic control in
type 2 diabetes mellitus patients. Diabetes 49:157 (Abstract)[Abstract]
: an essential regulator of
adipogenesis and modulator of fat cell function. Cell 99:239242[CrossRef][Medline]
, the ultimate thrifty gene.
Diabetologia 42:10331049[CrossRef][Medline]
2 regulates adipose expression of the phosphoenolpyruvate
carboxykinase gene. Mol Cell Biol 15:351357[Abstract]
and PPAR
activators. J Biol Chem 272:2821028217
and PPAR
activators direct a distinct tissue-specific transcriptional response
via a PPRE in the lipoprotein lipase gene. EMBO J 15:53365348[Medline]
2: tissue-specific regulator of an adipocyte
enhancer. Genes Dev 8:1224234
2, a lipid-activated
transcription factor. Cell 79:11471156[CrossRef][Medline]
. J
Clin Invest 98:10041009[Medline]
and its receptors during drug and dietary
modulation of insulin resistance. Endocrinology 134:264270[Abstract]
and C/EBP
. Proc Natl Acad Sci USA 92:985698560
. J Clin Endocrin Metab 83:28302835
agonist) action. Endocrinology 139:50345041This article has been cited by other articles:
![]() |
K. Sevastianova, J. Sutinen, K. Kannisto, A. Hamsten, M. Ristola, and H. Yki-Jarvinen Adipose tissue inflammation and liver fat in patients with highly active antiretroviral therapy-associated lipodystrophy Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E85 - E91. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Kershaw, M. Schupp, H.-P. Guan, N. P. Gardner, M. A. Lazar, and J. S. Flier PPAR{gamma} regulates adipose triglyceride lipase in adipocytes in vitro and in vivo Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1736 - E1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ranalletta, X. Q. Du, Y. Seki, A. S. Glenn, M. Kruse, A. Fiallo, I. Estrada, T.-S. Tsao, A. E. Stenbit, E. B. Katz, et al. Hepatic response to restoration of GLUT4 in skeletal muscle of GLUT4 null mice Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1178 - E1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. I. Anghel, E. Bedu, C. D. Vivier, P. Descombes, B. Desvergne, and W. Wahli Adipose Tissue Integrity as a Prerequisite for Systemic Energy Balance: A CRITICAL ROLE FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR {gamma} J. Biol. Chem., October 12, 2007; 282(41): 29946 - 29957. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liao, M. T. A. Nguyen, T. Yoshizaki, S. Favelyukis, D. Patsouris, T. Imamura, I. M. Verma, and J. M. Olefsky Suppression of PPAR-{gamma} attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E219 - E227. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pravenec and T. W. Kurtz Molecular Genetics of Experimental Hypertension and the Metabolic Syndrome: From Gene Pathways to New Therapies Hypertension, May 1, 2007; 49(5): 941 - 952. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Wajchenberg {beta}-Cell Failure in Diabetes and Preservation by Clinical Treatment Endocr. Rev., April 1, 2007; 28(2): 187 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. O. Li, D. G. Mashek, J. An, S. D. Doughman, C. B. Newgard, and R. A. Coleman Overexpression of Rat Long Chain Acyl-CoA Synthetase 1 Alters Fatty Acid Metabolism in Rat Primary Hepatocytes J. Biol. Chem., December 1, 2006; 281(48): 37246 - 37255. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yang, C.-C. Chan, O.-S. Kwon, S. Liu, J. McGhee, S. A. Stimpson, L. Z. Chen, W. W. Harrington, W. T. Symonds, and D. C. Rockey Regulation of peroxisome proliferator-activated receptor-{gamma} in liver fibrosis Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G902 - G911. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu, A. H. Moser, J. K. Shigenaga, K. R. Feingold, and C. Grunfeld Type II nuclear hormone receptors, coactivator, and target gene repression in adipose tissue in the acute-phase response J. Lipid Res., October 1, 2006; 47(10): 2179 - 2190. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gastaldelli, Y. Miyazaki, A. Mahankali, R. Berria, M. Pettiti, E. Buzzigoli, E. Ferrannini, and R. A. DeFronzo The Effect of Pioglitazone on the Liver: Role of adiponectin Diabetes Care, October 1, 2006; 29(10): 2275 - 2281. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Laplante, W. T. Festuccia, G. Soucy, Y. Gelinas, J. Lalonde, J. P. Berger, and Y. Deshaies Mechanisms of the Depot Specificity of Peroxisome Proliferator-Activated Receptor {gamma} Action on Adipose Tissue Metabolism. Diabetes, October 1, 2006; 55(10): 2771 - 2778. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Allen, F. Zhang, S. A. Moodie, L. E. Clemens, A. Smith, F. Gregoire, A. Bell, G. E.O. Muscat, and T. A. Gustafson Halofenate Is a Selective Peroxisome Proliferator-Activated Receptor {gamma} Modulator With Antidiabetic Activity Diabetes, |