help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borges, M. O. R.
Right arrow Articles by Avellar, M. C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borges, M. O. R.
Right arrow Articles by Avellar, M. C. W.
Endocrinology Vol. 142, No. 11 4701-4710
Copyright © 2001 by The Endocrine Society

ARTICLES

Characterization of Muscarinic Acetylcholine Receptor in Rat Sertoli Cells

Marilene O. R. Borges, Maria L. C. Abreu, Catarina S. Porto and Maria Christina W. Avellar

Section of Experimental Endocrinology (M.L.C.A., C.S.P., M.C.W.A.), Department of Pharmacology, Universidade Federal de São Paulo-Escola Paulista de Medicina, São Paulo, Brazil 04044-020; and Department of Physiological Sciences (M.O.R.B.), Universidade Federal do Maranhão, Brazil 65085-580

Address all correspondence and requests for reprints to: Maria Christina W. Avellar, Section of Experimental Endocrinology, Department of Pharmacology, Universidade Federal de São Paulo-Escola Paulista de Medicina, Rua 03 de maio 100, Instituto Nacional de Farmacologia, São Paulo 04044-020, Brazil. E-mail: avellar.farm{at}infar.epm.br


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study was designed to characterize muscarinic acetylcholine receptors (mAChRs) in primary cultured Sertoli cells from 30-d-old rats. RT-PCR was performed, and five PCR products corresponding to m1-m5 mAChR mRNA subtypes were detected in these cells. Ribonuclease protection assay further confirmed the presence of protected products for m1, m2, m3, and m4 mAChR transcripts. Radioligand binding studies and the analysis of changes in intracellular signaling pathways after cell exposure to carbachol were performed to study mAChRs at the protein level. Scatchard analysis revealed one single class of [3H]quinuclidinyl benzilate binding sites. Carbachol produced a reduction on forskolin-induced intracellular cAMP accumulation in Sertoli cells. This effect was reversed by atropine, methoctramine, and tropicamide but not by p-fluoro-hexahydro-sila-difenidol or pirenzepine. Carbachol also induced an increase on total [3H]-inositol phosphates content, an effect antagonized by atropine, p-fluoro-hexahydro-sila-difenidol, or pirenzepine but not by methoctramine. Thus, mAChR activation in Sertoli cell is linked to both adenylyl cyclase inhibition and to phosphoinositide hydrolysis. Furthermore, gel shift assays indicated that carbachol also induced a time-dependent stimulation of the activator protein-1 DNA-binding activity, suggesting that activation of mAChRs may play a role in the modulation of gene expression in Sertoli cells. Taken together, these results indicate that mAChRs are present at mRNA and protein level in rat Sertoli cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IN THE LAST two decades, it has become increasingly evident that disturbances of the hypothalamic-pituitary-gonadal axis account for male infertility (1). In an attempt to clarify the pathophysiology of idiopathic male infertility and develop new methods for male contraception, researches have focused on local regulators of intratesticular events (2).

How the testis is involved in the regulation of its own dual functions of maintaining virility and fertility is still an open question. Testicular function depends on local cellular secretions and cellular interactions that are influenced by pituitary secretions of LH acting on Leydig cells and secretions of FSH acting on Sertoli cells (3, 4, 5). Several studies have shown the importance of FSH in the control of Sertoli cell function; however, the male fertility is poorly affected in the absence of FSH. Male FSHß and FSH receptor knockout mice are fertile, despite having reduced testicular size and partial spermatogenic failure (6). Inactivating point mutation in FSH receptor makes human females but not males completely infertile (7, 8). These observations suggest the existence of other transduction pathways leading to the preservation of Sertoli cell function.

Efferent neurons supplying the rat testis originate in the pelvic ganglia and sympathetic chain (9). Adrenergic and cholinergic nerve fibers innervate the capsule, vasculature, peripheral interstitium, and myoid cells of the rat testis (9, 10, 11). Regression of spermatogenesis was shown during the chronic testicular denervation in mature rats (12), suggesting a neuronal control of spermatogenesis. Leydig and Sertoli cells are affect by neurotransmitters normally released from autonomic nervous system (13, 14, 15, 16). Catecholamines stimulate cAMP production and aromatization of T to 17ß-E2 in cultured rat Sertoli cells (14, 15, 16). Such stimulatory effect is subject to controversy because other studies have suggested that these effects are observed in cultured rat and hamster Sertoli cells but not in freshly isolated cells from immature rats (17, 18). However, in situ autoradiography on the rat testis sections showed that ß-adrenoceptors are present in Sertoli cells (19). Furthermore, it has been shown that freshly isolated rat Sertoli cells express ß2-adrenoceptors functionally coupled to adenylyl cyclase and tissue-type plasminogen activator stimulation (20, 21) and that these characteristics are preserved in Sertoli cells in culture (21).

Although Risley and Skrepetos (22) believed that the testis had no cholinergic fibers, later studies revealed acetylcholinesterase-containing fibers in the testicular capsule of several species of mammals, including monkey, rat, rabbit, and ram (10). A direct involvement of the cholinergic system and testis cells was also described by Chakraborty and Nelson (23), who detected the presence of cholinesterase during spermatid differentiation and spermatozoa maturation in mice testis, including the smooth-surfaced endoplasmic reticulum of Sertoli cells. Recently, molecules immunologically related to acetylcholinesterase were detected mainly in the interstitial and peritubular compartment of the testis from rats in early stages of the development, but during maturation they were found in Sertoli cells and in differentiating germ cells (24). The observed cellular and subcellular distribution of acetylcholinesterase could readily account for a cholinergic control mechanism in Sertoli cells. In fact, carbachol, a cholinergic agonist, inhibits FSH-induced cAMP accumulation in cultured Sertoli cells from immature hamsters (25) and T secretion by purified rat Leydig cells (26). Thus, although not directly innervated by the sympathetic and parasympathetic nervous system, testicular cells are subject to regulation by neurotransmitters normally released from these systems.

Muscarinic acetylcholine receptors (mAChRs) exist in multiple subtypes, denoted as M1, M2, M3, M4, and M5, which are encoded by five distinct but related genes (m1–m5) (27, 28, 29, 30, 31). Recently, Eglen et al. (32) have reported that a gene for a putative sixth mAChR m6 has been cloned and a U.S. patent application filed by Millennium Pharmaceuticals Inc. No details are yet available on the pharmacology or potential physiological role for this receptor subtype. Many tissues express more than one mAChR subtype, which may couple to different intracellular effectors and thus have different physiological roles. M1, M3, and M5 mAChR subtypes couple primarily to phospholipase C-mediated phosphoinositide hydrolysis, but M2 and M4 mAChR subtypes couple primarily to adenylyl cyclase inhibition (see for review 29, 30, 31, 32). The aim of this work was to characterize the expression of mAChR subtypes at mRNA and protein level in rat Sertoli cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture
Primary Sertoli cell cultures were obtained from 30-d-old male Wistar rats, housed in the Animal Facility at Instituto Nacional de Farmacologia (INFAR), UNIFESP-EPM and kept on a 12-h light/12-h dark lighting schedule, at 20 C, with food and water ad libitum. The animals were euthanized using the guidelines for the care and use of laboratory animal, approved by the Research Committee from UNIFESP-Escola Paulista de Medicina. The testes were removed and decapsulated. Sertoli cells were prepared as previously described (33). Cells were plated at a density of approximately 3 x 105 cells/ml in Ham’s F12/DMEM (F-12/DME 1:1) containing 3.6 g/liter HEPES, 1.2 g/liter NaHCO3, and 0.02 g/liter gentamicin (pH 7.2–7.4) at 35 C. The cells were grown in a humidified atmosphere of 95% air/5% CO2 at 35 C. After 24 h, the medium was changed to F12/DME supplemented with 10 µg/ml insulin, 10 µg/ml transferrin, 10 ng/ml sodium selenite and 10 ng/ml epidermal growth factor and the cells were grown for another 3 d. At this stage, the cells were 90–95% confluent and the percentage of viable cells in each culture, as determined by trypan blue exclusion, was more than 90%. Over 93% of the cells were identified as Sertoli cells by morphological study. At 30 d, the Sertoli cell proliferation in rats ceases (34, 35) and the androgen-binding protein secretion in cultured Sertoli cells treated with insulin, transferrin and epidermal growth factor is 2-fold higher than that obtained in cells from 19- to 25-d-old rats (36). Thus, this culture system allows the study of nonhormonal factors that control Sertoli cell secretory activity.

RNA isolation
Sertoli cells were cultured in 100-mm dishes as described before. Total RNA was extracted from Sertoli cells and from frozen rat brain and heart, as described by Chirgwin et al. (37). Purification of poly(A)+ RNA from Sertoli cell total RNA was performed by using oligo(dT)-cellulose column as described by Ausubel et al. (38). RNA samples were then quantitated, using a spectrophotometer at 260/280 nm and stored at 70 C for later use.

RT-PCR analysis
RT-PCR was performed using SuperScript II RT kit preamplification system for first-strand cDNA synthesis (Life Technologies, Inc., Gaithersburg, MD), according to manufacturer’s instructions. Reverse transcription (RT) of Sertoli cell poly(A)+ RNA (5 µg) or total RNA from brain (5 µg), using random hexamer primers (50 ng), was performed at 50 C in a total volume of 20 µl. All primers and PCR conditions were tested using total RNA from rat brain because m1–m5 muscarinic receptor mRNA transcripts are known to be expressed in this tissue (31). Reactions in the absence of RT were also included for each RNA tested to check for genomic contamination. The resulting cDNA (2.5 µl) was amplified in a reaction volume of 25 µl containing 20 mM Tris-HCl (pH 8.3), 50 mM KCl, 3 mM MgCl2, 0.4 µM of each specific pair of primers, 0.25 mM BSA, 0.2 mM deoxyribonucleotides, and 1.25 U Taq polymerase. The samples were transferred to capillary tubes, and PCR amplification performed in an Idaho RapidCycler (Idaho Technologies, Idaho Falls, ID) as follows: one cycle of denaturation at 96 C for 10 sec, followed by 35 cycles of denaturation 94 C, 10 sec; annealing 60 C, 10 sec and extension 72 C, 45 sec. A final extension of 72 C, 3 min was performed for all samples. Aliquots of the DNA samples (15 µl) were loaded onto 1.8% agarose gels, containing ethidium bromide (0.5 µg/ml). PCR products were visualized with fluorescent illumination and photographed. The authenticity of each PCR product was confirmed by nucleotide sequencing with an ABI PRISM 377 automated sequencer (PE Applied Biosystems, Foster City, CA) and BigDye Terminator sequencing kit (PE Applied Biosystems).

Primers against m1–m5 mAChR mRNA subtypes (39, 40) and against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (41), used as an internal control, were synthesized in the Oligonucleotide Facility, University of North Carolina at Chapel Hill, and in the Department of Biophysics, UNIFESP-Escola Paulista de Medicina, Brazil. Primer sequence, corresponding base sites and the size of the PCR products ({Delta}) were as follows: m1 sense, 5'-CTG GTT TCC TTC GTT CTC TG-3' (593–612) and m1 antisense 5'-GCT GCC TTC TTC TCC TTG AC-3' (1233–1214) ({Delta} 641); m2 sense, 5'-GGC AAG CAA GAG TAG AAT AAA-3' (633–653) and m2 antisense, 5'-GCC AAC AGG ATA GCC AAG ATT-3' (1184–1164) ({Delta} 552); m3 sense, 5'-GTG GTG TGA TGA TTG GTC TG-3' (591–610) and m3 antisense, 5'-TCT GCC GAG GAG TTG GTG TC-3' (1380–1361) ({Delta} 790); m4 sense, 5'-AGT GCT TCA TCC AGT TCT TGT CCA-3' (543–566) and m4 antisense, 5'-CAC ATT CAT TGC CTG TCT GCT TTG-3' (1052–1029) ({Delta} 510); m5 sense, 5'-CTC ATC ATT GGC ATC TTC TCC A-3' (1199–1220) and m5 antisense, 5'-GGT CCT TGG TTC GCT TCT CTG T-3' (1645–1628) ({Delta} 451); and GAPDH, sense 5'-CGG GAA GCT TGT GAT CAA TGG-3' (258–277) and GAPDH antisense 5'-GGC AGT GAT GCC ATG GAC TG-3' (614–595) ({Delta} 357).

Ribonuclease protection assays
RNA labeling. Linearized muscarinic receptor constructs, containing rat cDNA inserts for m1, m3, m4, and m5 in the antisense orientation, under the transcriptional control of SP6 RNA polymerase, were used to make antisense stranded RNA probes. Plasmids were kindly provided by Dr. Tom I. Bonner (Laboratory of Cell Biology, NIH, Bethesda, MD) and are described in Bonner et al. (27, 28). A 594-bp PCR product, including a 552-bp mAChR rat m2 gene fragment in the antisense orientation under T7 RNA polymerase transcriptional control, was obtained in our laboratory. Specific m2 gene primers included a 21-bp T3 and a T7 promoter sequence at the 5' end of the sense and antisense primer, respectively, as follows: m2-T3 sense (AATTAACCCTCACTAAAGGGAGGCAAGCAAGAGTAGAATAAA) and m2-T7 antisense (TAATACGACTCACTATAGGGAGCCAACAGGATAGCCAAGAATT) (RNA polymerase promoter sequence underlined). Linearized plasmid containing a 304-bp ß-actin gene fragment in the antisense orientation under the transcriptional control of T7/SP6 promoter was obtained from Ambion, Inc. (Austin, TX). RNA probes were radiolabeled with [{alpha}-32P]UTP (specific activity 800 Ci/mmol) using MAXIScript vitro transcription kit (Ambion, Inc.). Full-length probes were purified on an 8 M urea/5% acrylamide gel before use. Sizes (nucleotides) of full-length probes and protected fragments were as follows: m1 430/377, m2 577/552, m3 720/687, m4 563/519, m5 608/494, and ß-actin 304/250, respectively. For each mAChR probe, the fraction of uridine available for radiolabeling was similar: m1, 27%; m2, 33%; m3, 27%; m4, 25%; and m5, 30%.

Hybridization. Hybridization of RNA probes to total sample RNA was performed by using an RPA III assay kit (Ambion, Inc.) according to manufacturer’s instructions. Briefly, rat Sertoli cell (30 µg), brain (10 µg), and heart (10 µg) total RNA were coprecipitated with radiolabeled probe (106 cpm). RNA from the heart was used as a positive control because m2 mAChR transcript subtype expression is more abundant in this tissue than in the brain (31). Probe excess was confirmed in experiments with increasing amounts of total RNA. Pellet was resuspended in 10 µl of hybridization solution and incubated at 65 C (m1, m3, m4, and ß-actin probes) or 42 C (m2, m5, and ß-actin probes) for 12–14 h. Unprotected labeled RNA was digested with 0.25 U/ml RNase A and 10 U/ml RNase T1 for 30 min at 37 C. Samples were precipitated, resuspended in loading buffer (95% formamide; 0.025% xylene cyanol; 0.025% bromophenol blue; 0.5 mM EDTA; 0.025% SDS), and separated by electrophoresis on a denaturing 8 M urea/6% polyacrylamide gel, followed by drying and exposure to XAR-5 film (Kodak Co., Rochester, NY) for 12–24 h at -70 C. Nucleotide sizes were determined on the gel by comparison with the 0.1- to 1.0-kb 32P-RNA century marker template set (Ambion, Inc.).

[3H]QNB binding assay
The appropriate conditions for [3H]quinuclidinyl benzilate ([3H]QNB, specific activity 43–45.4 Ci/mmol) binding assays were determined in preliminary studies. According to these results, subsequent saturation binding assays were performed in Sertoli cells (approximately 200 µg protein/well, triplicate) incubated for 2 h at 4 C with 1 ml of HBSS (pH 7.2–7.4) containing 0.1–4 nM of [3H]QNB, in the absence (total binding) and presence (nonspecific binding) of atropine (1 mM). Reactions were stopped by cooling cells to 0 C. Cells were rinsed with ice-cold PBS, solubilized with Triton X-100 (20%, vol/vol), and transferred to 5 ml Aquasol-2 scintillation liquid. Bound radioactivity was determined in a beta counter (LS 6000 IC, Beckman Coulter, Inc., Palo Alto, CA). Specific binding data were analyzed for the determination of kinetic parameters (dissociation constant, KD and maximum number of binding sites, Bmax) by using GraphPad Prism program (GraphPad Prism Software Inc., San Diego, CA).

Intracellular cAMP assays
Sertoli cells were cultured in 6-well plates; 24 h before the experiments, the medium was changed to F12/DME without supplements, and cell treatments were performed in triplicates. Cells were initially incubated for 10 min at 35 C with medium containing isobutyl-methylxanthine (10-3 M), and incubation was continued for another 5 min in the absence (basal level) and presence of increasing concentrations of forskolin (10-6 to 5 x 10-5 M). Forskolin induced a concentration-dependent increase on intracellular cAMP accumulation in rat Sertoli cells. The maximum effect was observed with the concentration of 10-5 M. Thus, subsequent experiments to test the effect of carbachol and mAChR antagonists were performed on cells stimulated with forskolin 10-5 M. Cells were treated with forskolin (10-5 M) for 5 min and then for 1 min with carbachol (10-6 to 10-3 M) in the absence and presence of one of the following mAChR antagonists: atropine, methoctramine, tropicamide, pirenzepine, and p-fluoro-hexahydro-sila-difenidol (pfHHSiD) (10-7 M). These antagonists were added 2 min prior the incubation of cells with carbachol (42). The effect of mAChR agonist and antagonist on cAMP basal level was also investigated. Reactions were stopped by cooling cells to 0 C. Cells were rinsed with ice-cold PBS, transferred to tubes by using 600 µl 3% perchloric acid and mixed in a vortex for 4 min at 4 C. After neutralization with 30% sodium bicarbonate (pH 6.5–7.5), the homogenate was centrifuged (1000 x g, 10 min, 4 C). The intracellular cAMP level was measured in the perchloric acid-soluble supernatant, using cAMP 3H assay system kit (Amersham International, Little Chalfont, Buckinghamshire, UK) according to the manufacturer’s instruction. The intracellular cAMP levels were expressed as picomole per milligram protein.

Measurement of total [3H]inositol phosphates
Sertoli cells were cultured in 100-mm dishes; 24 h before the experiment, culture medium was replaced by 199 medium with Earle’s salts containing 2.2 g/liter NaHCO3, 0.02 g/liter gentamicin, 0.29 g/liter glutamine (pH 7.2–7.4) and 5 µCi/ml of myo[3H]inositol (specific activity 47.0 Ci/mmol) and kept at 35 C as previously described (43). After labeling, cells were rinsed and kept in the medium described before for 30 min. Medium containing 10 mM LiCl was then added to cells and, after 30 min, cells were incubated in the absence (basal level) and presence of carbachol (10-6–10-3 M) for 1 min. When mAChR antagonists were used (atropine, pirenzepine, pfHHSiD, and methoctramine, 10-7M), they were added 2 min before cell incubation with carbachol. ATP (10-4M, 1 min) was used as a positive control. Reactions were stopped by cooling cells to 0 C. The medium was removed and cells were scraped with 1 ml of cold NaOH (0.1 N) and transferred to tubes containing 0.5 ml of methanol/chloroform (1:1, vol/vol) and 0.5 ml H2O. Samples were mixed in vortex and centrifuged (1000 x g, 4 min, 4C), as described by Fox et al. (44). Aqueous phase was neutralized (pH 6.5–7.5) with 0.1 N HCl and the separation of total [3H]inositol phosphates was performed as previously described by Ascoli et al. (45) with some modifications. Briefly, the aqueous layer was mixed to 1 ml anion-exchange resin (Dowex AG1-x8, formate form, 200–400 mesh) and allowed to equilibrate for 30 min at room temperature. After centrifugation (1000 x g, 5 min, 4C), the resin was washed sequentially with 2 ml of 10 mM myo-inositol and 2 ml of 5 mM sodium tetraborate/60 mM sodium formate. Thereafter, 2 ml of 0.1 M formic acid/1 M ammonium formate were mixed to resin and incubated for 30 min at room temperature. The total [3H]inositol phosphates were eluted and placed in scintillation vials containing Insta-Gel XF scintillation liquid (Packard, Meriden, CT). The amount of radioactivity was determined in scintillation beta counter. Total [3H]inositol phosphates were expressed as dpm.

EMSA
Nuclear protein extract. Sertoli cells were cultured in 100-mm dishes; 24 h before the experiment, the medium was changed to F12/DME without supplements. Cells were incubated in the absence (control) and presence of carbachol (10-4 M) or forskolin (10-5) for 0.5–8 h. Reactions were stopped by cooling cells to 0 C. The medium was removed and cells were rinsed and scraped with ice-cold PBS. After centrifugation (2,700 x g, 15 sec), cells were resuspended in 400 µl lysis buffer [10 mM HEPES, pH 7.5; 10 mM KCl; 0.1 mM EDTA; 10% glycerol; 1 mM dithiothreitol (DTT); 0.1 mM phenylmethylsulfonyl fluoride (PMSF)] and kept for 15 min on ice. After adding 25 µl of NP-40 (10%), samples were mixed for 10 sec in vortex and centrifuged (2,700 x g, 30 sec, 4 C). The resultant pellet was washed with 100 µl lysis buffer and centrifuged (2,700 x g, 30 sec, 4 C). The nuclear pellet was resuspended in 50–100 µl nuclear extract buffer (10 mM HEPES, pH 7.0; 0.5 M KCl; 1 mM EDTA; 10% glycerol; 1 mM DTT; 0.1 mM PMSF). Tubes were kept at 4 C for 15 min in a rocking plate. Samples were then centrifuged (20,000 x g, 5 min) and resultant supernatant (nuclear extract) dialyzed for 2 h (dialysis membrane 0.25 µm, Millipore Corp., Bedford, MA) against the following buffer: 10 mM HEPES (pH 7.5) containing 25 mM KCl, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, and 0.1 mM PMSF. Nuclear extract was aliquoted and stored at -70 C until use. Aliquots were removed for protein concentration determination.

Gel shift assay. Assays were performed by using the gel shift assay system (Promega Corp., Madison, WI) according to the manufacturer’s instructions. Activator protein-1 (AP-1) double-strand oligonucleotide consensus sequence was 5'-CGCTTGATGAGTCAGCCGGAA-3' (factor binding site is underlined). Radiolabeled probe [32P]AP-1 was obtained by using [{gamma}-32P]ATP (specific activity 3000 Ci/mmol) and T4 polynucleotide kinase. For DNA binding reactions, 15 µg of nuclear extract were diluted in binding buffer [10 mM HEPES, pH 7.5; 50 mM KCl; 1 mM MgCl2; 0.5 mM EDTA; 0.5 mM DTT; 0.01 µg/µl poly(dI-dC).poly(dI-dC) and 4% glycerol]. After 30-min incubation at room temperature, a 45-min incubation was performed in the presence of 20,000 cpm/reaction of [32P]AP-1. Protein-DNA complexes were resolved by electrophoresis in a 6% polyacrylamide nondenaturing gel run at 150 V for 1 h at room temperature. The gel was dried and exposed to XAR-5 film (Kodak Co.) for 24–48 h at -70 C. Autoradiograms were scanned and analyzed densitometrically. For competition studies, specific (AP-1 consensus sequence) or nonspecific (TF-IID consensus sequence) unlabeled double-stranded oligonucleotides were included in a 50-fold molar excess over the amount of radiolabeled probe. Unlabeled oligonucleotide was added to binding reaction 30 min before the addition of the radiolabeled AP-1 consensus oligonucleotide.

Protein assay
Protein concentration was determined with a protein assay (Bio-Rad Laboratories, Inc., (Richmond, CA) using BSA as standard.

Statistical analysis
Data were expressed as mean ± SEM. Statistical analysis was determined by one-way ANOVA followed by Newman-Keuls test for multiple range comparisons, or by t test to compare the differences in two groups (46). P values < 0.05 were accepted as significant.

Drugs and reagents
Ham’s F-12/DMEM (F-12/DME, 1:1) was purchased from Irvine Scientific (Santa Ana, CA). Collagenase/dispase was purchased from Roche Molecular Biochemicals (Mannheim, Germany). Myo-[1,2-3H] inositol (47.0 Ci/mmol), [3H]QNB (43,0 - 45,4 Ci/mmol), [{gamma}-32P]UTP (800 Ci/mmol), [{alpha}-32P]ATP (3000 Ci/mmol), and Aquasol II were purchased from NEN Life Science Products (Boston, MA). A cyclic AMP 3H assay system kit was purchased from Amersham International. Methoctramine (methoctramine tetrahydrochloride), tropicamide, and pfHHSiD were purchased from Research Biochemicals International (Natick, MA). Dowex AG 1-x8 (formate form, 200–400 mesh) resin was purchased from Bio-Rad Laboratories, Inc. Insta-Gel XF was purchased from Packard. SuperScript II RT kit preamplification system, oligo(dT)-cellulose resin, and Medium 199 with Earle’s salts were purchased from Life Technologies, Inc. The gel shift assay system was purchased from Promega Corp. MAXIScript in vitro transcription kit, RPA III assay Kit, and RNA Century Marker Template Plus were purchased from Ambion, Inc. Taq DNA polymerase was purchased from PerkinElmer (Norwalk, CT). All other drugs and reagents were purchased from Sigma (St. Louis, MO) or Life Technologies, Inc.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of mAChR mRNA subtypes in rat Sertoli cells
The effectiveness of m1–m5 mAChR subtype specific primers was checked by performing RT-PCR studies with total RNA from rat brain, used as positive control (Fig. 1AGo). Specific products corresponding to the five mAChR transcript subtypes were detected (Fig. 1AGo). GAPDH was used as a control for cDNA amplification. No products were detected when reverse transcriptase was omitted from RT-PCR reaction, demonstrating that amplified products are indeed from cDNA and not from genomic DNA contamination (data not shown). When RT-PCR was performed with poly (A)+ RNA from Sertoli cells, amplification of the five different mAChR subtypes was also detected (Fig. 1BGo).



View larger version (48K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR for the identification of mAChR mRNA subtypes in rat brain and Sertoli cells. RT-PCR products amplified from rat brain total RNA (A) and Sertoli cell poly(A)+ RNA (B) with specific primers for five different mAChR gene transcripts (m1–m5) were resolved on 1.8% agarose gel and visualized by ethidium bromide staining. GAPDH was used as an internal control for the cDNA production. Molecular weight (MW) is a 100-bp DNA standard ladder. The arrow indicates the MW of 600 bp. Specific amplified gene product sizes were: m1, 641; m2, 552; m3, 790;m4, 510; m5, 451 bp. Results are representative of five different experiments.

 
Total RNA isolated from rat Sertoli cells was tested in ribonuclease protection assays to detect the steady-state of mAChR mRNA subtypes. Total RNA from rat brain was used as a positive control for the expression of m1, m3, m4, and m5 mAChR transcripts, and total RNA from rat heart was used to detect m2 mAChR mRNA expression. All protected products were visualized in the expected sizes when RNA from brain and heart was used (Fig. 2AGo). When labeled cRNA probes were hybridized against total RNA from rat Sertoli cell, the presence of m1, m2, m3, and m4 mAChR-protected fragments were observed, with levels comparably lower than those observed in brain and heart (Fig. 2BGo). In contrast to RT-PCR experiments, m5 mAChR-protected gene fragment was not detected in Sertoli cells in ribonuclease protected assays. The absence of m5 transcript in Sertoli cells by this technique was not owing to RNA quality, since ßactin expression was detected (Fig. 2BGo).



View larger version (46K):
[in this window]
[in a new window]
  		Figure 2. Ribonuclease protection assay for the identification of mAChR mRNA subtypes in rat brain, heart, and Sertoli cells. A, Total RNA from rat brain was used as a positive control for the expression of m1, m3, m4, and m5 mAChR transcripts. Total RNA from rat heart was used to detect m2 mAChR expression. B, Total RNA from Sertoli cells was tested for the presence of m1–m5 mAChR mRNA expression. ß-Actin protected fragment is shown on the right. The sizes of protected fragments were: m1, 377; m2, 552; m3, 687; m4, 519; m5, 494; and ß-actin, 250. Results are representative of three to five experiments.

 
The binding of [3H]QNB to rat Sertoli cells
[3H]QNB binding to Sertoli cells was specific and saturable. Scatchard analysis of [3H]QNB-specific binding at 4 C fitted best a one-site model, suggesting the presence of a single class of high-affinity sites (Fig. 3Go). An analysis of five separate experiments, performed in triplicate, yielded a dissociation constant (KD) of 1.78 ± 0.32 nM and binding capacity (Bmax) of 221 ± 20 fmol/mg protein.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 3. The binding of [3H]QNB to rat Sertoli cells. Sertoli cells were incubated with [3H]QNB (0.1- 4 nM) in the absence (total binding, {blacktriangleup}) and presence (nonspecific binding, {blacksquare}) of atropine (1 mM) for 2 h at 4 C. The reaction was stopped and the [3H]QNB bound to Sertoli cells was measured as described in Materials and Methods. Specific binding (•) is the difference between the total and nonspecific binding. Inset, Scatchard plot of [3H]QNB-specific binding. Results are representative of five experiments performed in triplicate.

 
Effect of carbachol and mAChR antagonists on forskolin-induced intracellular cAMP accumulation
Although carbachol 10-6 M did not change forskolininduced intracellular cAMP accumulation, increasing concentrations of the cholinergic agonist (10-5, 10-4, and 10-3 M) elicited significant reductions on forskolin-induced intracellular cAMP accumulation (23%, n = 6; 34%, n = 5; and 41%, n = 9; respectively) (Fig. 4AGo).



View larger version (39K):
[in this window]
[in a new window]
  		Figure 4. Effect of carbachol and mAChRs on forskolin-induced intracellular cAMP accumulation in rat Sertoli cells. A, Sertoli cells were incubated for 5 min with forskolin (10-5 M) in the absence and presence of carbachol (10-6–10-3 M). B, Cells were incubated for 5 min with forskolin (10-5 M) and then with carbachol (10-3 M, 1 min), in the absence and presence of mAChR antagonists (10-7 M). Antagonists were added 2 min prior the incubation of cells with carbachol. The intracellular cAMP accumulation was measured as described in Materials and Methods. Each bar and vertical line represent the mean ± SEM of three to nine experiments. *, Significantly different from forskolin 10-5 M (A) or from carbachol 10-3 M (B) (P < 0.05, t test).

 
Muscarinic antagonists were tested for their ability to antagonize the effect of carbachol (10-3 M) on forskolin-induced intracellular cAMP accumulation (Fig. 4BGo). Atropine (nonselective antagonist), methoctramine (M2/M4-selective), and tropicamide (M4-selective) (10-7 M) reversed the effect of carbachol. However, pfHHSiD (M3/M1-selective) and pirenzepine (M1-selective) (10-7 M) did not change the effect induced by carbachol (Fig. 4BGo). The incubation of cells with carbachol and all mAChR antagonists tested, in the absence of forskolin, did not change the basal levels of cAMP in Sertoli cells (data not shown).

Effect of carbachol and mAChR antagonists on total [3H]inositol phosphates accumulation
ATP (10-4 M, 1 min), used as a positive control, increased Sertoli cells total [3H]inositol phosphates content to 114.2% ± 9.6 (n = 6) above basal level. Carbachol induced an increase on total [3H]inositol phosphates accumulation in Sertoli cells, reaching a maximum increase of 26.2% (n = 6) above basal level with the concentration of 10-4 M (Fig. 5AGo).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 5. Effect of carbachol and mAChR antagonists on total [3H]inositol phosphates accumulation in rat Sertoli cells. A, Sertoli cells were incubated for 1 min in the absence (basal level) and presence of carbachol (10-6 –10-3 M). B, Cells were incubated for 1 min with carbachol (10-4 M) in the absence and presence of mAChR antagonists (10-7 M). Antagonists were added 2 min prior the incubation of cells with carbachol. Total [3H]inositol phosphates accumulation was measured as described in Materials and Methods. The basal levels were 46,348 ± 4,829 dpm (n = 10). Each bar and vertical line represent the mean ± SEM of 4–0 experiments. *, Significantly different from basal level (A) or from carbachol 10-4 M (B) (P < 0.05, t test).

 
Figure 5BGo shows the effect of different muscarinic antagonists on total [3H]inositol phosphates accumulation induced by carbachol (10-4 M). Atropine (nonselective), pfHHSiD (M3/M1-selective), and pirenzepine (M1-selective) (10-7 M) significantly reduced the effect of carbachol in 52%, 78%, and 56%, respectively, but methoctramine (M2/M4-selective) did not alter the effect of carbachol on total [3H]inositol phosphates accumulation in rat Sertoli cell (Fig. 5BGo). The incubation of cells with muscarinic antagonists, in the absence of carbachol, did not change the basal levels of total [3H]inositol phosphates in rat Sertoli cells (data not shown).

Effect of carbachol on AP-1 transcription factor
The induction of AP-1-DNA binding activity, through mAChR activation by carbachol, was studied in rat Sertoli cell by EMSA. With no receptor stimulation, Sertoli cells expressed very little binding of nuclear factor AP-1 to DNA (Fig. 6AGo, lanes 2 and 10). When cells were incubated with forskolin, used as a positive control, a biphasic effect on AP-1-DNA binding activity was observed (Fig. 6AGo, lanes 3–8; Fig. 6BGo). There was an increase in AP-1-DNA complex after 30 min of incubation. After 1 h of exposure to forskolin, AP-1-DNA binding decreased, but a second peak of AP-1 binding activity was detected between 2 and 6 h of incubation (Fig. 6BGo). When cells were stimulated with carbachol, the same biphasic effect on AP-1-DNA binding activity was observed (Fig. 6AGo, lanes 13–18; Fig. 6CGo). Carbachol stimulated AP-1 binding after 30 min of incubation and, although after 1 h of stimulation the AP-1-DNA binding decreased, there was a second peak of stimulation, reaching a maximum binding after 6 h of stimulation. The specificity of AP1-DNA complex was confirmed because binding was blocked by the presence of molar excess of specific unlabeled oligonucleotide AP-1 but not by the presence of a nonspecific unlabeled oligonucleotide (Fig. 6AGo, lanes 11 and 12).



View larger version (59K):
[in this window]
[in a new window]
  		Figure 6. Effect of carbachol and forskolin on AP-1-DNA binding activity in rat Sertoli cells. Sertoli cells were incubated in the absence (lanes 2 and 10) and presence of forskolin 10-5 M (lanes 3–8), used as positive control, or carbachol 10-4 M (lanes 13–18) for 0.5–8 h. Nuclear extracts were incubated with 32P-labeled oligonucleotide encompassing AP-1 consensus motif and analyzed by EMSA, as described in Materials and Methods. A, Representative autoradiogram. Lanes 1 and 9 represent free AP-1-labeled oligonucleotide probe. Lanes 2 and 10 represent basal AP-1-binding activity of nuclear extracts from nonstimulated cells (control). Specificity of 32P-DNA/protein interaction was tested by incubation of extracts and labeled probe with a 50-fold molar excess of specific (unlabeled AP-1 consensus sequence, lane 11) and nonspecific competitor (unlabeled TF-IID consensus sequence, lane 12). The arrow indicates specific protein/AP-1 binding site complexes. B and C, Densitometric analysis of the AP-1-DNA binding activity induced by forskolin and carbachol. Data are expressed as percent of AP-1-DNA binding activity of nuclear extracts from nonstimulated cells (control). Each bar and vertical line represent the mean ± SEM of three experiments. Different letters indicate statistical significance (P < 0.05, Newman-Keuls test).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
mAChRs are known to regulate numerous fundamental physiological processes, including the muscarinic actions of acetylcholine on peripheral effector tissues and central sensory, vegetative, and motor functions (47, 48). In the male reproductive tract, the activation of mAChRs induces vasoactivity within the testes (49), sperm transport through the excurrent duct system (50), muscle contraction, secretion (51, 52, 53), and cell proliferation (54) within the sex accessory glands. Studies with subtype-selective antibodies, in situ mRNA hybridization experiments, and RT-PCR have shown that m1–m5 mAChR subtypes are widely expressed throughout the central nervous system and peripheral tissues and that the expression of each subtype is tissue and specie dependent (29, 30, 55, 56, 57). The present work shows evidence for the presence of mAChRs, at mRNA and protein level, in rat Sertoli cells, suggesting that the cholinergic neurotransmitter may play a role in the autocrine and/or paracrine regulation of testicular cells.

Molecular studies indicated that multiple mAChR mRNA subtypes are present in rat Sertoli cells. All five different mAChR subtypes were detected in Sertoli cells by RT-PCR. Ribonuclease protection assays further confirmed that m1-m4 transcripts are, in fact, expressed in Sertoli cells and that the relative distribution of these transcripts in Sertoli cells was less abundant when compared with the positive control rat brain and heart. Consideration should be given to the fact that m5 transcript was detected by RT-PCR but not by RPA studies. Similar result discrepancies have been reported in the literature in other systems, and could be related to the higher sensitivity of RT-PCR for transcript detection (58, 59, 60). Because molecular techniques indicated that different mAChR subtypes are present in rat Sertoli cells, radioligand binding and functional intracellular signaling studies were performed to confirm whether mAChRs were present at the protein level in Sertoli cell. Because the characterization of the M5 receptor is still incomplete and taking into consideration the lack of selective antagonists for this mAChR subtype (30, 56, 57), we have not further explored the possible expression of this transcript on Sertoli cell.

[3H]QNB saturation binding studies indicated the presence of one class of high-affinity sites for QNB in Sertoli cells, with affinity comparable to other tissues (KD = 0.02 to 5 nM) that express mAChRs such as epididymis (61), prostate (62, 63, 64), vas deferens (63), bladder (65, 66), and corpus cavernosum (67). In our laboratory, experiments performed on membrane preparation of freshly isolated Sertoli cells incubated with [3H]QNB showed that the binding in these cells was specific and ligand concentration-dependent (data not shown), indicating that mAChRs are present in fresh and cultured rat Sertoli cells. Furthermore, Palmero et al. (24) has recently shown that a nonselective antibody against mAChRs localized mAChR-like molecules in Sertoli cells during rat development. Taken together, these results give support to the idea that mAChRs may have, in fact, a physiological role in Sertoli cells.

The multiplicity of signals affecting the Sertoli cells suggests that multiple second messengers are used to modulate the function of these cells. It is well known that FSH acts via adenylyl cyclase activation and that the subsequent rise in cAMP levels leads to the activation of cAMP-dependent protein kinases and in turn phosphorylate-specific protein substrates (4). Furthermore, FSH via formation of cAMP exerts inhibitory effects on the phosphoinositide turnover of immature rat Sertoli cells in culture (68). Sertoli cells, like other cell types, are also regulated by agonists having the ability to block FSH and glucagon-stimulated cAMP formation, such as adenosine (69, 70) and acetylcholine (25). In the present study, carbachol induced a concentration dependent decrease on intracellular cAMP accumulation in rat Sertoli cells, an effect reversed with M2/M4-selective mAChR antagonists such as methoctramine and tropicamide but not with M1/M3-selective mAChR antagonists such as pfHHSiD and pirenzepine. It is important to emphasize that the concentration of methoctramine and tropicamide used (10-7M) is in agreement with pKi values described for these antagonists in M2 and M4 mAChR subtypes (71, 72). Thus, these results suggested that M2/M4 mAChRs, linked to inhibition of intracellular cAMP accumulation, are present in rat Sertoli cells.

Quirk and Reichert (43) showed that, using AlF4- as a stimulus, immature rat Sertoli cells contain pertussis toxin-sensitive, G protein-modulated phospholipase C activity. Monaco et al. (68) observed that an unidentified component of FBS provokes inositol phosphate accumulation in these cells. Furthermore, endothelin and ATP induced inositol phosphate accumulation in prepubertal rat Sertoli cells (73). In the present study, besides the effect on cAMP, the stimulation of mAChRs with carbachol also induced an increase on total inositol phosphate content in rat Sertoli cells. Because this effect was antagonized by muscarinic antagonists such as pfHHSiD (M3/M1-selective) and pirenzepine (M1-selective) but not by methoctramine (M2/M4-selective), the results suggested that M3 and/or M1 mAChR subtypes are also present in rat Sertoli cell. Thus, mAChR activation in Sertoli cell is linked to both adenylyl cyclase inhibition (via M2 and/or M4 mAChR) and to phosphoinositide hydrolysis (via M1 and/or M3 mAChR).

The literature reports that mAChRs coupled to phospholipase C and phosphoinositide hydrolysis can mediate the induction of early genes as c-fos and AP-1 transcription factor complex in the rat brain and cerebellar cells (74, 75, 76). It is also known that cAMP targets the cAMP response element for induction of c-fos transcription in rat Sertoli cells (77, 78, 79). Thus, the involvement of AP-1 transcription factor during stimulation of Sertoli cells with cholinergic agonist was tested in the present study. Our results showed that carbachol was able to induce a biphasic increase in AP-1-DNA binding activity. The same biphasic induction of AP-1-DNA binding activity has been described in endothelial cells exposed to shear stress (80) and in HeLa cells exposed to hypoxia (81). Atropine (10-7 M), a nonselective mAChR antagonist, blocked the increase in AP1-DNA binding activity induced by carbachol (data not shown). Further experiments with subtype selective antagonists will be necessary to elucidate which mAChR is in fact involved in the carbachol induced increase of AP-1-DNA binding activity in Sertoli cells. Because regulation of AP-1-DNA binding activity by different mechanisms is likely to play a central role in the control of complex biological processes like cell proliferation and differentiation (79, 82, 83, 84), the results suggest that carbachol stimulation trigger different intracellular signaling pathways, which in turn modulate gene expression on Sertoli cells.

Heterogeneity of mAChR subtypes is described in the literature in different species and tissues in the male reproductive tract by different pharmacological approaches. M2 and M3 mAChR subtypes functionally involved with smooth muscle contraction were shown by molecular and functional studies in the bladder (47, 72). In human and rat prostate, there is a predominant population of M1 mAChR subtype present in the glandular epithelium involved in cell proliferation (47, 54) and a predominant population of M3 mAChRs mediating smooth muscle contraction in the rat ventral prostate (51). Functional studies demonstrated that postsynaptic M3 and presynaptic M1 mAChRs are present in rat vas deferens, and radioligand binding studies suggested a predominant population of M2 mAChRs in rat vas deferens and epididymis (61, 85, 86). Although evidence for a direct innervation of Sertoli cells is still lacking, neuronal regulation of Sertoli cell functions has been implicated by findings demonstrating modulation of Sertoli cell functions by neurotransmitters and related molecules (14, 15, 16, 87, 88, 89). The presence of nerve-related proteins such as phosphoneuroprotein (90) and nerve growth factor (91) yields further support for neural regulation of Sertoli cell functions. Taken together, the results of the present study suggest that carbachol stimulation of Sertoli cells triggers different intracellular signaling pathways involving different mAChR subtypes. Considering the fact that different cells are present in rat testes, further immunological studies with selective antibodies against each mAChR subtype will be an important tool to localize and determine the relative importance of mAChRs in rat testes.

In conclusion, the present results provide evidence for the presence of functional mAChR subtypes linked to different intracellular signaling pathways in rat Sertoli cells. The physiological implications of endogenous acetylcholine stimulation of these receptors remain to be clarified.


   Acknowledgments
 
We thank Espedita M. Jesus dos Santos and Maria Damiana Silva for technical assistance.


   Footnotes
 
This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP (Grant 96/1777-1), Brazil and T. W. Fogarty International (Grant 5R37HD04466-26, subcontract UNC-5-53284). Doctoral fellowship supported by Coordenação de Aperfeiçoamento Pessoal de Nível Superior, CAPES-PICDT, Brazil (M.O.R.B.). Research fellowship supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico, CNPq, Brazil (C.S.P., M.C.W.A.).

Abbreviations: AP-1, Activator protein-1; DTT, dithiothreitol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; [3H]QNB, [3H]quinuclidinyl benzilate; mAChR, muscarinic acetylcholine receptors; pfHHSiD, p-fluoro-hexahydro-sila-difenidol; PMSF, phenylmethylsulfonyl fluoride; RT, reverse transcription.

Received April 2, 2001.

Accepted for publication July 10, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Achermann JC, Jameson JL 1999 Fertility and infertility: genetic contributions from the hypothalamic-pituitary-gonadal axis. Mol Endocrinol 13:812–818[Free Full Text]
  2. Spiteri-Grech J, Nieschlag E 1993 Paracrine factors relevant to the regulation of spermatogenesis—a review. J Reprod Fertil 98:1–14[Abstract/Free Full Text]
  3. Skinner MK 1991 Cell-cell interactions in the testis. Endocr Rev 12:45–77[CrossRef][Medline]
  4. Griswold MD 1993 Actions of FSH on mammalian Sertoli cells. In: Russel LD, Griswold MD, eds. The Sertoli cell. Clearwater: Cache River Press; 493–508
  5. Bardin CW, Cheng CY, Musto NA, Gunsalus GL 1994 The Sertoli cell. In: Knobil E, Neill JD, Greewald GS, Markert CL, Pfaff DW, eds. The physiology of reproduction. 2nd ed. New York: Raven Press; 1291–1333
  6. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204[CrossRef][Medline]
  7. Aittomäki K, Lucena JL, Pakarinen P, et al. 1995 Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 82:959–968[CrossRef][Medline]
  8. Tapanainen JS, Aittomäki K, Min J, Vaskivuo T, Huhtaniemi IT 1997 Men homozygous for an inactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable suppression of spermatogenesis and fertility. Nat Genet 15:205–206[CrossRef][Medline]
  9. Rauchenwald M, Steers WD, Desjardins C 1995 Efferent innervation of the rat testis. Biol Reprod 52:1136–1143[Abstract]
  10. Langford GA, Silver A 1974 Proceedings: histochemical localization of acetylcholinesterase-containing nerve fibers in the testis. J Physiol 242:9P–10P
  11. Miyake K, Yamamoto M, Mitsuya H 1986 Pharmacological and histological evidence for adrenergic innervation of the myoid cells in the rat seminiferous tubule. Tohoku J Exp Med 149:79–87[Medline]
  12. Chow S-H, Giglio W, Anesetti R, Ottenweller JE, Pogach LM, Huang HFS 2000 The effects of testicular denervation on spermatogenesis in the Sprague-Dawley rat. Neuroendocrinology 72:37–45[CrossRef][Medline]
  13. Anakwe OO, Moger WH 1986 Catecholamine stimulation of androgen production by rat Leydig cells. Interactions with luteinizing hormone and luteinizing hormone-releasing hormone. Biol Reprod 35:806–814[Abstract]
  14. Verhoeven G 1979 Effects of neurotransmitters and follicle stimulating hormone on the aromatization of androgens and the production of adenosine 3', 5'-monophosphate by cultured testicular cells. J Steroid Biochem 12:315–322
  15. Eikvar L, Bjornerheim R, Attramadal H, Hansson V 1993 ß-Adrenoceptor mediated responses and subtypes of ß-adrenoceptors in cultured rat Sertoli cells. J Steroid Biochem Mol Biol 44: 85–91
  16. Attramadal H, Le Gac F, Jahnsen T, Hansson V 1984 ß-Adrenergic regulation of Sertoli cell adenylyl cyclase: desensitization by homologous hormone. Mol Cell Endocrinol 34:1–6[CrossRef][Medline]
  17. Kierszenbaum AL, Spruill WA, White MG, Tres LL, Perkins JP 1985 Rat Sertoli cells acquire a ß-adrenergic response during primary culture. Proc Natl Acad Sci USA 82:2049–2053[Abstract/Free Full Text]
  18. Skinner TJ, Heindel JJ 1990 Identification and characterization of a ß-adrenergic receptor in hamster Sertoli cells. J Androl 11:293–300[Abstract/Free Full Text]
  19. Tolszczuk M, Follea N, Pelletier G 1988 Characterization and localization of ß-adrenergic receptors in control and cryptorchidized rat testis by in vitro autoradiography. J Androl 9:172–177[Abstract/Free Full Text]
  20. Laurent-Cadoret V, Guillou F, Combarnous Y 1993 Involvement of cyclic adenosine monophosphate-dependent protein kinase isozymes in tissue plasminogen activator secretion by rat Sertoli cells stimulated with follicle stimulating hormone in vitro. Acta Endocrinol (Copenh) 128:555–562[Medline]
  21. Troispoux C, Reiter E, Combarnous Y, Guillou F 1998 ß2 adrenergic receptors mediate cAMP, tissue-type plasminogen activator and transferrin production in rat Sertoli cells. Mol Cell Endocrinol 142:75–86[CrossRef][Medline]
  22. Risley PL, Skrepetos CN 1964 Histochemical distribution of cholinesterases in the testis, epididymis and vas deferens of the rat. Anat Rec 148:231–249
  23. Chakraborty J, Nelson L 1974 Cholinesterase distribution during spermatid differentiation and spermatozoal maturation in the white mouse. J Reprod Fertil 38:359–367[Abstract/Free Full Text]
  24. Palmero S, Bardi G, Coniglio L, Falugi C 1999 Presence and localization of molecules related to the cholinergic system in developing rat testis. Eur J Histochem 43:277–283[Medline]
  25. Davenport CW, Heindel JJ 1987 Cholinergic inhibition of cAMP accumulation in Sertoli cells cultured from immature hamsters. J Androl 8: 307–313
  26. Favaretto ALV, Valença MM, Picanço-Diniz DLW, Antunes-Rodrigues J 1993 Inhibitory role of cholinergic agonists on testosterone secretion by purified rat Leydig cells. Arch Int Physiol Biochim Biophys 101:333–335[Medline]
  27. Bonner TI, Buckley NJ, Young AC, Brann MR 1987 Identification of a family of muscarinic acetylcholine receptor genes. Science 237:527–532[Abstract/Free Full Text]
  28. Bonner TI, Young AC, Brann MR, Buckley NJ 1988 Cloning and expression of the human and rat m5 muscarinic acetylcholine receptor genes. Neuron 1:403–410[CrossRef][Medline]
  29. Ashkenazi A, Peralta EG 1994 Muscarinic acetylcholine receptors. In: Peroutka SJ, ed. Handbook of receptors and channels. G protein coupled receptors. New York: CRC Press; 1–27
  30. Caulfield MP, Birdsall NJM 1998 International Union of Pharmacology. XVII. Classification of muscarinic acetylcholine receptors. Pharmacol Rev 50:279–290[Abstract/Free Full Text]
  31. Birdsall NJM, Buckley NJ, Caulfield MP, et al. 1998 Muscarinic acetylcholine receptor. In: The IUPHAR compendium of receptor characterization and classification. London: IUPHAR Media; 36–45
  32. Eglen RM, Choppin A, Dillon MP, Hegde S 1999 Muscarinic receptor ligands and their therapeutic potential. Curr Opin Chem Biol 3:426–432[CrossRef][Medline]
  33. Mather JP, Phillips DM 1984 Primary culture of testicular somatic cells. In: Methods for serum-free culture of cells of the endocrine system. New York: Alan R. Liss Inc.; 29–45
  34. Steinberger A, Steinberg E 1971 Replication pattern of Sertoli cells in maturing rat testis in vivo and in organ culture. Biol Reprod 4:84–87[Abstract]
  35. Orth JM 1982 Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative autoradiographic study. Anat Rec 203:485–492[CrossRef][Medline]
  36. Rich KA, Bardin CW, Gunsalus GL, Mather JP 1983 Age-dependent pattern of androgen-binding protein secretion from rat Sertoli cells in primary culture. Endocrinology 113:2284–2293[Abstract]
  37. Chirgwin JM, Przybyla AE, Macdonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299[CrossRef][Medline]
  38. Ausubel FM, Brent R, Kingston RE, et al. 1994 Current protocols in molecular biology. New York: Wiley & Sons
  39. Drescher DG, Upadhyay S, Wilcox E, Fex J 1992 Analysis of muscarinic receptor subtypes in the mouse cochlea by means of the polymerase chain reaction. J Neurochem 59:765–767[CrossRef][Medline]
  40. Sharma VK, Colecraft HM, Wang DX, Levey AL, Grigorenko EV, Yeh HH, Sheu SS 1996 Molecular and functional identification of m1 muscarinic acetylcholine receptors in rat ventricular myocytes. Circ Res 79:86–93[Abstract/Free Full Text]
  41. Scofield MA, Liu F, Abel PW, Jeffries WB 1995 Quantification of steady state expression of mRNA for ß-1 adrenergic receptor subtypes using reverse transcription and a competitive polymerase chain reaction. J Pharmacol Exp Ther 275:1035–1042[Abstract/Free Full Text]
  42. Abdalla FMF, Abreu LC, Porto CS 2000 Effect of estrogen on intracellular signaling pathways linked to activation of M2- and M3- muscarinic acetylcholine receptors in rat myometrium. Mol Cell Endocrinol 160:17–24[CrossRef][Medline]
  43. Quirk SM, Reichert LE 1988 Regulation of the phosphoinositide pathway in cultured Sertoli cells form immature rats: effects of follicle-stimulating hormone and fluoride. Endocrinology 123:230–237[Abstract]
  44. Fox AW, Abel PW, Minneman KP 1985 Activation of ß1-adrenoceptors increases [3H]inositol metabolism in rat vas deferens and caudal artery. Eur J Pharmacol 116:145–152[CrossRef][Medline]
  45. Ascoli M, Pignataro OP, Segaloff DL 1989 The inositol phosphate/diacylglycerol pathway in M.A.-10 Leydig tumor cells. J Biol Chem 262:6674–6681
  46. Snedecor GW, Cochran GC 1980 Statistical methods. 7th ed. Ames, IA: Iowa State University Press; 89–233
  47. Eglen RM, Hegde SS, Watson N 1996 Muscarinic receptor subtypes and smooth muscle function. Pharmacol Rev 48:531–565[Medline]
  48. Levine RR, Birdsall NJM 1989 Subtypes of muscarinic receptors. Proceedings of the 4th international symposium on subtypes of muscarinic receptors. Trends Pharmacol Sci 10(Suppl 7):S1–S119
  49. Kumazawa T, Mizumura K, Sato J 1987 Response properties of polymodal receptors studied using in vitro testis superior spermatic nerve preparations of dogs. J Neurophysiol 57:702–711[Abstract/Free Full Text]
  50. Hodson N 1965 Sympathetic nerves and reproductive organs in the male rabbit. J Reprod Fertil 10: 209–220
  51. Lau WAK, Pennefather JN 1998 Muscarinic receptor subtypes in the rat prostate gland. Eur J Pharmacol 343:151–156[CrossRef][Medline]
  52. Lau WAK, Pennefather JN, Mitchelson FJ 2000 Cholinergic facilitation of neurotransmission to the smooth muscle of the guinea-pig prostate gland. Br J Pharmacol 130:1013–1020[CrossRef][Medline]
  53. Wang JM, Mackenna KE, Lee C 1991 Determination of prostatic secretion in rats: effect of neurotransmitters and testosterone. Prostate 18:289–301[Medline]
  54. Luthin GR, Wang P, Zhou H, Dhanasekaran D, Ruggieri MR 1997 Role of m1 receptor G-protein coupling in cell proliferation in the prostate. Life Sci 60:963–968[CrossRef][Medline]
  55. Levey AI 1993 Immunological localization of m1–m5 muscarinic acetylcholine receptors in peripheral tissues and brain. Life Sci 52:441–448[CrossRef][Medline]
  56. Reever CM, Ferrari-Dileo G, Flynn DD 1997 The M5/m5 receptor subtype: fact or fiction? Life Sci 60:1105–1112[CrossRef][Medline]
  57. Kohn EC, Alessandro R, Probst J, Jacobs W, Brilley E, Felder CC 1996 Identification and molecular characterization of a m5 muscarinic receptor in A2058 human melanoma cells: coupling to inhibition of adenylyl cyclase and stimulation of phospholipase A2. J Biol Chem 271:17476–17484[Abstract/Free Full Text]
  58. Dausse JP, Leriche A, Yablonski F 1998 Patterns of messenger RNA expression for ß1-adrenoceptor subtypes in human corpus cavernosum. J Urol 160:597–600[CrossRef][Medline]
  59. Traish AM, Gupta S, Toselli P, Tejada IS, Goldstein I, Moreland RB 1995 Identification of {alpha}1-adrenergic receptor subtypes in human corpus cavernosum tissue and in cultured trabecular smooth muscle cells. Receptor 5:145–157[Medline]
  60. Gallo MP, Alloatti G, Eva C, Oberto A, Levi RC 1993 M1 muscarinic receptors increase calcium current and phosphoinositide turnover in guinea-pig ventricular cardiocytes. J Physiol 471:41–60[Abstract/Free Full Text]
  61. Maróstica E, Avellar MCW, Porto CS 1998 Characterization of muscarinic receptors in the rat epididymis. Naunyn Schmiedebergs Arch Pharmacol 358:R88 (Abstract)
  62. Lepor H, Kuhar MJ 1984 Characterization and localization of the muscarinic cholinergic receptor in human prostatic tissue. J Urol 132:397–402[Medline]
  63. Lepor H, Kuhar MJ 1984 Characterization of muscarinic cholinergic receptor binding in the vas deferens, bladder, prostate and penis of the rabbit. J Urol 132:392–396[Medline]
  64. Yazawa H, Saita Y, Iida E, Honma Y, Morita T, Honda K 1994 Characterization of muscarinic cholinoceptor in primary culture of smooth muscle cells form human prostate. J Urol 152:2173–2177[Medline]
  65. Levin RM, Staskin DR, Wein AJ 1982 The muscarinic cholinergic binding of the human urinary bladder. Neurourol Urodyn 1:221–225
  66. Batra S, Björklund A, Hedlund H, Andersson KE 1987 Identification and characterization of muscarinic cholinergic receptors in the human urinary bladder and parotid gland. J Auton Nerv Syst 20:129–135[CrossRef][Medline]
  67. Traish AM, Carson MP, Kim N, Goldstein I, Tejada IS 1990 Characterization of muscarinic acetylcholine receptors in human penile corpus cavernosum: studies on whole tissue and cultured endothelium. J Urol 144:1036–1040[Medline]
  68. Monaco L, Adamo S, Conti M 1988 Follicle stimulating hormone modulation of phosphoinositide turnover in the immature rat Sertoli cell in culture. Endocrinology 123:2032–2039[Abstract]
  69. Monaco L, Toscano MV, Conti M 1984 Purine modulation for the hormonal response of the rat Sertoli cell in culture. Endocrinology 115:1616–1628[Abstract]
  70. Eikvar L, Levy FO, Jutte NHPM, Cervenka J, Yoganathan T, Hansson V 1985 Effects of adenosine analogs on glucagon-stimulated adenosine 3',5' monophosphate formation in Sertoli cell cultures from immature rats. Endocrinology 117:488–491[Abstract]
  71. Dong GZ, Kameyama K, Rinken A, Haga T 1995 Ligand binding properties of muscarinic acetylcholine receptor subtypes (m1–m5) expressed in baculovirus-infected insect cells. J Pharmacol Exp Ther 274:378–384[Abstract/Free Full Text]
  72. Hedge SS, Choppin A, Bonhaus D, et al. 1997 Functional role of M2 and M3 muscarinic receptors in the urinary bladder of rats in vitro and in vivo. Br J Pharmacol 120:1409–1418[CrossRef][Medline]
  73. Rudge SA, Hughes PJ, Brown GR, Michell RH, Kirk CJ 1995 Inositol lipid-mediated signalling in response to endothelin and ATP in the mammalian testis. Mol Cell Biochem 149/150:161–174
  74. Hughes P, Dragunow M 1993 Muscarinic receptor-mediated induction of Fos protein in rat brain. Neurosci Lett 150:122–126[CrossRef][Medline]
  75. Li X, Song L, Jope RS 1996 Cholinergic stimulation of AP-1 and NF{kappa}B transcription factors is differentially sensitive to oxidative stress in SH-SY5Y neuroblastoma: relationship to phosphoinositide hydrolysis. J Neurosci 16:5914–5922[Abstract/Free Full Text]
  76. Chae HD, Suh BC, Joh TH, Kim KT 1996 AP1-mediated transcriptional enhancement of the rat tyrosine hydroxilase gene by muscarinic stimulation. J Neurochem 66:1264–1272[Medline]
  77. Jia MC, Ravindranath N, Papadopoulos V, Dym M 1996 Regulation of c-fos mRNA expression in Sertoli cells by cyclic AMP, calcium, and protein kinase C mediated pathways. Mol Cell Biochem 156:43–49[CrossRef][Medline]
  78. Hall SH, Joseph DR, French FS, Conti M 1988 Follicle-stimulating hormone induces transient expression of the protooncogene c-fos in primary Sertoli cell cultures. Mol Endocrinol 2:55–61[CrossRef][Medline]
  79. Hamil KG, Conti M, Shimasaki S, Hall SH 1994 Follicle-stimulating hormone regulation of AP-1: inhibition of c-jun and stimulation of jun-B gene transcription in the rat Sertoli cell. Mol Cell Endocrinol 99:269–277[CrossRef][Medline]
  80. Lan Q, Mercurius KO, Davies PF 1994 Stimulation of transcription factors NF{kappa}B and AP1 in endothelial cells subjected to shear stress. Biochem Biophys Res Commun 201:950–956[CrossRef][Medline]
  81. Rupec RA, Baeuerle PA 1995 The genomic response of tumor cells to hypoxia and reoxygenation. Differential activation of transcription factors AP-1 and NF-{kappa}B. Eur J Biochem 234:632–640[Medline]
  82. Chaudhary J, Whaley PD, Cupp A, Skinner MK 1996 Transcriptional regulation of Sertoli cell differentiation by follicle-stimulating hormone at the level of the c-fos and transferrin promoters. Biol Reprod 54:692–699[Abstract]
  83. Whaley PD, Chaudhary J, Cupp A, Skinner MK 1995 Role of specific response elements of the c-fos promoter and involvement of intermediate transcription factor(s) in the induction of Sertoli cell differentiation (transferrin promoter activation) by the testicular paracrine factor PModS. Endocrinology 136:3046–3053[Abstract]
  84. Jenab S, Morris PL 1998 Testicular leukemia inhibitory factor (LIF) and LIF receptor mediate phosphorylation of signal transducers and activators of transcription (STAT)-3 and STAT-1 and induce c-fos transcription and activator protein-1 activation in rat Sertoli but not germ cells. Endocrinology 139:1883–1890[Abstract/Free Full Text]
  85. Miranda HF, Duran E, Bustamante D, Paeile C, Pinardi G 1994 Pre and postjunctional muscarinic receptor subtypes in the vas deferens of rat. Gen Pharmacol 25:1643–1647[Medline]
  86. Kamai T, Fukumoto Y, Gousse A, Yoshida M, Davenport TA, Weiss RM, Latifpour J 1994 Diabetes-induced alterations in the properties of muscarinic cholinergic receptors in rat vas deferens. J Urol 152:1017–1021[Medline]
  87. Orth JM 1986 FSH-stimulated Sertoli cell proliferation in the developing rat is modified by ß-endorphin produced in the testis. Endocrinology 119:1876–1878[Abstract]
  88. Morris PL, Vale WW, Bardin CW 1987 ß-Endorphin regulation of FSH-stimulated inhibin production is a component of a short loop system in testis. Biochem Biophys Res Commun 148:1513–1519[CrossRef][Medline]
  89. Fabbri A, Knox G, Buczko E, Dufau ML 1988 Be