Endocrinology Vol. 142, No. 11 4617-4622
Copyright © 2001 by The Endocrine Society
Biosynthesis of the Neurosteroid 3
-Hydroxy-4-pregnen-20-one (3
HP), a Specific Inhibitor of FSH Release
Lisa D. Griffin and
Synthia H. Mellon
Departments of Neurology (L.D.G.) and Obstetrics and Gynecology
(S.H.M.), and Center for Reproductive Endocrinology (S.H.M.),
University of California, San Francisco, California 94143
Address all correspondence and requests for reprints to: Synthia H. Mellon, Ph.D., Box 0556, University of California, San Francisco, California 94143-0556. E-mail: mellon{at}cgl.ucsf.edu
 |
Abstract
|
|---|
The gonadal steroid 3
-hydroxy-4-pregnen-20-one (3
HP) is a
neuroactive steroid with anxiolytic and analgesic actions. In addition,
3
HP has been shown to inhibit GnRH activity on gonadotropes and
selectively suppress FSH release from pituitary cells, without an
effect on LH. The enzyme 3
-hydroxysteroid dehydrogenase (3
HSD)
has been presumed to be the enzyme responsible for the conversion of
progesterone to 3
HP, but this has never been confirmed in
vitro or in vivo. We have now determined the
mechanism of 3
HP synthesis in vivo using specific
enzyme inhibitors and in vitro using recombinant
proteins. Incubation of [3H]progesterone with
purified recombinant rat and human 3
HSD isoforms showed that
both the rat 3
HSD and the human type 2brain 3
HSD
converted progesterone to 3
HP. Age-dependent 3
HP production was
demonstrated in pituitary and cortex. Incubation of both tissues with
indomethacin, a known 3
HSD inhibitor, decreased the conversion of
progesterone to 3
HP by at least 70%, indicating that 3
HSD was
responsible for this conversion. As human type 2 3
HSD is expressed
in a region-specific fashion in the brain, 3
HP may only be made in
specific regions of the brain. Furthermore, the data suggest that the
pituitary has the capacity for 3
HP production, which may provide an
additional mechanism for regulation of GnRH action.
 |
Introduction
|
|---|
THE GONADAL STEROID
3
-hydroxy-4-pregnen-20-one (3
HP), first identified in Sertoli
cells of the rat testes (1), has been subsequently
identified in many other tissues, including rodent pituitary and ovary
(2, 3, 4). Initially, 3
HP was shown to reduce FSH
secretion and possibly its synthesis in vitro at very low
concentrations (10-10 M).
This is in contrast to the stimulatory effects of other neuroactive
steroids, such as 3
5
-tetrahydroprogesterone (3
,5
THP), on
FSH secretion (5, 6). 3
HP has been shown to decrease
extracellular Ca2+ entry, at the level of the
gonadotrope membrane/calcium channel, into rat gonadotropes
(6) as well as interfere with the
PKC/Ca2+ channel system and with the
intracellular mobilization of Ca2+
(7).
3
HP appears also to have analgesic and antinociceptive effects. Like
the other derivatives of progesterone or deoxycorticosterone,
3
,5
THP or 5
-pregnan-3
,21-diol-20-one
(tetrahydrodeoxycorticosterone), 3
HP enhances the effects of the
inhibitory neurotransmitter
-aminobutyric acid (GABA) by
potentiating GABA-induced Cl- conductance
(8, 9). The analgesic effects of this compound can be
blocked by administration of the GABA antagonists bicuculline and
picrotoxin and can be reduced by benzodiazepine antagonists
(10). These alterations do not appear to be membrane
effects, because its stereoisomer, 3ßHP, has no effect on
GABAA receptor function or FSH secretion
(10).
3
HP contains an allylic structure in the A-ring of its 21-carbon
structure, with a double bond between carbons 4 and 5 and a hydroxyl in
the axial (
) direction at the carbon-3 position; thus, it is a
highly unstable structure. 3
HP is extremely sensitive to high
temperatures, causing dehydration to a diene structure, whereas light
and oxygen may cause rapid oxidation to progesterone (1).
Despite the assumption that 3
HP is rapidly converted to and from
progesterone by the steroidogenic enzyme 3
- hydroxysteroid
dehydrogenase (3
HSD), it has not yet been conclusively shown that
the reaction is mediated by 3
HSD. Instead, a chemical method has
been used to synthesize 3
HP for use as standards or substrates in
various studies (11).
In this study we use several methods to demonstrate the synthesis of
3
HP by 3
HSD, both in vivo in rat brain and pituitary
as well as in vitro using purified recombinant rat and human
3
HSD protein. Furthermore, we demonstrate that the synthesis of
3
HP can be enhanced by fluoxetine, a selective serotonin reuptake
inhibitor previously shown to affect 3
HSD activity in
vitro (12). We demonstrate that one of the human
3
HSD isoforms, type 2brain, is selectively
capable of producing 3
HP. These data suggest that the human brain
has the capacity for 3
HP production and provides not only an
additional endogenous regulator of the GABAA
receptor, but also possibly an additional mechanism for the regulation
of GnRH action.
 |
Materials and Methods
|
|---|
Animals
Female Sprague Dawley rats (3060 d of age) were obtained
from Simonsen Laboratories, Inc. (Gilroy, CA). Rats were
fed Purina rat chow (Ralston Purina Co., St. Louis, MO)
and water ad libitum. Rats were killed by decapitation after
CO2 anesthesia. Holding and treatment of the rats
were in accordance with regulations established and approved by the
laboratory animal research committee at University of California-San
Francisco.
Materials and Methods
[1,2,6,7-3H]Progesterone (114.4 Ci/mmol)
was purchased from NEN Life Science Products. 3
-HP was
purchased from Steraloids (Wilton, NH). 3
,5
THP, 3
,5ßTHP,
3ß,5
THP, 3ß,5ßTHP, and other steroids were purchased from
Research Plus (Bayonne, NJ). Finasteride and indomethacin
were obtained from Sigma (St. Louis, MO). Fluoxetine was
obtained as Prozac (Eli Lilly & Co., Indianapolis, IN)
tablets.
Plasmids
Rat liver 3
HSD, human type 3 and type
2brain 3
HSD expression plasmids were used to
produce purified protein as previously described (12).
Human 20
HSD cDNA was cloned from human fetal brain RNA using primers
based on the sequence of human liver 20
HSD [5'-primer,
ATGGATTCGAAATACCAG (nucleotides 118); 3'-primer, TTAATATTCATCAGAAAATG
(nucletides 950970)] (13). This cDNA was cloned into
the prokaryotic expression vector pET (Novagen, Madison, WI), and
BL21(DE3) bacteria were transformed. Proteins expressed in BL21(DE3)
were induced in bacteria by 0.4 mM
isopropyl-ß-D-thiogalactoside stimulation for 3 h,
and proteins were purified by preparation of bacterial inclusion bodies
or by immunoaffinity purification using a T7 tag. The purity of the
isolated proteins was assessed by SDS-PAGE, and protein concentration
was determined using a bicinchoninic acid reagent assay kit
(Pierce Chemical Co., Rockford, IL).
3
-HSD and 20
HSD activities
Both 3
HSD and 20
HSD activities were determined by
monitoring the metabolism of either radioactive or cold progesterone.
Bacterial extracts (20 µl) were incubated with either 40,000 cpm
[3H]steroid precursor or 10 mM
progesterone in 100 mM sodium phosphate buffer, pH 7.4,
containing 10 mM NADPH at 37 C for 30 min. The reactions
were extracted in 5 vol ether, dried under N2,
and resuspended in a small volume of ether. These reactions were
repeated a minimum of 10 times with 2 preparations of protein.
Tissue incubations
Animals were decapitated, and pituitaries, brain cortexes, and
ovaries were rapidly excised and collected in medium 199 supplemented
with HBSS and 10 mM HEPES buffer. Tissues were halved and
then homogenized in 100 µl of the above medium to which were added
radiolabeled progesterone and 33 mM NADPH. Incubations were
performed for 28 h at 37 C. All reactions were extracted in 5 vol
ether, dried rapidly under N2, and resuspended in
a small volume of ether. Each reaction was performed in quadruplicate
for each of the two ages tested.
Synthesis inhibition and augmentation
Inhibition of 3
HSD activity. Tissues were prepared as
described above. These samples were preincubated with nothing (control)
or indomethacin (20 µM) for 15 min at 37 C. Radiolabeled
(14C or 3H) progesterone
and 33 mM NADPH were then added to all samples. Reactions
were stopped at 4 or 8 h by the addition of ethyl ether. Each
reaction was performed in quadruplicate.
Inhibition of 5
-reductase activity. Additional samples of
brain were collected and homogenized as described above. These samples
were preincubated with nothing (control) or with
finasteride (50 mg/kg) for 15 min at 37 C, followed by the
addition of progesterone and NADPH. These reactions were stopped at 4
and/or 8 h with ether, then extracted and resuspended before
spotting on TLC plates as described above. Each reaction was performed
in quadruplicate.
Augmentation of 3
HSD activity with selective serotonin reuptake
inhibitors (SSRIs)
A dose-response curve was generated using increasing doses of
fluoxetine (from 5 to 500 µM). Bacterial extracts (20
µl) were incubated in the presence or absence of the SSRI fluoxetine,
with 40,000 cpm [3H]progesterone in 100
mM sodium phosphate buffer, pH 7.4, containing 10
mM NADPH at 37 C for 30 min (12). The
reactions were extracted in 5 vol chloroform/isooctane (1:1, vol/vol),
dried under N2, and resuspended in a small volume
of methylene chloride. These reactions were repeated three times with
two different preparations of recombinant protein.
TLC
TLC was performed as previously described (2) with
slight modifications (12). Assays with purified
recombinant protein were run either twice in a one-dimensional system
of chloroform/ethyl acetate (3:1, vol/vol), mixture or in a
two-dimensional system as described below. Assays performed using
tissues were run twice in solvent system 3 (hexane/chloroform/ethyl
acetate, 2:2:1, vol/vol/vol), after which the plates were rotated 90°
and run twice in solvent system 2 (hexane/ethyl acetate, 5:2, vol/vol)
(2). Cold standards were visualized by exposure of TLC
plates to 5% phosphomolybdic acid and heating to 100 C until spots
were seen. Radioactive steroid product was identified after exposure on
a phosphor screen and were analyzed using a PhosphorImager and
ImageQuant version 1.2 software (Molecular Dynamics,
Sunnyvale, CA). Rf values were determined
relative to the Rf of progesterone. Radioactive
products were identified through comparison of their
Rf values with those of cold standards run in an
identical system.
Product derivatization
Steroids determined putatively to be 3
HP by comparison of
Rf values of radioactive and cold materials were
scraped off the TLC plates and extracted from the silica in 10 vol
ether. These were then rapidly dried under N2 and
resuspended in 80 µl 100% pyridine. To this was added an equal
volume of acetic anhydride, and the reaction was allowed to proceed at
37 C overnight. Water (0.5 ml) was added to stop the reaction, and the
acetylation products were extracted with dichloromethane, again dried
under a continuous N2 stream, resuspended in
ether, and subjected to TLC. Chloroform/ether (10:2, vol/vol), was used
as the solvent system.
 |
Results
|
|---|
Identification of the enzyme responsible for 3
HP synthesis
We determined which enzyme was responsible for the generation of
3
HP from progesterone. The proposed pathway is shown in Fig. 1
. 3
HP had been identified in several
tissues and had been shown to be rapidly oxidized to progesterone
(1). [14C]Progesterone was
incubated with purified recombinant rat and human 3
HSD as well as
with human 20
HSD, all in the presence of either NADH or NADPH. Both
rat 3
HSD (from liver) as well as human type
2brain 3
HSD produced 3
HP from progesterone
(Fig. 2
). Human type 3 3
HSD as well as
human 20
HSD were not able to synthesize this compound from
progesterone, but, rather, synthesized 20
-dihydroprogesterone
(20
DHP; 57% and 88%, respectively). Although human type
2brain 3
HSD could synthesize 3
HP from
progesterone, this was not the major product of the reaction. The major
product (19%) was 20
DHP, described previously
(12).
Identification of 3
HP in rat tissues
We analyzed both cortex and pituitary of 60-d-old rats to confirm
that these tissues synthesize 3
HP from progesterone and found that
both pituitary and brain cortex manufactured an array of progesterone
derivatives (Fig. 3
and Table 1
). Each of these derivatives was
confirmed by comparing the Rf values of each to a
cold standard. In addition, several of these derivatives, including the
product thought to be 3
HP, were acetylated and compared with the
equivalent cold acetylated standards. Both pituitary and cortex
generated 3
HP from progesterone, although it represented a greater
percentage of the total product in the pituitaries and cortexes from
younger animals (Fig. 3
). At 30 d of age, in the sexually
immature, noncycling female, 3
HP was consistently synthesized and
stable in both cortex and pituitary, representing 2.5% of product in
pituitary (Fig. 3
) compared with 0.75% in cortex. However, at 60
d of age, the synthesis of 3
HP decreased in the pituitary. Products
formed in the pituitary from 30- and 60-d-old rats and their total
percentages are shown in Table 1
. This is consistent with previous
observations that 3
HP concentrations decrease over time
(2). 3
HP was also synthesized in ovary, consistent with
previous work (data not shown) (4).

View larger version (110K):
[in this window]
[in a new window]
|
Figure 3. Metabolism of progesterone in rat pituitary.
Pituitaries from 30- to 60-d-old female rats were excised, homogenized,
and incubated with [14C]progesterone for 8 h at 37
C. Steroid product was extracted, analyzed by two-dimensional TLC, and
visualized with a phosphor screen using a Molecular Dynamics, Inc., PhosphorImager. Products of progesterone were identified
by comparison to known cold steroid standards as the following: a,
5 DHP; b, progesterone; c, 3 ,5 THP; d, 3 HP; e,
unidentified; f, 3ß,5 THP; g, 3 ,5ßTHP; h, 20 DHP;
i, 3 ,5 ,20 HHP; j, 3 ,20 THP; k, unidentified; l,
unidentified.
|
|
Inhibition of 3
HSD and 5
-reductase activity
In addition to demonstration of in vitro synthesis of
3
HP by recombinant enzyme, we determined whether this enzyme was
solely responsible for 3
HP synthesis in the tissues where it is
present. To accomplish this, tissue homogenates of either 30- or
60-d-old rats were incubated with the precursor progesterone in the
presence of indomethacin, a known inhibitor of 3
HSD. Two-dimensional
TLC analysis showed nearly complete suppression of both
allopregnanolone (3
,5
THP) and 3
HP (Table 2
), whereas 5
- and 20
-reduced
products were increased or unchanged. Interestingly, 5
DHP production
in the pituitary is not substantially increased in the presence of
indomethacin as might have been expected and in contrast to the
cortical 5
DHP synthesis.
Incubation of tissue homogenates with finasteride, which
inhibits 5
-reductase, did not affect 3
HP production, but did
decrease the amounts of allopregnanolone and 5
DHP formed. These
results are consistent with the requirement of 5
-reductase for
5
DHP and allopregnanolone production, but not for 3
HP
production.
Augmentation of 3
HP synthesis by SSRIs
We previously demonstrated that SSRIs could affect 3
HSD
activity in the synthesis of both allopregnanolone and
3
-androstanediol (12). We determined whether the
synthesis of 3
HP could be enhanced by the addition of the selective
serotonin reuptake inhibitor, fluoxetine, to the type
2brain 3
HSD isoform. The addition of
pharmacological doses of fluoxetine caused an increase in the
conversion of progesterone to 3
HP along with a concomitant decrease
in the amount of 20
DHP (Fig. 4
).
 |
Discussion
|
|---|
3
-Dihydroprogesterone has been identified previously by RIA and
HPLC/TLC in tissues such as testes, ovary, pituitary, and hypothalamus
at levels equivalent to or greater than those of progesterone. Wiebe
et al. (14) recently demonstrated that normal
(nontumorous) breast tissue produces more 3
HP from progesterone than
other derivatives such as 5
DHP, whereas tumorous human breast tissue
contains far more 5
DHP than 3
HP. In rats, 3
HP has been
demonstrated in vivo and in vitro (5, 15) to be exclusive among steroids in its ability to suppress
either basal or GnRH-induced FSH release without affecting LH
secretion.
3
HP can be synthesized chemically employing potassium
trisiamylborohydride and can be oxidized to progesterone in the absence
of enzyme if exposed to light or oxygen (11). Previous
attempts to produce 3
HP by incubation of progesterone with cellular
fractions that contain 3
HSD under various different conditions have
failed, raising the question of whether synthesis of 3
HP required a
specific isoform of 3
HSD or a different enzyme altogether. Because
3
HP synthesis may be cell specific (rat Sertoli cells make 3
HP,
but Leydig cells do not), it is also possible that another cofactor or
molecule is required. It is also possible that the relative ratios of
other steroidogenic enzymes that metabolize progesterone and/or 3
HP
determine whether 3
HP is formed in appreciable amounts, as recently
demonstrated in breast cancer cell lines (14).
Our results here show that 3
HSD is involved in the formation of
3
HP. This has been shown through the use of recombinant purified
enzyme as well as through inhibition of its formation in rat pituitary
extracts using an enzyme-specific inhibitor in rat pituitary extracts.
To date, only one isoform of rat 3
HSD (reductive type) has been
cloned (16), although there is biochemical and genetic
evidence to suggest that at least two other forms exist (17, 18). In addition, an oxidative rat 3
HSD has been identified
and is identical to the type II retinol dehydrogenase
(19). The partial inhibition of 3
HP formation in
pituitary extracts by indomethacin may be due to incomplete inhibition
of one such 3
HSD isoform or, alternatively, may indicate the
presence of another enzyme, possibly indomethacin insensitive, that is
capable of 3
HP formation. 3
HP has previously been shown to be a
potent modulator of the GABAA receptor (8, 9) and may contribute to endogenous modulation of the
GABAA receptor in certain brain regions.
Neurosteroids such as 3
,5
THP and perhaps 3
HP also appear to
modulate many of the anticonvulsant, anxiolytic, and sedative
properties of ethanol, which is believed to exert its central nervous
system actions in part through the GABAA receptor
(20). In fact, the presence of 3
HP in rodent cortex may
explain why there is incomplete reduction of the neurosteroid
modulatory effects of ethanol in the presence of the 5
-reductase
inhibitor finasteride (20, 21).
Humans are known to possess at least three 3
HSD isoforms, many of
which display tissue-specific, and probably cell-specific,
distributions. Human fetal and adult brain contains a type 2 and a type
3 3
HSD. The type 2 3
HSD we identified in brain is 99.7% and
99.3% identical at the nucleotide and amino acid levels, respectively,
to the type 2 3
HSD isolated from prostate, differing by only two
amino acids, at amino acids 38 and 89 (22), and is 99.5%
and 98.7% identical to the human type II isoform from liver, differing
by four amino acids, at amino acid positions 38, 75, 89, and 175
(23). Our data show that, although type
2brain and type 3 3
HSD are both regionally
distributed in human brain, only the type 2brain
isoform is capable of synthesizing 3
HP in the presence of specific
cofactor, NAD(P)H. As the type 2brain 3
HSD
mRNA is found in different amounts in different regions of the brain
(12), the data suggest that 3
HP production may occur in
specific regions of the human brain. The synthesis of 3
HP may be
enhanced by the interaction of 3
HSD with members of the SSRI class
of drugs, perhaps by modification and/or stabilization of the binding
pocket and active site of the 3
HSD protein or by the alteration of
its oxidative Km, similar to the effects found
previously (12). The distribution of the type 2 3
HSD
isoform in human tissues was recently reported (24), and
the type 2 enzyme is the predominant isoform in human mammary gland as
well as being highly expressed in prostate. Given the diverse functions
of 3
HP in human and rodent tissues, further investigation into the
regulation of 3
HP and 3
HSD is warranted.
 |
Acknowledgments
|
|---|
 |
Footnotes
|
|---|
This work was supported by NIH Grants NS-01979 (to L.D.G.) and HD-27970
(to S.H.M.), the March of Dimes (to S.H.M.), and the Ara Parseghian
Medical Research Foundation (to S.H.M.).
Abbreviations: 3
-androstanediol,
5
-Androstane-3
,17ß-diol; 5
DHP, 5
-pregnane-3,20-dione,
5
-dihydroprogesterone; 20
DHP, 4-pregnen-20
-ol-3-one,
20
-dihydroprogesterone; GABA,
-aminobutyric acid;
3
,5
,20
HHP, 5
-pregnane-3
,20
-diol; 3
HP,
3
-hydroxy-4-pregnen-20-one (4-pregnen-3
-ol-20-one),
3
-dihydroprogesterone; 3ßHP, 4-pregnen-3ß-ol-20-one,
3ß-hydroxyprogesterone; 3
HSD, 3
-hydroxysteroid dehydrogenase;
SSRI, selective serotonin reuptake inhibitor; 3
,5
THP,
5
-pregnane-3
-ol-20-one, allopregnanolone; 3ß,5
THP,
5
-pregnane-3ß-ol-20-one, epiallopregnanolone; 3
,5ßTHP,
5ß-pregnan-3
-ol-20-one, pregnalone; 3ß,5ßTHP,
5ß-pregnan-3ß-ol-20-one, epipregnanolone; 3
,20
THP,
4-pregnen-3
,20
-diol.
Received May 15, 2001.
Accepted for publication July 23, 2001.
 |
References
|
|---|
-
Wiebe JP 1982 Identification of a unique
Sertoli cell steroid as 3
-hydroxy-4-pregnen-20-one
(3
-dihydroprogesterone: 3
-DHP). Steroids 39:259278[CrossRef][Medline]
-
Wiebe JP, Boushy D, Wolfe M 1997 Synthesis,
metabolism and levels of the neuroactive steroid,
3
-hydroxy-4-pregnen-20-one (3
HP), in rat pituitaries. Brain Res 764:158166[CrossRef][Medline]
-
Eechaute W, Dhooge, WS, Gao, CQ, Calders, P, Rubens, R,
Weyne, J, Kaufman, JM 1999 Progesterone-transforming enzyme
activity in the hypothalamus of the male rat. J Steroid Biochem Mol
Biol 70:159167[CrossRef][Medline]
-
Wiebe JP, De Gannes GC, Dallaire MJ 1994 Synthesis
of the allylic regulatory steroid, 3
-hydroxy-4-pregnen-20-one, by
rat granulosa cells and its regulation by gonadotropins. Biol Reprod 50:956964[Abstract]
-
Wood PH, Wiebe JP 1989 Selective suppression of
follicle-stimulating hormone secretion in anterior pituitary cells by
the gonadal steroid 3
-hydroxy-4-pregnen-20-one. Endocrinology 125:4148[Abstract]
-
Wiebe JP, Dhanvantari S, Watson PH, Huang Y 1994 Suppression in gonadotropes of gonadotropin-releasing
hormone-stimulated follicle-stimulating hormone release by the
gonadal- and neurosteroid 3
-hydroxy-4-pregnen-20-one involves
cytosolic calcium. Endocrinology 134:377382[Abstract]
-
Dhanvantari S, Wiebe JP 1994 Suppression of
follicle-stimulating hormone by the gonadal- and neurosteroid
3
-hydroxy-4-pregnen-20-one involves actions at the level of the
gonadotrope membrane/calcium channel. Endocrinology 134:371376[Abstract]
-
Morrow AL, Pace JR, Purdy RH, Paul SM 1990 Characterization of steroid interactions with gamma-aminobutyric acid
receptor-gated chloride ion channels: evidence for multiple steroid
recognition sites. Mol Pharmacol 37:263270[Abstract]
-
Purdy RH, Morrow AL, Blinn JR, Paul SM 1990 Synthesis, metabolism, and pharmacological activity of 3
-hydroxy
steroids which potentiate GABA-receptor-mediated chloride ion
uptake in rat cerebral cortical synaptoneurosomes. J Med Chem 33:15721581[CrossRef][Medline]
-
Wiebe JP, Kavaliers M 1988 Analgesic effects of the
putative FSH-suppressing gonadal steroid,
3
-hydroxy-4-pregnen-20-one: possible modes of action. Brain Res 461:150157[CrossRef][Medline]
-
Wiebe JP, Deline C, Buckingham KD, Dave V, Stothers
JB 1985 Synthesis of the allylic gonadal steroids,
3
-hydroxy-4-pregnen-20-one and 3
-hydroxy-4-androsten-17-one, and
of 3
-hydroxy-5
-pregnan-20-one. Steroids 45:3951[CrossRef][Medline]
-
Griffin LD, Mellon SH 1999 Selective serotonin
reuptake inhibitors directly alter activity of neurosteroidogenic
enzymes. Proc Natl Acad Sci USA 96:1351213517[Abstract/Free Full Text]
-
Stolz A, Hammond L, Lou H, Takikawa H, Ronk M, Shively
JE 1993 cDNA cloning and expression of the human hepatic bile
acid-binding protein. A member of the monomeric reductase gene family.
J Biol Chem 268:1044810457[Abstract/Free Full Text]
-
Wiebe JP, Muzia D, Hu J, Szwajcer D, Hill SA, Seachrist
JL 2000 The 4-pregnene and 5
-pregnane progesterone metabolites
formed in nontumorous and tumorous breast tissue have opposite effects
on breast cell proliferation and adhesion. Cancer Res 60:936943[Abstract/Free Full Text]
-
Wiebe JP, Wood PH 1987 Selective suppression
of follicle-stimulating hormone by 3
-hydroxy-4-pregnen-20-one, a
steroid found in Sertoli cells. Endocrinology 120:22592264[Abstract]
-
Cheng KC, White PC, Qin KN 1991 Molecular cloning
and expression of rat liver 3
-hydroxysteroid dehydrogenase. Mol
Endocrinol 5:823828[CrossRef][Medline]
-
Krause JE, Karavolas HJ 1980 Pituitary
5
-dihydroprogesterone 3
-hydroxysteroid oxidoreductases.
Subcellular location and properties of NADH- and NADPH-linked
activities. J Biol Chem 255:1180711814[Free Full Text]
-
Lin HK, Hung CF, Moore M, Penning TM 1999 Genomic
structure of rat 3
-hydroxysteroid/dihydrodiol dehydrogenase
(3
-HSD/DD, AKR1C9). J Steroid Biochem Mol Biol 71:2939[CrossRef][Medline]
-
Hardy DO, Ge RS, Catterall JF, Hou YT, Penning TM, Hardy
MP 2000 Identification of the oxidative 3
-hydroxysteroid
dehydrogenase activity of rat Leydig cells as type II retinol
dehydrogenase. Endocrinology 141:16081617[Abstract/Free Full Text]
-
VanDoren MJ, Matthews DB, Janis GC, Grobin AC, Devaud
LL, Morrow AL 2000 Neuroactive steroid
3
-hydroxy-5
-pregnan-20-one modulates electrophysiological and
behavioral actions of ethanol. J Neurosci 20:19821989[Abstract/Free Full Text]
-
Morrow AL, Janis GC, VanDoren MJ, Matthews DB, Samson
HH, Janak PH, Grant KA 1999 Neurosteroids mediate pharmacological
effects of ethanol: a new mechanism of ethanol action? Alcoholism Clin
Exp Res 23:19331940[CrossRef][Medline]
-
Lin HK, Jez JM, Schlegel BP, Peehl DM, Pachter JA,
Penning TM 1997 Expression and characterization of recombinant
type 2 3
-hydroxysteroid dehydrogenase (HSD) from human prostate:
demonstration of bifunctional 3
/17ß-HSD activity and cellular
distribution [published erratum appears in Mol Endocrinol 1999
Nov;12(11):1763]. Mol Endocrinol 11:19711984[Abstract/Free Full Text]
-
Khanna M, Qin KN, Wang RW, Cheng KC 1995 Substrate specificity, gene structure, and tissue-specific distribution
of multiple human 3
-hydroxysteroid dehydrogenases. J Biol
Chem 270:2016220168[Abstract/Free Full Text]
-
Penning TM, Burczynski ME, Jez JM, Hung H-K, Ma H, Moore
M, Palackal N, Ratnam K 2000 Human 3
-hydroxysteroid
dehydrogenase isoforms (AKR1C1-AKR1C4) of the aldo-keto-reductase
superfamily: functional plasticity and tissue distribution reveals
roles in the inactivation and formation of male and female sex
hormones. Biochem J 351:6777[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. Centrella, T. L. McCarthy, W.-Z. Chang, D. C. Labaree, and R. B. Hochberg
Estren (4-Estren-3{alpha},17{beta}-diol) Is a Prohormone that Regulates Both Androgenic and Estrogenic Transcriptional Effects through the Androgen Receptor
Mol. Endocrinol.,
May 1, 2004;
18(5):
1120 - 1130.
[Abstract]
[Full Text]
[PDF]
|
 |
|