help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takeuchi, S.
Right arrow Articles by Takahashi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takeuchi, S.
Right arrow Articles by Takahashi, S.
Endocrinology Vol. 142, No. 12 5158-5166
Copyright © 2001 by The Endocrine Society

GRH-SOMATOSTATIN-GH

Identification of a Novel GH Isoform: A Possible Link between GH and Melanocortin Systems in the Developing Chicken Eye

Sakae Takeuchi, Masahiko Haneda, Kiyoshi Teshigawara and Sumio Takahashi

Department of Biology, Faculty of Science, Okayama University, Okayama 700-8530, Japan

Address all correspondence and requests for reprints to: Sakae Takeuchi, Ph.D., Department of Biology, Faculty of Science, Okayama University, 3-1-1 Tsushimanaka, Okayama 700-8530, Japan. E-mail: stakeuch{at}cc.okayama-u.ac.jp


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GH is considered to play a role in the pathogenesis of diabetic retinopathy, causing neovascularization in the retina. The present study was conducted to assess the possibility that GH may play a role in ocular development by determining whether GH is expressed in the eye of the chicken during development. In the 17-d-old embryo, immunocytochemistry detected immunoreactive GH in retinal pigment epithelial (RPE) cells. Characterization of GH mRNA expressed in the eye by RT-PCR and rapid amplification of cDNA 5'-ends revealed it to be a novel GH mRNA transcribed from the middle of the intron 3 of the chicken GH (cGH) gene. The deduced protein, designated small GH isoform (s-cGH), was a cytosolic protein of 16.5 kDa with 140 amino acid (aa) residues, lacking the signal peptide and the N-terminal 71 aa residues of 22-kDa cGH, replacing them with 20 aberrant aa residues, and identical to 22-kDa cGH for the C-terminal 120-aa residue portion. Western blotting determined the molecular size of immunoreactive GH in RPE cells to be 80–84 kDa, similar to the computed molecular mass of s-cGH/GH receptor complex. Furthermore, RT-PCR demonstrated that GH receptor mRNA, but not s-cGH mRNA, was expressed in RPE cells. These results suggest that RPE cell is one of the target cells of s-cGH in the eye. During embryonic development, the immunoreactivity for s-cGH in RPE cells was initially observed on embryonic d 10, and the staining intensity increased and peaked on embryonic d 17. By hatching, s-cGH immunoreactivity in RPE cells was gradually decreased, and it was not detectable after hatching. This ontogenetic staining pattern correlates well with the pattern of the production of {alpha}MSH in RPE cells. The cell type expressing s-cGH remains to be identified; however, our findings imply a possible involvement of GH in the regulation of ocular development by acting on the intraocular melanocortin system in the chicken.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
GH IS CONSIDERED essential for postnatal somatic growth in virtually all vertebrate species, exerting its effects on growth by hepatic production of IGF-I together with local release of IGF-I in at least some target tissues (1). Besides the growth-promoting activity, GH is now widely recognized to have a broad array of physiological actions in both the central nervous system and the periphery; some are considered direct effects, and others are mediated by IGF-I (2, 3, 4, 5). The best known source of GH is the somatotroph in the anterior lobe of the pituitary, but GH is also produced locally and acts in autocrine and/or paracrine ways in extrapituitary tissues such as immune and mammary tissues (4, 6, 7).

In higher vertebrates, GH is encoded by a single copy gene consisting of five exons and four introns that produces a single species of mRNA translated into a precursor GH (pro-GH) with a conventional secretory signal peptide. The newly synthesized GH is a protein of 22 kDa with about 191 amino acid (aa) residues; the number of residues varies slightly with GH from different species (8). GH subsequently undergoes posttranslational modifications to yield a series of GH variants differing in mass, charge (8, 9, 10, 11), and even biological activities or potency (12, 13, 14, 15, 16, 17, 18); these modifications include deamidation, glycosylation, phosphorylation, acetylation, proteolytic cleavage, and dimerization/oligomerization. The only exception known to date is the human, in which GH heterogeneity is due to the presence of two nonallelic GH genes, hGH-N and hGH-V, and alternative splicing of the hGH-N transcript besides the posttranslational modifications (8, 9). In the chicken, GH variants differing in charge and size have been observed in the pituitary glands (14, 15, 18, 19) as have glycosylated (20, 21), phosphorylated (22, 23), and cleaved forms (24). As the relative proportion of the GH variants exhibits ontogenetic changes, it is suggested that GH variants exert distinct biological functions during late embryonic development and posthatch growth in the chicken (18).

Recently, immunoreactive GH (ir-GH) and immunoreactive GH receptor (ir-GHR) have been demonstrated to be expressed in most of early embryonic tissues of the chicken (25). Based on the fact that IGF-I and its receptor are widely expressed in chick embryos from the first day of development (26, 27), extrapituitary GH has been proposed to act as a local growth factor to participate in embryogenesis and organogenesis (25). In the chicken eye, IGF-I is expressed in the retina of embryos from embryonic d (ED) 7 to ED18, when proliferation and differentiation of retinal cells occur, and IGF-I stimulates DNA synthesis of the retina (28). In humans, GH and/or IGF-I are thought to play a role in the pathogenesis of diabetic retinopathy, causing neovascularization in the retina (29). Moreover, reduced retinal vascularization (lower number of vascular branching points) has been reported in children with congenital GH deficiency regardless of whether they were treated with GH (30). Considering these facts, it might be speculated that GH would play an important role in organogenesis of the eye.

The aim of the present study was to assess the possibility that GH may play a role in ocular development by determining whether GH is expressed in the eye of the chicken during development. By a combination of immunocytochemistry, RT-PCR, and rapid amplification of cDNA 5'-ends (5'RACE), we demonstrate here that a novel GH isoform is expressed in the chicken eye, and that its binding to the retinal pigment epithelial cells (RPE cells) is temporally regulated and correlates well with the production of {alpha}MSH in RPE cells during embryonic development. The results imply a possible involvement of the GH isoform in the regulation of ocular development by acting on the intraocular melanocortin system in the chicken. This is the first report demonstrating that GH gene produces distinct GH isoforms by alternative usage of transcription initiation sites.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Tissues for RNA extraction, protein preparation, and immunocytochemistry were obtained from Rock Cornish chicks and/or embryos purchased from a commercial grower (Fukuda Poultry Breeding Farm, Okayama, Japan).

Isolation of eye layers and other eye tissues
Rock Cornish embryos on ED17 were killed by cervical dislocation. The eyes were then rapidly dissected and placed in Ca2+- and Mg2+-free Hanks’ solution containing 20 mM HEPES and 0.3% BSA (fraction V, Sigma, St. Louis, MO; CMF-HSH-BSA). An incision was made slightly posterior to the corneal limbus, and the anterior sections, lens, and vitreous humor were then removed. The remaining posterior cup was divided into three or four pieces and placed in 0.5 mM EDTA in CMF-HSH-BSA at 4 C for 30 min and subsequently at 37 C for 40 min. The tissue was washed twice with CMF-HSH-BSA. The layers of RPE, neural retina, and choroid were membranously separated from the tapetum using forceps. Those tissues were immediately frozen in liquid nitrogen and stored at -70 C before being used for RNA preparation. To assess the purity of the isolated tissues, some tissue fragments were subjected to standard histochemical analysis.

Immunocytochemistry
Rock Cornish chicks or embryos were killed by cervical dislocation, and the eye layers were dissected as described above. Pieces of the posterior cup were fixed with Bouin’s solution (24 h at 4 C) and processed by sequential immersion: twice in 70% ethanol (8 h at 4 C); in 80%, 90%, 95%, 100%, and 100% ethanol (20 min each at 4 C); twice in 100% xylene (5 min at room temperature); in a 1:1 mixture of paraffin (Paraplast, Sherwood Medical, St. Louis, MO)-xylene (10 min at 50 C); and in Paraplast (10 min at 50 C), then embedded in Paraplast. Five-micron sections were cut and mounted onto microscope slides. Slides bearing eye sections were deparaffinized and rehydrated by sequential immersion at room temperature: twice in xylene (15 min); in 100%, 100%, 90%, and 70% ethanol (5 min each); and in distilled water (DW; 5 min), then treated with 0.3% hydrogen peroxide in methanol for 10 min at room temperature to inhibit endogenous peroxidase activity. After being rinsed three times in DW and once in 0.01 M PBS (0.14 M sodium chloride in 0.01 M sodium phosphate, pH 7.6), the slides were subjected to immunostaining using a specific antiserum and a Vectastain ABC kit (Vector Laboratories, Inc., Burlingame, CA) according to the manufacturer’s directions. The antiserum used as a first antiserum was antirat GH (1:4000). The production and characterization of the antiserum used in this study have been described previously (31). To decolorize melanin pigments in the RPE cells, slides were oxidized for 10 sec at room temperature with Gomori’s oxidization mixture consisting of 0.5% potassium permanganate and 0.25% sulfuric acid, bleached in 3% sodium bisulfite for 20 sec, and then rinsed by sequential immersion at room temperature: three times in DW (5 min); in 0.1 M Tris-HCl, pH 8.0 (5 min); twice in DW (5 min); and in 0.01 M PBS, pH 7.6 (5 min), then were subjected to immunostaining. Nonspecific immunoreactivity was blocked by incubating the slides in 2% low fat milk (wt/vol) in 0.01 M PBS, pH 7.6, for 1 h at room temperature. They were then incubated with the first antiserum in 0.01 M PBS, pH 7.6, for 24 h at 4 C in a humidified box and were washed three times with 0.01 M PBS, pH 7.6. The slides were incubated with biotinylated antirabbit IgG in 0.01 M PBS, pH 7.6 (1:100), for 1 h, and then with avidin-biotinylated peroxidase complex for 30 min at room temperature. They were washed three times with 0.01 M PBS, pH 7.6. Sections were immunostained in the dark for 90 sec at room temperature in 0.02% 3,3'-diaminobenzidine tetrahydrochloride (wt/vol) solution containing 2–3 drops/50 ml intensifier included in the Vectastain ABC kit (Vector Laboratories, Inc.) and 0.05 M sodium phosphate, pH 7.6. The resulting slides were washed three times with DW for 5 min each time, stained with hematoxylin for 5 min, and then rinsed under running water for 5 min. They were dehydrated by passage through a graded ethanol series (70%, 90%, 100%, and 100%, 5 min each) and xylene (5 min twice), mounted in paramount, and coverslipped. As negative controls, some sections were processed as described above, except that 2% low fat milk (wt/vol) was used in place of each first antiserum. The primary antibody was absorbed with 5 µg/100 µl antiserum of highly purified rat GH (NIDDK, rGH-I-5) or BSA (Sigma) for 24 h at 4 C before being used for immunostaining.

Western blotting
Rock Cornish embryos on ED17 were killed by cervical dislocation, and the layer of the RPE was prepared as described above. Three-day-old Rock Cornish chicks were killed by cervical dislocation, and the anterior pituitaries were then rapidly dissected in CMF-HSH-BSA. Extracts of those tissues were prepared by the method described previously (32). Briefly summarized, those tissues were rapidly homogenized in a buffer containing 0.01 M Tris-HCl and 2% Nonidet P-40, pH 8.8, employing a Potter-type homogenizer on ice. The resulting homogenates were subsequently sonicated for 20 min and then centrifuged (135,000 x g) for 30 min at 4 C. The supernatants were collected, and protein content was determined by the Bradford method using a protein assay kit (Bio-Rad Laboratories, Inc., Richmond, CA). Aliquots corresponding to 5 µg (for pituitary) or 15 µg (for RPE) total protein were boiled for 5 min in the presence of 5% SDS and 3% ß-mercaptoethanol before being subjected to vertical SDS-PAGE in 15% gels or 7.5–20% gradient gels using the buffer system of Laemmli (33). After electrophoresis, the gels were equilibrated in transfer buffer (0.025 M Tris, 0.2 M glycine, and 20% methanol) and transferred electrophoretically onto Hybond-P membranes (Amersham Pharmacia Biotech, Uppsala, Sweden). The membranes were blocked with 5% low fat milk in PBS-T (0.1% Tween 20 in 0.01 M PBS, pH 7.6) for 1 h at room temperature, and then incubated with the antirat GH antiserum (1:5000) in PBS-T for 1 h at room temperature. After being rinsed twice in PBS-T for 10 min each time, the membranes were incubated with a secondary antibody (goat antirabbit IgG) conjugated to horseradish peroxidase (1:3000; Bio-Rad Laboratories, Inc.) for 1 h at room temperature, then rinsed three times in PBS-T for 10 min each time at room temperature. Detection of immunoreactive proteins was performed using an ECL kit (Amersham Pharmacia Biotech) according to the manufacturer’s directions. Molecular weight markers from Daiichi Pharmaceutical Co. Ltd. (Tokyo, Japan) were used to determine the relative molecular weights of immunostained bands.

RT-PCR analysis
Total RNA was prepared from tissues using the method of Chomczynski and Sacchi (34). One microgram of each total RNA was reverse transcribed using Superscript II reverse transcriptase (Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s directions. A 0.1-ml aliquot of the reaction was used in each PCR, using specific primers for GH, GHR, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers specific for GAPDH were described previously (35). The forward primers located in exons 1 (PE1F) and 4 (PE4F) of the chicken GH (cGH) gene were TCAAGCAACACCTGAGCAACT C and TTTTGGCACCTCAGACAGAGTG, respectively, and the reverse GH primer located in exon 5 (PE5R) was CTGTGGGTTTATTCCTCGTGT. The primers for GHR were CACAGATACCCAACAGCCGCAT and ACCCAACCCAAAGCTGACTC TG. PCR was carried out using TAKARA Taq DNA polymerase (TAKARA, Otsu, Japan) and a thermal cycler (Gene Amp PCR System 9700, PE Applied Biosystems, Foster City, CA). The temperature cycling conditions for the PCR were 35 cycles of reactions including denaturation for 30 sec at 95 C and extension for 1 min at 60 C, followed by additional extension for 10 min at 60 C. In some cases PCR was carried out with various cycling numbers to compare the expression levels of a gene among different tissues. A 0.1-ml aliquot of each resulting reaction was electrophoresed on a 2.0% agarose gel, stained with ethidium bromide, and photographed under UV illumination. The amplified cDNA fragments were then subcloned into a pGEM3Zf+ plasmid and subjected to sequencing. Dideoxynucleotide sequencing was performed using fluorescent primers and an automated DNA sequencer (PE Applied Biosystems 373A). The size of the amplicon is 637 bp for GHR. The set of PE1F and PE5R primers should produce 773-bp products from cDNA of pituitary cGH. Similarly, the set of PE4F and PE5R primers should produce 360-bp products.

5'RACE analysis of GH mRNA
The 5'RACE analysis was performed using a 5'/3'RACE kit (Roche, Sandhofer Strasse, Mannheim, Germany) according to the manufacturer’s directions. Total RNA was prepared from tissues using a GLASS MAX RNA Microisolation Spin Cartridge System (Life Technologies, Inc.), and 2 µg of each total RNA were reverse transcribed using PE5R as gene-specific primer-1. Two gene-specific primers-2 were used in subsequent amplification of GH cDNA; PE4R (exon 4 primer) and PE5R1 (exon 5 primer) were AACCAGTGAAAACCGAAGCAG and CTTGTCGTAGGTGGGTCT. A 0.1-ml aliquot of each PCR reaction was electrophoresed on a 2.0% agarose gel, stained with ethidium bromide, and photographed under UV illumination. The amplified cDNA fragments were subcloned into a pGEM3Zf+ plasmid and subjected to sequencing. Sequence analysis was carried out using GENETYX software.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Immunocytochemistry and Western blot analysis were used to determine whether the antirat GH antiserum used in this study is capable of detecting cGH. As shown in Fig. 1AGo, most of immunoreactive cells were localized in the caudal lobe of the anterior pituitary, correlating well with the distribution of the somatotrophs, the GH-producing cells in the pituitary (upper panel). Moreover, immunostaining was completely abolished by preincubation of the antiserum with highly purified rat GH (lower panel). This immunoreactivity was also shown to be associated with proteins similar in size to GH moieties reported previously (Fig. 1BGo) (18); the estimated molecular masses of major and minor bands were 22 and 40 kDa, respectively. These results clearly demonstrate that the anti-GH antiserum can detect the cGH.



View larger version (93K):
[in this window]
[in a new window]
  		Figure 1. Evaluation of the ability of the antirat GH antiserum used in this study to detect chicken GH. A, Immunocytochemical localization of GH-immunoreactive cells in the anterior pituitary gland of 3-d-old Rock Cornish chicks. Light micrographs are representative examples of immunostaining using antirat GH antiserum preabsorbed with BSA (upper panel) or purified rat GH (lower panel). The transverse sections show the distribution of immunoreactive somatotrophs in the caudal (Ca) and cephalic (Ce) lobes of the anterior pituitary gland. Scale bar, 0.4 mm. B, Western blot analysis of immunoreactive GH expressed in the anterior pituitary gland of 3-d-old Rock Cornish chicks. The autoluminogram is a representative example of Western blots. Pituitary extract (5 µg) was subjected to SDS-PAGE in a 15% gel under reducing conditions, and immunoreactive GH bands were detected chemiluminescently using antirat GH antiserum and an ECL kit.

 
Immunostaining with the anti-GH antiserum was performed on eye sections of chick embryos on ED17, when a large amount of IGF-I has been demonstrated to be present in the retina (28). As shown in Fig. 2AGo, RPE cells were stained intensely. The immunoreactivity of the RPE cells disappeared after preabsorption of the antiserum with rat GH (Fig. 2BGo). In the negative control, no immunoreactivity was observed (Fig. 2CGo). These results indicate that GH-like immunoreactive material exists in the RPE cells of ED17 chick embryos.



View larger version (62K):
[in this window]
[in a new window]
  		Figure 2. Immunocytochemical localization of immunoreactive GH in the eye of Rock Cornish embryos on ED17. Light micrographs are representative examples of immunostaining using antirat GH antiserum preabsorbed with BSA (A) or purified rat GH (B) as first antiserum and using low fat milk instead of first antiserum (C; control). RPE and NR indicate layers of the retinal pigment epithelium and the neural retina, respectively. Immunoreactivity is represented by half-tone staining. Scale bar, 40 µm.

 
The pituitary somatotrophs secretes GH from ED16 (36), and plasma GH is detectable from ED17 in the chicken (37). It is therefore possible that the ir-GH observed in RPE cells on ED17 could result from the sequestration of pituitary GH. To examine intraocular expression of GH at the mRNA level, total RNA was prepared from whole eyes of ED17 embryos and subjected to RT-PCR analysis. Total RNA from hearts of ED6 embryos was also examined, because intense GH immunoreactivity has been reported (25), and total RNA from anterior pituitaries of 3-d-old chicks was used as a positive control. The RT-PCR with the primer set of PE4F and PE5R amplified GH cDNA in all three samples (Fig. 3Go, left panel), indicating that GH mRNA is expressed in the eye and heart of chick embryos. Coexpression of GHR mRNA (Fig. 3Go, right panel) suggests local actions of GH in those tissues. Notably, although GH mRNA was detectable by RT-PCR with the primer set of PE4F and PE5R in all tissues examined, the set of PE1F and PE5R primers amplified GH cDNA only in sample from anterior pituitaries (Fig. 3Go, left panel), implying the structural heterogeneity of GH mRNA.



View larger version (66K):
[in this window]
[in a new window]
  		Figure 3. RT-PCR analysis of the expression of GH and GH receptor mRNAs in the eye (ED17) and heart (ED6) of Rock Cornish embryos. The left panel shows the electrophoretic pattern of PCR products amplified using PE1F or PE4F as a GH forward primer. The location of each GH primer is presented schematically below the panel. E1–E5, Exons 1- 5, respectively. The right panel shows the electrophoretic pattern of PCR products amplified using a primer set specific for GHR. In each case, a 100-bp ladder used as a molecular marker is indicated on the left.

 
To characterize GH mRNA expressed in those extrapituitary tissues, 5'RACE analysis was carried out using the primers indicated in Fig. 4AGo; PE5R was used in RT reactions, and PE4R or PE5R1 was used as a reverse primer in subsequent PCR reactions. Although PE4R and PE5R1 should produce about 400- and 600-bp products, respectively, from GH cDNA, those primers amplified cDNA fragments of about 200 and 400 bp, respectively, in samples from both eyes and hearts (Fig. 4BGo). Sequence analysis of the cDNAs from both tissues revealed that they were identical and consisted of two exons; the first exon extending from the middle of intron 3 to exon 4, and the second exon corresponding to exon 5 of pituitary GH mRNA (Figs. 4AGo and 5AGo). The cDNA for the newly identified GH, designated small GH isoform (s-cGH), was 569 bp in length and contained an open reading frame of 420 bp, beginning with GGCATGC, which is in agreement with the Kozak consensus sequence for translation initiation sites (38). In the 3' downstream from the coding region, there was a typical polyadenylation signal, which is actually acting in the 3'-end processing of pituitary GH mRNA (39, 40). This cDNA sequence is available from DDBJ, EMBL, and GenBank data libraries under accession number AB066586.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 4. 5'RACE analysis of GH mRNA expressed in the eye (ED17) and heart (ED6) of Rock Cornish embryos. A, Schematic representation of the location of each primer used in this study and the structure of a novel GH mRNA found to be expressed in both eyes and hearts. The solid and shaded boxes indicate exons of GH mRNA expressed in the pituitary and the eye (ED17)/heart (ED6), respectively. B, The electrophoretic pattern of PCR products amplified using PE5R1 or PE4R as a GH reverse primer. A 100-bp ladder used as a molecular marker is indicated on the left.

 


View larger version (55K):
[in this window]
[in a new window]
  		Figure 5. Structure of the novel GH isoform, s-cGH. A, Nucleotide sequence of s-cGH cDNA. The s-cGH cDNA consists of two exons. The first exon corresponds to a part of intron 3 and exon 4, and the second exon corresponds to exon 5 of the pituitary GH mRNA. The putative translation initiation site (ATG) and stop codon (TGA) are indicated by underlines, and the potential polyadenylation signal is shown by asterisks. B, Alignment of the deduced aa sequence of s-cGH with that of the chicken pituitary GH (aa positions 77–216, where the translation initiation methionine is defined as 1). The predicted secondary structures of s-cGH and 22-kDa cGH are also presented over and under, respectively, their aa sequences. H, E, and C, {alpha}-Helix, ß-sheet, and coil conformation, respectively. Four cysteine residues in each protein are boxed. Solid boxes indicate leucine residues arranged every seven aa residues in an {alpha}-helix domain, a characteristic of leucine zipper transcription factors. C, Hydropathy profile of s-cGH. The hydropathy profile of s-cGH was determined by the method of Kyte and Doolittle (59 ).

 
Figure 5BGo shows the alignment of the amino acid (aa) sequence of s-cGH with that of the corresponding region of the cGH (22-kDa cGH). The s-cGH was a protein of 16.5 kDa with 140 aa residues lacking the signal peptide and the N-terminal 71 aa residues of 22-kDa cGH, replacing them with 20 aberrant aa residues, and identical to 22-kDa cGH for the C-terminal 120-aa residue portion that contains helixes 3 and 4 of GH where biological and receptor-binding activities, respectively, are located (8). Although no homology in primary sequence was observed in the N-terminal 20 aberrant aa residues to the corresponding region of 22-kDa cGH, this region was predicted to adopt the same secondary structure (coil) as the corresponding region of 22-kDa cGH. In addition, four cysteine residues were observed at similar positions in both s-cGH and 22-kDa cGH, which are conserved in all GHs from as evolutionarily diverse species as human and shark and are responsible for the formation of two intramolecular and/or intermolecular disulfide bridges (8). These structural similarities of s-cGH with 22-kDa cGH suggest that s-cGH could bind to and activate GHRs. Interestingly, in the third helical domain of s-cGH, leucine residues were arranged every 7 aa residues, a characteristic of leucine zipper transcription factors. It should be noted that the N-terminal stretch of s-cGH was hydrophilic and was predicted not to serve as a secretory signal peptide (Fig. 5CGo), suggesting that s-cGH is a cytosolic protein.

Western blot analysis was performed under reducing conditions to determine the relative molecular masses of the ir-GH present in RPE cells. Surprisingly, as shown in Fig. 6Go, the antirat GH antiserum detected a predominant band about 80–84 kDa in size, although sequence analysis of cDNA predicted s-cGH to be a protein of 16.5 kDa. GH/GHR complexes have been purified from many mammalian species even under reducing conditions, and the molecular mass of the chicken GH/GHR complex has been reported to be 80–86 kDa (41). As the molecular mass of the s-cGH/GHR complex composed of one GHR protein and one s-cGH molecule is calculated to be 82.3 kDa, similar to that of the immunoreactive band, it might be speculated that the immunoreactive 80-/84-kDa moiety would represent the s-cGH/GHR complex, and the RPE cells would be the target cells of s-cGH.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 6. Western blot analysis of ir-GH expressed in RPE cells of ED17 Rock Cornish embryos. The autoluminogram is a representative example of Western blots. Extracts from RPE cells of ED17 embryos (15 µg) and pituitaries of 3-d-old chicks (5 µg) were subjected to SDS-PAGE in a 7.5–20% gradient gel under reducing conditions, and ir-GH bands were detected chemiluminescently using antirat GH antiserum and an ECL kit. The positions of the molecular mass markers are indicated on the left.

 
To address the possibility that the RPE cells are target cells of s-cGH, an attempt was made to isolate individual cell layers of the RPE, choroid, and neural retina from ED17 chick embryos, and RT-PCR analysis on those layers was performed to localize the expression of GHR and s-cGH mRNAs. As shown in Fig. 7Go, GHR mRNA was expressed comparably in all eye layers, but s-cGH mRNA was not detectable by RT-PCR in those layers. The results not only indicate that the RPE cells are the target cells of s-cGH, but also suggest that s-cGH could be secreted and bind to GHRs even though it lacks the signal peptide and the N-terminal 71 aa residues of 22-kDa cGH. The expression of GHR in the neural retina might suggest that the retinal production of IGF-I during embryonic development (28) is regulated by s-cGH. To identify the site of s-cGH production in the eye, RT-PCR was performed on various eye tissues isolated from ED17 chick embryos, including sclera, recten, lens, vitreous body, iris, ciliary body, and cornea; however, s-cGH mRNA was not detectable in those isolated tissues, but was detected in whole eyes (data not shown). It might be possible that cells or tissues removed during the tissue-isolating processes would express s-cGH, such as the peripheral blood cells and extraocular muscle.



View larger version (80K):
[in this window]
[in a new window]
  		Figure 7. RT-PCR analysis of the expression of GHR and s-cGH mRNAs in eye layers of Rock Cornish embryos on ED17. The PCR was carried out with three different cycling numbers using primers specific for GH (PE4F and PE5R), GHR, or GAPDH. The electrophoretic pattern of each PCR reaction using cDNA from whole eye (EYE) and individual cell layers of the neural retina (NR), RPE, and choroid (CHO) is shown. A 100-bp ladder used as a molecular marker is indicated on the left.

 
If RPE cells are the targets of s-cGH, s-cGH should be exerting some effect on them. We recently demonstrated that RPE cells in chick embryo express {alpha}MSH in a developmentally regulated pattern; the expression of {alpha}MSH is initially detected in RPE cells on ED10, the expression level increases as development proceeds and peaks on ED17, and {alpha}MSH expression in RPE cells ceases after hatching. As the melanocortin receptor subtypes, CMC1, CMC4, and CMC5, are expressed in the layers of the choroid and the neural retina, adjacent to RPE cells, we have proposed that RPE cells secrete {alpha}MSH to regulate ocular development in a paracrine fashion (42). To examine whether {alpha}MSH production in RPE cells is associated with the action of s-cGH on RPE cells, we examined the ontogenetic profile of s-cGH immunoreactivity in RPE cells by immunocytochemistry. As shown in Fig. 8Go, s-cGH immunoreactivity was localized to RPE cells with a pattern of staining similar to that of {alpha}MSH expression (42). In the embryonic stages tested (from ED7 to hatching), s-cGH immunoreactivity was initially detected in RPE cells on ED10. The staining intensity increased as embryonic development proceeded, peaked on ED17, and then gradually decreased. After hatching, RPE cells showed no immunoreactivity for s-cGH. This result suggests that s-cGH regulates {alpha}MSH production in RPE cells during chick embryogenesis.



View larger version (137K):
[in this window]
[in a new window]
  		Figure 8. Ontogenetic profile of s-cGH expression in the eye of Rock Cornish chicken. Light micrographs are representative examples of immunostaining using antirat GH antiserum preabsorbed with BSA. Developmental stages are indicated on each panel; ED9–ED20 and D1/D7 indicate ED9–20 and D1/7 after hatching, respectively. Sections were oxidized with Gomori’s oxidization mixture before immunostaining to decolorize melanin pigments in the RPE cells. Arrowheads indicate the retinal pigment epithelium. CHO and NR indicate layers of the choroid and neural retina, respectively. Scale bar, 30 µm.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present study provided evidence for the expression of a novel GH mRNA in the eye of the chick embryo on ED17. Sequence analysis of the cDNA revealed that GH mRNA was transcribed from the middle of intron 3 of the cGH gene and consisted of two exons, and it predicted a protein of 16.5 kDa with 140 aa residues lacking a signal peptide. As this novel GH isoform was smaller in molecular mass than the pituitary cGH (22 kDa), we named it s-cGH.

The gene for GH has been isolated to date from species belonging to all vertebrate taxa and is characterized as a gene encoding the precursor GH with a conventional secretory signal peptide and consisting of five exons and four introns, with the exception of those for Tilapia and Salmo species, which have six exons and five introns (43). Newly synthesized GH is considered to be a protein of 22 kDa, and GH heterogeneity existing in all vertebrate classes results from posttranslational modifications, except for that of human GH (hGH), which represents two nonallelic GH genes as well as alternatively spliced mRNA encoding 20-kDa hGH (8). Thus, the existence of GH mRNA with quite different structures has not been established as yet. This is therefore the first report demonstrating that the GH gene produces distinct GH isoforms by alternative usage of transcription initiation sites.

The s-cGH is a severely truncated GH isoform lacking over a third of its N-terminal portion and missing helix 1 of four major helixes. An analogous GH isoform lacking N-terminal helix 1 of 22-kDa GH has been reported in humans, the 17-kDa hGH. The 17-kDa hGH is generated in the pituitary by proteolytic cleavage of 22-kDa hGH and is made up of the portion of 22-kDa hGH from about aa residue 40–191, the C-terminal portion of the hormone. The apparent proteolytic cleavage that produces 17-kDa hGH is not totally specific, but the most prominent cleavage point is between aa residues 43 and 44 (44). As the 17-kDa hGH has been shown to bind to GHR or GH-binding proteins with a lower affinity than 22-kDa hGH (45), it might be speculated that the affinity and property in the complex formation with GHRs would be different between s-cGH and 22-kDa cGH, especially as it is doubtful whether s-cGH could dimerize two GHRs and induce GHR signaling.

Lewis et al. (44) recently demonstrated that antiserum directed against 17-kDa hGH produced significant labeling of a major retinal vessel in the retina of the diabetic, but not in retina of the nondiabetic, where this type of staining was not seen when a monoclonal antibody to 22-kDa hGH was used. Based on the observation together with the fact that 17-kDa hGH has potent diabetogenic activities, they proposed that 17-kDa hGH may be involved in diabetic retinopathy in humans (44). It is interesting that the GH isoforms, s-cGH and 17-kDa hGH, expected to be acting in the eye lack N-terminal helix 1. According to the results of Lewis et al. (44), GHR expressed in the major retinal vessel preferentially binds 17-kDa hGH rather than 22-kDa hGH, although 17-kDa hGH has a lower affinity for cloned GHR or GH-binding protein than 22-kDa hGH (45). It might be possible that distinct GHRs would be expressed in the eye and/or that a single GHR would be interacting with tissue-specific membrane proteins, which modulates the specificity and affinity of the receptor for GH isoforms, as splicing variants of GHR are well established, and it has been proposed that variation occurs in GHR translated from the same mRNA, due to differential posttranslational processing and/or association with other proteins (41).

In the present study RPE cells on ED17 were found to express GHR mRNA, but not s-cGH mRNA, although the cells showed GH immunoreactivity. Moreover, the GH-immunoreactive band present in RPE cells was demonstrated to be 80–84 kDa in size, equivalent to the computed molecular mass of the s-cGH/GHR complex. It is therefore possible that s-cGH is secreted to bind to GHRs and exerts effects in the eye despite the fact that s-cGH was predicted to be a cytosolic protein lacking a signal peptide. The primary translation product of secretory proteins, in general, has a hydrophobic signal peptide; however, a small number of extracellular proteins have recently been described not to contain the signal peptide, such as two prototypic members of the fibroblast growth factor (FGF) family, FGF-1 and FGF-2 (46). A mechanism for the cytosolic isoform of FGF-2 (18-kDa protein) exocytosis via an endoplasmic reticulum-Golgi-independent pathway has been described, involving the catalytic {alpha}-subunit of Na+,K+-adenosine triphosphatase (47). It is therefore possible that s-cGH could be secreted by the same or a similar mechanism in which ATP-dependent transporters are involved as in the case of FGF-2, although the site of s-cGH production remains to be determined.

The ir-GH has been detected in most tissues during early embryonic development of the chicken (25). A combination of RT-PCR and 5'RACE revealed that mRNA for s-cGH, but not for 22-kDa cGH, was expressed in the heart on ED6 where extensive expression of ir-GH has been reported (25). Similar analyses of other tissues are required; however, our results imply the possibility that s-cGH could be an embryonic GH expressed in most extrapituitary tissues in the chicken. It is unclear at present whether those extrapituitary tissues express s-cGH in adult chickens. If this is the case, then the physiological hyperglycemia observed in the chicken might reflect the widespread expression of s-cGH, as the analogous 17-kDa hGH is characterized as a potent diabetogenic substance of the pituitary gland, causing glucose intolerance and insulin resistance (44).

Although RPE cells of ED17 embryos showed cytoplasmic staining, GH and GHR immunoreactivities have been shown to often be associated with the nucleus of embryonic cells (25). It is possibly due to the nuclear translocation of the secreted s-cGH in target cells subsequent to its binding to the cell surface GHRs and internalization of the s-cGH/GHR complexes, as this mode of nuclear translocation is well established in cytokines and growth factors (48, 49). It is also possible that the nuclear staining represents the intracrine actions of s-cGH in some s-cGH-producing cells, as nuclear localization of GHRs/GH-binding activity is well established in the pituitary gland as well as in the liver (50). In each case, the nuclear s-cGH/GHR complexes might be acting as a transcription factor to regulate the expression of specific genes by binding to DNA, as s-cGH contains a leucine zipper motif in its C-terminal region, although this hypothesis remains to be proven.

In the present study immunocytochemistry revealed a temporal pattern of s-cGH expression in the eye during development in the chicken; the binding of s-cGH to RPE cells was extensive during middle to late embryonic development and ceased after hatching. As this ontogenetic pattern of s-cGH binding correlated well with that of the production of {alpha}MSH in RPE cells, it is possible that s-cGH is acting directly on RPE cells to induce {alpha}MSH synthesis during embryonic development in the chicken. Many lines of evidence have shown that the proliferation, differentiation, and apoptosis of retinal cells during ocular development are humorally regulated by growth factors generated within the eye, such as FGFs (51, 52, 53, 54, 55, 56) and IGFs (28, 57, 58), by an autocrine and/or paracrine mechanism. The ontogenetic pattern of the immunostaining in RPE cells suggests the possible involvement of s-cGH in regulating the embryonic development of chicken eye in a similar fashion. However, the exact physiological role of s-cGH during ocular development remains to be elucidated. It is unclear at present why RT-PCR failed to detect s-cGH mRNA in isolated eye tissues. Cellular localization of the expression of s-cGH by in situ hybridization is now in progress. Further analysis of the ocular s-cGH system will contribute to our understanding of how eye development is regulated by GH and provide a foundation for future attempts to develop methods of treatment for eye diseases in which GH may be the causative agent, such as the retinopathy linked to the therapeutic use of GH or to diabetes.

RPE cells make up the outermost layer of the retina, performing many supporting functions essential for the survival of photoreceptors, including retinoid processing and circadian phagocytosis of shed photoreceptor outer segments. Our previous findings (41) as well as the present results imply a novel role for RPE cells in the regulation of eye development by local communications using so-called pituitary hormones in the chicken.

In conclusion, the present study demonstrates that a novel GH isoform (s-cGH) is expressed in the chicken eye, and that its binding to RPE cells is temporally regulated and correlates well with the production of {alpha}MSH in RPE cells during embryonic development, implying a possible involvement of s-cGH in the regulation of ocular development by acting on the intraocular melanocortin system in the chicken.


   Acknowledgments
 
We thank Dr. Luc R. Berhgman of Texas A&M University for his critical reading of the manuscript.


   Footnotes
 
This work was supported in part by a Grant-in Aid for Scientific Research from Japan Society for the Promotion of Science (to S. Takeuchi; No. 12640650).

Abbreviations: aa, Amino acids; cGH, chicken GH; DW, distilled water; ED, embryonic day; CMF-HSH-BSA, Ca2+- and Mg2+-free Hanks’ solution containing 20 mM HEPES and 0.3% BSA; FGF, fibroblast growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GHR, GH receptor; hGH, human GH; ir-GH, immunoreactive GH; ir-GHR, immunoreactive GH receptor; 5'RACE, rapid amplification of cDNA 5'-ends; RPE, retinal pigment epithelial; s-cGH, small GH isoform.

Received June 20, 2001.

Accepted for publication August 23, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Scanes CG, Daughaday WH 1995 Growth hormone action: growth. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 351–369
  2. Scanes CG 1995 Growth hormone action:carbohydrate metabolism, lipid metabolism, protein metabolism. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 371–391
  3. Scanes CG, Harvey S 1995 Growth hormone action: reproductive function. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 393–405
  4. Scanes CG 1995 Growth hormone action: immune function, osmoregulation, endocrine function. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 407–427
  5. Harvey S 1995 Growth hormone action: neuroendocrine function, neural function. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 429–449
  6. Auernhammer CJ, Strasburger CJ 1995 Effects of growth hormone and insulin-like growth factor-I on the immune system. Eur J Endocrinol 133:635–645
  7. Hull KL, Harvey S 1997 Growth hormone: an immune regulator in vertebrates. In: Kawashima S, Kikuyama S, eds. Advances in comparative endocrinology. Bologna: Monduzzi Editoire; 565–572
  8. Scanes CG, Campbell RM 1995 Growth hormone action: chemistry. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 351–369
  9. Lewis UJ 1984 Variants of growth hormone and prolactin and their post-translational modifications. Annu Rev Physiol 46:33–42
  10. Lewis UJ, Singh RNP, Tutwiler GF, Sigel MB, VanderLaan EF, VanderLaan WP 1980 Human growth hormone: a complex of proteins. Recent Prog Horm Res 36:477–508
  11. Baumann G 1991 Growth hormone heterogeniety: genes, isohormones, variants, and binding proteins. Endocr Rev 12:424–447
  12. Singh RNP, Seavey BK, Rice VP, Lindsey TT, Lewis UJ 1974 Modified forms of human growth hormone with increased biological activities. Endocrinology 94:883–891
  13. Hart IC, Blake LA, Chadwick PME, Payne GA, Simmonds AD 1984 The heterogeniety of bovine growth hormone: extraction from the pituitary of components with different biological and immunological properties. Biochem J 218:573–581
  14. Aramburo C, Campbell RM, Scanes CG 1989 Heterogeniety of chicken growth hormone (cGH): identification of lipolytic and non-lipolytic variants. Life Sci 45:2201–2207
  15. Aramburo C, Montiel JL, Perera G, Navarrete S, Sanchez R 1990 Molecular isoforms of chicken growth hormone (cGH): Different bioactivities of cGH charge variants. Gen Comp Endocrinol 80:59–67
  16. Hart IC, Chadwick PME, Boone TC, Langley KE, Rudman C, Souza LM 1984 A comparison of the growth-promoting, lipolytic, diabetogenic, and immunological properties of pituitary and recombinant-DNA-derived bovine growth hormone (somatotropin). Biochem J 224:93–100
  17. Ellis S, Grindeland RE, Nuenke JM, Callahan PX 1968 Isolation and properties of rat and rabbit growth hormones. Ann NY Acad Sci 148:328–342
  18. Aramburo C, Luna M, Carranza M, Reyes M, Martinez-Coria H, Scanes CG 2000 Growth hormone size variants: changes in the pituitary during development of the chicken. Proc Soc Exp Biol Med 223:67–74
  19. Houston B, Goddard C 1988 Molecular forms of growth hormone in the chicken pituitary glands. J Endocrinol 116:35–41
  20. Berghman LR, Lens P, Decuypere E, Kuhn ER, Vandesande F 1987 Glycosylated chicken growth hormone. Gen Comp Endocrinol 68:408–414
  21. Aramburo C, Navarrete S, Montiel JL, Sanchez R, Berghman LR 1991 Purification and electrophoretic analysis of glycosylated chicken growth hormone (G-cGH): Evidence of G-cGH isoforms. Gen Comp Endocrinol 84:135–146
  22. Aramburo C, Donoghue D, Montiel JL, Berghman LR, Scanes CG 1990 Phosphorylation of chicken growth hormone. Life Sci 47:945–952
  23. Aramburo C, Montiel JL, Proudman JA, Berghman LR, Scanes CG 1992 Phosphorylation of prolactin and growth hormone. J Mol Endocrinol 8:181–191
  24. Aramburo C, Scanes CG Endogenous proteolytic cleavage of growth hormone. Proceedings of the 73rd Annual Meeting of The Endocrine Society, Washington, DC, 1991, p 232 (Abstract)
  25. Harvey S, Johnson CDM, Sanders EJ 2000 Extra-pituitary growth hormone in peripheral tissues of early chick embryos. J Endocrinol 166:489–502
  26. Serrano J, Shuldiner AR, Roberts Jr CT, LeRoith D, de Pablo F 1990 The insulin-like growth factor-I IGF-I gene is expressed in chick embryos during early organogenesis. Endocrinology 127:1547–1549
  27. Scavo LM, Serrano J, Roth J, de Pablo F 1991 Genes for the insulin receptor and the insulin-like growth factor-I receptor are expressed in the chicken embryo blastoderm and throughout organogenesis. Biochem Biophys Res Commun 176:1393–1401
  28. Calvaruso G, Vento R, Giuliano M, Lauricella M, Gerbino E, Tesoriere G 1996 Insulin-like growth factors in chick embryo retina during development. Regul Pept 61:19–25
  29. Smith LEH, Kopchick JJ, Chen W, Knapp J, Kinose F, Daley D, Foley E, Smith RG, Schaeffer JM 1997 Essential role of growth hormone in ischemia-induced retinal neovascularization. Science 276:1706–1709
  30. Hellstrom A, Svensson E, Carlsson B, Niklasson A, Albertsson-Wikland K 1999 Reduced retinal vascularization in children with growth hormone deficiency. J Clin Endocrinol Metab 84:795–798
  31. Takahashi S 1992 Growth hormone secretion in old female rats analyzed by the reverse hemolytic plaque assay. Acta Endocrinol (Copenh) 127:531–535
  32. Bollengier F, Velkeniers B, Hooghe-Peters E, Mahler A, Vanhaelst L 1988 Multiple forms of rat prolactin and growth hormone in pituitary cell subpopulations separated using a Percoll gradient system: disulphide-bridges and glycosylated variants. J Endocrinol 120:201–206
  33. Laemmli UK 1970 Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227:680–685
  34. Chomczynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159
  35. Takeuchi S, Takahashi S 1998 Melanocortin receptor genes in the chicken: tissue distributions. Gen Comp Endocrinol 112:220–231
  36. Porter TE 1997 Regulation of somatotroph differentiation during chicken embryonic development: a review. In: Harvey S, Etches RJ, eds. Perspectives in avian endocrinology. Bristol: Journal of Endocrinology; 47–56
  37. Harvey S, Davidson TF, Chadwick A 1979 Ontogeny of growth horme and prolactin secretion in the domestic fowl, Gallus domesticus. Gen Comp Endocrinol 59:270–273
  38. Kozak M 1989 The scanning model for translation: an update. J Cell Biol 108:229–241
  39. Zhvirblis GS, Gorbulev VG, Rubtsov PM, Karapetyan RV, Zhuravlev IV, Fisinin VI, Skryabin KG, Baev AA 1987 Genetic engineering of peptide hormones: Cloning and primary structure of cDNA of chicken growth hormone. Mol Biol 21:1324–1328
  40. Lamb IC, Galehouse DM, Foster DN 1988 Chicken growth hormone cDNA sequence. Nucleic Acids Res 16:9339
  41. Harvey S, Hull KL 1995 Growth hormone action: growth hormone receptors. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 303–335
  42. Teshigawara K, Takahashi S, Boswell T, Qiushi L, Tanaka S, Takeuchi S 2001 Identification of avian {alpha}-melanocyte-stimulating hormone in the eye: temporal and spatial regulation of expression in the developing chicken. J Endocrinol 168:527–537
  43. Harvey S 1995 Growth hormone synthesis. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 55–78
  44. Lewis UJ, Sinha YN, Lewis GP 2000 Structure and properties of members of the hGH family: a review. Endocr J 47(Suppl):S1–S8
  45. Rowlinson SW, Waters MJ, Lewis UJ, Barnard R 1996 Human growth hormone fragments 1–43 and 44–191: in vitro somatogenic activity and receptor binding characteristics in human and nonprimate systems. Endocrinology 137:90–95
  46. Burgess WH, Maciag T 1989 The heparin-binding (fibroblast) growth factor family of proteins. Annu Rev Biochem 58:575–606
  47. Florkiewicz RZ, Anchin J, Baird A 1998 The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+,K+-ATPase. J Biol Chem 273:544–551
  48. Rakowicz-Szulczynska EM, Rodeck U, Herlyn M, Kopzowski H 1986 Chromatin binding of epidermal growth factor, nerve growth factor, and platelet-derived growth factor in cells bearing the appropriate surface receptors. Proc Natl Acad Sci USA 83:3728–3732
  49. Curtis BM, Widmer MB, de Roos P, Qwarnstrom EE 1990 IL-1 and its receptor are translocated to the nucleus. J Immunol 144:1295–1303
  50. Harvey S, Hull KL 1995 Growth hormone action: genomic mechanisms. In: Harvey S, Scanes CG, Daughaday WH, eds. Growth hormone. Boca Raton: CRC Press; 347–350
  51. Guillemot F, Cepko CL 1992 Retinal fate and ganglion cell differentiation are potentiated by acidic FGF in an in vitro assay of early retinal development. Development 144:743–754
  52. Consigli SA, Lyser KM, Joseph-Silverstein J 1993 The temporal and spatial expression of basic fibroblast growth factor during ocular development in the chicken. Invest Ophthalmol Vis Sci 34:559–566
  53. Tcheng M, Oliver L, Courtois Y, Jeanny JC 1994 Effects of exogenous FGFs on growth, differentiation, and survival of chick neural retina cells. Exp Cell Res 212:30–35
  54. Pittack C, Grunwald GB, Reh TA 1997 Fibroblast growth factors are necessary for retina but not pigmented epithelium differentiation in chick embryos. Development 124:805–816
  55. Yokoyama Y, Ozawa S, Seyama Y, Namiki H, Hayashi Y, Kaji K, Shirama K, Shioda M, Kano K 1997 Enhancement of apoptosis in developing chick neural retina cells by basic fibroblast growth factor. J Neurochem 68:2212–2215
  56. Desire L, Head MW, Fayein NA, Courtois Y, Jeanny JC 1998 Suppression of fibroblast growth factor 2 expression by antisense oligonucleotides inhibits embryonic chick neural retina cell differentiation and survival in vivo. Dev Dyn 212:63–74
  57. de La Rosa EJ, Bondy CA, Hernandez-Sanchez C, Wu X, Zhou J, Lopez-Carranza A, Scavo LM, de Pablo F 1994 Insulin and insulin-like growth factor system components gene expression in the chicken retina from early neurogenesis until late development and their effect on neuroepithelial cells. Eur J Neurosci 6:1801–1810
  58. Hernandez-Sanchez C, Lopez-Carranza A, Alarcon C, de La Rosa EJ, de Pablo F 1995 Autocrine/paracrine role of insulin-related growth factors in neurogenesis: local expression and effects on cell proliferation and differentiation in retina. Proc Natl Acad Sci USA 92:9834–9838
  59. Kyte J, Doolittle RF 1982 A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105–132



This article has been cited by other articles:


Home page
 J EndocrinolHome page
M. A Zmijewski, R. K Sharma, and A. T Slominski
Expression of molecular equivalent of hypothalamic-pituitary-adrenal axis in adult retinal pigment epithelium
J. Endocrinol., April 1, 2007; 193(1): 157 - 169.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M.-L. Baudet, B. Martin, Z. Hassanali, E. Parker, E. J. Sanders, and S. Harvey
Expression, Translation, and Localization of a Novel, Small Growth Hormone Variant
Endocrinology, January 1, 2007; 148(1): 103 - 115.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
E. J. Sanders, M. A. Walter, E. Parker, C. Aramburo, and S. Harvey
Opticin Binds Retinal Growth Hormone in the Embryonic Vitreous
Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5404 - 5409.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M.-L. Baudet, E. J. Sanders, and S. Harvey
Retinal Growth Hormone in the Chick Embryo
Endocrinology, December 1, 2003; 144(12): 5459 - 5468.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takeuchi, S.
Right arrow Articles by Takahashi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takeuchi, S.
Right arrow Articles by Takahashi, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals