Endocrinology Vol. 141, No. 7 2465-2471
Copyright © 2000 by The Endocrine Society
Effects of Leptin Receptor Mutation on Agrp Gene Expression in Fed and Fasted Lean and Obese (LA/N-faf) Rats1
Judith Korner,
Sharon L. Wardlaw,
Shun-Mei Liu,
Irene M. Conwell,
Rudolph L. Leibel and
Streamson C. Chua, Jr.
Departments of Medicine (J.K., S.L.W., S.-M.L., I.M.C., R.L.L.,
S.C.C.) and Pediatrics (S.-M.L., R.L.L., S.C.C.), Columbia University
College of Physicians & Surgeons, New York, New York 10032
Address all correspondence and requests for reprints to: Judith Korner M.D., Ph.D., Department of Medicine, Division of Endocrinology, Columbia University College of Physicians & Surgeons, 630 West 168th Street, Black Building Room 905, New York, New York 10032. E-mail:
jk181{at}columbia.edu
 |
Abstract
|
|---|
Agouti-related protein provides an orexigenic signal, probably
through interaction with central melanocortin receptors. Expression of
Agrp is markedly increased in the hypothalamus of mice
deficient in leptin
(Lepob/Lepob) or
its receptor
(Leprdb/Leprdb),
suggesting that leptin mediates signals suppressing Agouti-related
protein production. The regulation of Agrp expression in
the rat hypothalamus has not been reported. We, therefore, analyzed the
expression of Agrp in the medial basal hypothalamus of
lean (+/+, +/faf) and obese leptin
receptor-deficient
(faf/faf) LA/N
rats. Using a sensitive solution hybridization/S1 nuclease protection
assay, we found no significant difference in Agrp
messenger RNA (mRNA) levels (pg/µg total RNA ± SEM)
in obese rats (n = 5), compared with lean controls (n = 5):
0.46 ± 0.06 vs. 0.47 ± 0.06
(P = 0.9). Similarly, no difference in
Agrp expression was found using in situ
hybridization or semiquantitative RT-PCR. In contrast to
Agrp, Pomc mRNA levels were
significantly suppressed in the obese, compared with the lean, rats
(P = 0.001). Thus, the ratio of Pomc to
Agrp mRNA is decreased in the obese rats and may be an
important modulator of food intake. To assess the physiological
regulation of Agrp in rats, we examined the effect of
food deprivation in lean Sprague Dawley (SD) rats. There was a 273%
increase in medial basal hypothalamus Agrp mRNA in
SD rats fasted for 48 h (n = 8), compared with
rats fed ad libitum (n = 8): 0.82 ± 0.23
vs. 0.30 ± 0.08 (P = 0.0001).
Lean LA/N rats (n = 7) fasted for 48 h also showed a 231%
increase in Agrp expression, compared with fed lean
controls (n = 8): 0.74 ± 0.11 vs. 0.32
± 0.03 (P = 0.002), whereas Pomc
expression was decreased by 32% in fasted animals from the same
experiment (0.34 ± 0.05 vs. 0.50 ± 0.07;
P = 0.03). There were no significant differences in
Agrp or Pomc mRNA levels between fasted and
fed obese LA/N-faf rats. These results
suggest that, in the rat, the Agrp response to fasting
may involve leptin-mediated phenomena, but factors in addition to
leptin must also be involved in the regulation of Agrp
gene expression.
 |
Introduction
|
|---|
THE REGULATION OF food intake and energy
metabolism is a complex process that involves multiple neurohormonal
signals. Several lines of evidence implicate the melanocortin system as
an important regulator of eating behavior. There are five known members
of the melanocortin receptor family. The expression of Mc3r
and Mc4r is localized to the central nervous system (CNS),
whereas expression of Mc1r and Mc2r is primarily
limited to the skin and adrenal gland, respectively (1).
Mc5r is expressed in various non-CNS tissues. Agonists of
MC3R and MC4R inhibit food intake, whereas antagonists increase food
intake (2). The Agouti protein is a potent antagonist of
-MSH
(
-MSH) action at several members of the melanocortin receptor family
(3). Expression of the Agouti gene in mice is normally
limited to the skin, where the gene product, Agouti signaling protein
(ASP), blocks the action of
-MSH at MC1R, resulting in pheomelanin
synthesis (3). Ectopic overexpression of ASP in mice segregating for
dominant mutations of Agouti produces pleiotropic effects
including yellow coat color, hyperphagic obesity, hyperinsulinemia,
diabetes, and increased body length. These effects are presumably
caused by antagonism of
-MSH action in both the periphery (at MC1R)
and in the hypothalamus (at MC4R) (4). The obesity-related (but not
coat color) phenotypes are recapitulated by deletion of the
Mc4r gene (5).
A gene with high sequence homology to Agouti, Agouti-related
protein (Agrp; 6) or agouti-related transcript
(Art; 7), was isolated from mouse and human expression
libraries by homology searches. Expression of Agrp is
limited primarily to the hypothalamus and the adrenal gland and is
increased in the hypothalamus of obese mice deficient in leptin
(Lepob/Lepob)
or its receptor
(Leprdb/Leprdb).
Ubiquitous overexpression of Agrp complementary DNA (cDNA)
in transgenic mice causes obesity without affecting coat pigmentation
(6, 8). Recombinant Agouti-related protein (AGRP) protein is a potent
inhibitor of
-MSH action on the CNS-specific melanocortin receptors,
MC3R and MC4R, but has no apparent attenuating activity for
-MSH at
the peripheral receptors, MC1R and MC2R (6, 9). These data suggest that
AGRP may be a physiological regulator of feeding through modulation of
-MSH action at central melanocortin receptors.
Further support for the role of the melanocortin system in the
regulation of energy homeostasis are studies showing a decrease in
Pomc gene expression in the hypothalamus of ad
libitum fed ob/ob and db/db mice and
food-restricted lean rodents (10, 11, 12, 13, 14, 15). We have previously shown that
Pomc gene expression and peptide products, including
-MSH, are also decreased in the medial basal hypothalamus (MBH) of
the obese leptin receptor-deficient
LA/N-faf/faf
rat (16). The
LA/N-faf/faf
rat (also known as Koletsky or corpulent, cp) is
characterized by an autosomal recessive phenotype that includes
early-onset severe obesity, insulin resistance, and strain-dependent
diabetes (17). This phenotype is attributable to a point mutation
resulting in a premature termination codon in the extracellular domain
of the leptin receptor (18, 19). In this report, we analyze the
expression of both Agrp and Pomc in the MBH of
LA/N (lean and obese) and Sprague Dawley (SD) rats in ad
libitum and food-restricted states.
 |
Materials and Methods
|
|---|
Animals
Male 2- to 3-month-old lean (+/+,
+/faf) and obese
(faf/faf)
rats (provided by Julie Williams, Vassar College, Poughkeepsie, NY)
were the result of serial backcrosses (N10 equivalent) of the mutation
Lepr-faf (also known as Koletsky,
faf, f, or cp)
to the inbred rat strain, LA/N (19). Gene dosage for the
faf allele was assessed by
PCR-RFLP with a mutagenic primer (rLepr 14A) that introduces a
DraI site into the mutant allele. The sequences of the
primers were: rLepr 14ACTGGACACTGTCACCTAATGTTT and rLepr
14BCATGGATATAATACTTGTTAACAT. Genomic DNA (10100ng) was amplified
with the specified primers, using Taq DNA polymerase
according to the manufacturers recommendations, for 35 cycles (94
C - 55 C - 72 C for 30 sec each). The PCR product was
digested with DraI overnight and size fractionated on
agarose gels. The wild-type allele is uncut (125 bp), whereas the
mutant allele is digested to yield two fragments (102 bp + 23 bp). This
assay readily distinguishes all three genotypes (+/+,
+/faf,
faf/faf). Male
SD rats (mean weight, 265g) were purchased from Charles River Laboratories, Inc. (Wilmington, MA). FVB/NJ-db mice
were the result of 10 backcross generations from C57BLKS/J-m
db to FVB/NJ (developed by S. C. Chua, Jr.). Animals
were housed on a natural light/dark cycle and had ad libitum
access to water and Purina Rodent Chow 5001 except where indicated.
Rats were killed by decapitation after a 30-sec exposure to
CO2. All animal experiments were carried out in
accordance with the National Institute of Health Guide for the Care and
Use of Laboratory Animals and were approved by the Columbia University
Institutional Animal Care and Use Committee.
Cloning of partial cDNA for rat Agrp
Total RNA from rat MBH (LA/N strain) was reverse transcribed and
subjected to PCR using oligonucleotide primers from coding sequences
conserved between mouse and human AGRP genes within exon 2
(5'-AGGGCATCAGAAGGCCTGACCAGG-3') and exon 3
(5'-CTTGAAGAAGCGGCAGTAGCACGT-3'). The partial rat cDNA was then
subcloned into the pBluescript plasmid vector containing T3 and T7
promoters (Stratagene, San Diego, CA). One clone was
selected that bore no alterations in sequence from the primary
amplified cDNA. The sequence data has been submitted to GenBank,
accession number AF206017. Sequence alignments were performed with the
BLAST program.
Preparation of messenger RNA (mRNA)
The MBH was dissected, as described previously (20), and
immediately homogenized in 1 ml cold homogenization buffer [10
mM Tris (pH 8.0), 3 mM
CaCl2, 2 mM
MgCl2, 0.5 mM dithiothreitol, 0.15%
Triton X-100] containing 0.3 M sucrose and 50 U of human
placental ribonuclease inhibitor. The homogenate was layered over 0.3
ml of homogenization buffer containing 0.4 M sucrose and
centrifuged at 2,500 x g, for 10 min at 4 C, to pellet
the cell nuclei. The supernatant was incubated with proteinase K and
extracted twice with phenolchloroform (1:1), and the cytoplasmic
RNA was precipitated with isopropanol. Total RNA was quantified by
spectrophotometry.
S1 Nuclease protection assay
RNA used to generate standard curves and
32P-labeled RNA probes were synthesized using
commercial transcription kits (Promega Corp., Madison,
WI). Sense and antisense 175-base Agrp RNAs were synthesized
from the plasmid vector containing T3 and T7 polymerase described
above. Sense and antisense Pomc RNAs were synthesized from
plasmid vectors containing the Sp6 promoter and a 538-bp
Pomc cDNA fragment spanning part of exon 3 (obtained from M.
Blum and J. L. Roberts, Mt. Sinai School of Medicine, New
York, NY; Ref. 21). Sense RNAs were quantified spectrophotometrically
and used to generate standard curves in the hybridization assays.
Components of the hybridization reaction included: 4 µg cytoplasmic
RNA in 5 µl H2O; 24.5 µl hybridization buffer
containing 80% formamide, 40 mM PIPES (pH
7.4), 400 mM NaCl, 1 mM
EDTA; 5 µg yeast RNA; and 32P-labeled riboprobe
(22). Reaction mixtures were heated at 85 C for 5 min, then incubated
for 16 h at 45 C. After hybridization, 300 µl S1 buffer [300
mM NaCl, 30 mM NaAc (pH
4.8), 3 mM ZnCl2, 20
µg/ml salmon sperm DNA] and 400800 U S1 nuclease (Roche Molecular Biochemicals, Mannheim, Germany) were added and
incubated for 1 h at 56 C. Reaction mixtures were
phenol-chloroform extracted, precipitated, resuspended in 5
mM Tris (pH 7.5), 10 mM EDTA, and heated
for 5 min at 68 C before electrophoresis on a 4% nondenaturing
acrylamide gel. Protected bands were quantified by visualization with
an autoradiogram, followed by excision of the corresponding bands from
the gel and liquid scintillation counting (Packard 1500
Analyzer, Downers Grove, IL) and comparison with the standard
curve. Because the protected hybrids were smaller than the cellular
transcripts, 32P counts were normalized to the
full-length RNA species: 0.7 kb for full-length mouse Agrp
cytoplasmic RNA (6); 1.1 kb for full-length Pomc cytoplasmic
RNA (23). Results are presented as pg cytoplasmic RNA/µg total RNA.
The total mass of RNA isolated from the MBH of experimental and control
animals was not significantly different in any experiment.
In situ hybridizations with Agrp. In situ
hybridizations were performed as described by Burke et al.
(24). Brains were rapidly removed and frozen by immersion in isopentane
on dry ice and then serially sectioned on a cryostat through the
hypothalamus at 14 µm. For hybridization, sections were fixed by
immersion in 4% paraformaldehyde 0.1 M phosphate
buffer (pH 7.1) for 5 min, rinsed twice in PBS, and delipidated by
successive immersion in increasing concentrations of ethanol and then
chloroform. Sections were rehydrated and immersed in 2 x SSC, and
then prehybridized at 50 C for 2 h with 1:1
formamide/prehybridization mix, consisting of 0.6
M NaCl, 10 mM Tris (pH
7.5), 0.04% Ficoll, 0.04% polyvinylpyrrolidone, 0.2% BSA, 2
mM EDTA, 1 mg/ml salmon sperm DNA, 1 mg/ml total
yeast RNA, and 0.1 mg/ml yeast transfer RNA. Sections were then
hybridized with 1:1 formamide/hybridization mix at 50 C for 1618 h.
Hybridization mix was similar to prehybridization mix but contained
20% dextran, 0.2 mg/ml salmon sperm DNA, 0.1 mg/ml total yeast
RNA, and 35S-labeled Agrp cRNA probe
at a final activity of approximately 12,000 cpm/ml. Riboprobes were
synthesized as described above, except that
35S-uridine 5'-triphosphate, rather than
32P-uridine 5'-triphosphate, was used. After
hybridization, brain sections were washed by immersion in 4 liters of
2 x SSC for 60 min at 40 C, followed by treatment with 30 µg/ml
RNAase for 40 min at 37 C. Sections were then washed in 4 liters of
0.1 x SSC/0.05% sodium pyrophosphate/14 mM
mercaptoethanol, dehydrated in ethanol, vacuum dried, and exposed in a
cassette to Amersham Pharmacia Biotech (Piscataway,
NJ) Hyperfilm b-max at -80 C for 3 weeks. The specificity of the
hybridization was assessed by hybridization with sense riboprobe. The
autoradiograms were analyzed on a Loats Associates image analysis
system with Inquiry Software. 14C standards were
included in each cassette to ensure that the optical densities recorded
on the film from exposure to the labeled brain sections were within the
linear response range, and to enable expression of optical densities in
14C-dpm equivalents. Exposure intensities were
quantified by placing a fixed circular window over the arcuate nucleus
and measuring the relative optical density. Background optical density
was measured by placing the window over the VMN, an area devoid of AGRP
neurons (7, 25, 26).
Semiquantitative RT-PCR
cDNA synthesis was performed with 2 µg MBH RNA using
ribonuclease-H-reverse transcriptase (Superscript II, Life Technologies, Inc. Rockville, MD) and an anchored
oligo-dT primer (Not PA, Promega Corp.). cDNA templates,
the equivalent of 20 ng total RNA, were amplified with Agrp-
and Actin-specific primers (spanning at least 1 intron) and
Taq DNA polymerase for 28 (Agrp) or 20 cycles
(Actin) in the presence of
35S-deoxy-ATP. These conditions were previously
determined to be within the linear range of amplification and will
measure relative message levels. The products were size-fractionated on
4% polyacrylamide gels, dried, and exposed to x-ray film. Bands
corresponding to the Agrp and Actin cDNAs were
quantified with a scanning densitometer (Bio-Rad Laboratories, Inc., Hercules, CA; GS700) and QuantOne
software (Bio-Rad Laboratories, Inc.).
Plasma insulin and glucose
Plasma insulin concentrations were measured with an RIA kit
using mouse insulin as a standard (Sensitive Insulin RIA Kit,
Linco, St. Charles, MO). Plasma glucose concentrations were
measured with a Glucometer Elite (Bayer Corp., Pittsburgh, PA).
Statistical analysis
Relative chemical concentrations of mRNA are reported as mean
values (pg/µg total RNA) ± SEM. For experiments
using solution hybridization and in situ hybridization,
significant differences between groups were determined by ANOVA,
followed by the Bonferroni/Dunn all-means test when more than two
groups were compared. Statistical analysis of RT-PCR was performed by
the Mann-Whitney test (one-sided with significance set at
P
0.05.
 |
Results
|
|---|
Cloning of rat Agrp partial cDNA
Oligonucleotide primers, based on coding sequences conserved
between mouse and human AGRP genes within exons 2 and 3,
were used to generate a single PCR product from reverse-transcribed rat
hypothalamic RNA. The predicted 78-amino-acid sequence is 87% and
72%, identical to the mouse and human orthologs, respectively (Fig. 1
). Within the amino terminus of the rat
sequence, there is a 3-amino-acid deletion, compared with the mouse
sequence. This region of the protein is not required for antagonism of
-MSH (6). The highly conserved cysteine-rich motif in the carboxyl
terminus is maintained, with the exception of a 2-amino-acid difference
and a single amino acid deletion (Fig. 1
; shaded box).
Agrp mRNA expression in the MBH of lean and obese
LA/N-faf rats
Cytoplasmic RNA in the MBH of lean (+/+,
+/faf) and obese
(faf/faf)
LA/N rats was quantified by solution hybridization and S1 nuclease
protection assay. There was no significant difference in
Agrp mRNA levels in obese rats (n = 5), compared with
lean controls (n = 5): 0.46 ± 0.06 vs. 0.47
± 0.06 pg/ug total RNA ± SEM
(P = 0.9; Fig. 2
). In
these dissections, the total RNA content (12.11 ± 81
vs. 12.10 ± 41 ug,) and the absolute amount
of Agrp mRNA in the MBH (5.54 ± 0.59 vs.
5.54 ± 0.62 pg) were also not significantly different in the
obese rats, compared with lean controls. Because the absence of an
increase in Agrp expression in the obese
(faf/faf)
LA/N rat was not the predicted result (levels of Agrp mRNA
are increased in the MBH of mice homozygous for inactivating mutations
of Lepr; Refs. 7, 27), the anatomical localization
of Agrp RNA in the rat brain was analyzed by in
situ hybridization using the same rat probe. Similar to the mouse,
Agrp RNA expression was restricted to the arcuate nucleus
(Fig. 3
). However, in support of the
results with solution hybridization, there was no significant
difference in levels of Agrp expression (mean optical
densities expressed in 14C-dpm equivalents and
measured in the linear range) in the MBH between lean (258 ± 33;
n = 4) and obese
faf/faf
(304 ± 40; n = 3) rats (P = 0.4). There was
also no significant regional difference in Agrp RNA
expression when the rostral and caudal arcuate were analyzed
separately. Semiquantitative RT-PCR was performed to further confirm
these results. Again, no difference in hypothalamic Agrp
mRNA expression was detected between lean and obese
faf/faf
rats, whereas db/db mice exhibited a 3-fold increase,
compared with lean controls (Fig. 4
).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2. Mean Agrp cytoplasmic RNA levels
(pg/µg total RNA ± SEM) from the MBH of lean (+/+,
+/faf) and obese
(faf/faf) LA/N
rats.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
Figure 3. In situ hybridization with
antisense Agrp cRNA probe in the arcuate nucleus of lean
(A) and obese (B)
(faf/faf) LA/N
rats.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Figure 4. Agrp mRNA levels in the hypothalamus of lean and
obese rodents, as detected by semiquantitative RT-PCR.
Actin mRNA content was determined for each sample and
used for normalization. The Agrp mRNA content of each
animal is expressed relative to the median Agrp mRNA
content of the appropriate lean group (lean rats or lean mice), which
was set to 1.00. There was no significant difference in
Agrp mRNA content between lean (n = 4) and
faf/faf (n =
5) rats. The difference between lean (n = 5) and
db/db (n = 4) mice was significant,
P < 0.008. AU, Arbitrary units.
|
|
Effect of food restriction on Agrp and Pomc mRNA expression in the
MBH of nonobese Sprague Dawley rats
To assess physiological regulation of Agrp expression
in rats, the effect of food restriction was analyzed in nonobese SD
rats. After a 48-h period of food restriction, SD rats exhibited a mean
14.3% reduction in body weight, as opposed to a 6.7% body-weight gain
in rats given free access to food during the same time period. There
was a 273% increase in MBH Agrp mRNA in SD rats fasted for
48 h (n = 8), compared with rats fed ad libitum
(n = 8): 0.82 ± 0.23 vs. 0.30 ± 0.08
pg/µg total RNA (P = 0.0001; Figs. 5
and 6A
).
In contrast, Pomc mRNA within the same dissections was
decreased by 25% in fasted vs. fed rats: 0.51 ± 0.04
vs. 0.68 ± 0.03 pg/µg total RNA (P=0.006;
Fig. 6B
).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 5. Autoradiogram of a gel, showing the standard curve
and protected bands from MBH mRNA samples hybridized with antisense
Agrp riboprobe. Lanes 16, Agrp standard
curve (04 pg); lanes 713, cytoplasmic RNA from the MBH of Sprague
Dawley rats fed ad libitum (+) or fasted for 48 h
(-).
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. A, Mean Agrp mRNA levels in the MBH
of fed and fasted SD rats; B, mean Pomc mRNA levels in the
MBH of the same animals presented in A; *, significant difference
(P < 0.05), compared with fed controls.
|
|
Effect of food restriction on Agrp and Pomc mRNA expression in the
MBH of lean and obese LA/N-faf rats
Lean (+/+, +/faf; mean
weight, 261 g) LA/N rats exhibited an 11.4 ± 0.5% body
weight reduction after a 48 h fast (Table 1
) and showed a 231% increase in
Agrp mRNA expression, compared with fed controls showing a
4.1 ± 0.7% gain in body weight: 0.74 ± 0.11 vs.
0.32 ± 0.03 pg Agrp mRNA/µg total RNA
(P = 0.002; Fig. 7A
).
However, there was no significant difference in Agrp mRNA
levels between fasted and fed obese
(faf/faf;
mean weight, 350 g) LA/N rats exhibiting a 12.1 ± 0.6%
decrease and a 4.7 ± 0.7% increase in body weight, respectively:
0.41 ± 0.05 vs. 0.36 ± 0.05 pg/µg total RNA
(P = 0.5; Fig. 7A
). Again, no difference was
detected in Agrp expression in fed obese LA/N rats, compared
with fed lean controls. After the 48-h fast, there was a significant
decline in plasma insulin levels in both lean and obese rats (Table 1
;
P < 0.0001). Insulin levels were significantly higher
in the fed and food-restricted obese LA/N rats, compared with their
respective lean controls. Plasma glucose levels also declined after the
48-h fast in both lean and obese rats.
View this table:
[in this window]
[in a new window]
|
Table 1. Mean weight, plasma insulin and glucose levels in
LA/N rats after 48 h of ad libitum feeding
or food restriction
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7. A, Mean Agrp mRNA levels in the MBH
of lean (+/+, +/faf) and obese
(faf/faf) LA/N
rats fed ad libitum or fasted for 48 h; B, mean
Pomc mRNA levels in the MBH of the same animals presented in
A; *, significant difference (P < 0.05), compared
with lean fed controls.
|
|
In MBH extracts from the same experiment, there was a significant
decrease in Pomc mRNA levels in fed obese LA/N rats,
compared with fed lean controls: 0.24 ± 0.03 vs.
0.50 ± 0.07 pg/µg total RNA (P = 0.001; Fig. 7B
). There was also a significant decrease in Pomc mRNA
levels in food-restricted lean LA/N rats, compared with lean LA/N rats
fed ad libitum: 0.34 ± 0.05 vs. 0.50
± 0.07 pg/µg total RNA (P = 0.03; Fig. 7B
). No
change, however, was detected in Pomc mRNA levels in 48-h
food-restricted obese LA/N rats, compared with obese rats fed ad
libitum: 0.25 ± 0.02 vs. 0.24 ± 0.03
pg/µg total RNA (P = 0.9; Fig. 7B
).
 |
Discussion
|
|---|
We have demonstrated in fed obese leptin receptor-deficient
(faf/faf)
rats that there is no increase in hypothalamic Agrp mRNA
expression, compared with lean controls, using solution hybridization,
in situ hybridization, and semiquantitative RT-PCR.
Furthermore, Agrp expression does not increase when the
obese
faf/faf
animals are food restricted. These results differ markedly from those
reported in fed leptin receptor-deficient (db/db) mice,
which exhibit an up-regulation in Agrp mRNA expression,
compared with lean controls, and a further increase in Agrp
expression upon food restriction (7, 27). As in mice, however, fasting
results in up-regulation of Agrp mRNA in lean LA/N and SD
rats. The data in mice suggest that leptin tonically suppresses
Agrp expression in the fed state, and that this suppression
is released in the absence of leptin or a functional leptin receptor,
or during fasting when circulating leptin levels are decreased (7, 25, 27). In addition, leptin treatment of nonmutant and ob/ob
mice decreases Agrp mRNA (25, 27). In the
faf/faf
rat, however, unlike the db/db mouse, leptin receptor
deficiency alone does not lead to an increase in Agrp gene
expression, compared with lean (+/+,
+/faf) controls, and Agrp
expression does not increase with fasting in
faf/faf
animals. There also does not seem to be a difference in Agrp
mRNA expression between lean homozygote (+/+) or heterozygote
(+/faf) animals. However,
the number of animals in these experiments may have been too small to
detect a subtle gene-dosage effect.
Because the faf mutation is a null
variant (28), it is unlikely that the lack of an increase in basal
Agrp expression in
faf/faf
animals is caused by suppression from partial leptin activity at the
mutant rat leptin receptor, as might be the case with the
Leprfa mutation (though we did not
examine this possibility). Thus, in the rat, the normal Agrp
response to fasting may involve leptin receptor-mediated phenomena, but
factors in addition to the leptin-leptin receptor axis must also be
important for the regulation of Agrp gene expression. If
leptin were the sole regulator of Agrp expression, then
levels of Agrp mRNA would be increased in the hypothalamus
of fed leptin receptor-deficient rats. It has also been shown that
factors other than leptin-leptin receptor are involved in the
regulation of hypothalamic Agrp gene expression in mice: in
db/db mice, Agrp gene expression is further
increased upon fasting, although the animals are leptin insensitive
(27); and in streptozotocin-induced diabetic mice, fasting stimulates
hypothalamic Agrp mRNA, whereas plasma leptin levels remain
unchanged (29).
So important to survival is the drive to eat, that there likely exist
redundant mechanisms to ensure that this drive is maintained.
Orexigenic factors other than AGRP, such as neuropeptide Y (NPY), which
is coexpressed with AGRP in the same neurons of the medial arcuate
nucleus (30), may contribute to the obesity syndrome in the
faf rat. In fact, NPY peptide levels
are significantly increased in the arcuate nucleus of ad
libitum fed obese
faf/faf
rats compared with lean controls (31). Intracerebroventricular
administration of insulin suppresses the fasting-induced increase in
NPY gene expression in the arcuate nucleus of lean, but not obese,
Zucker (fa/fa) rats (32). Obese
faf/faf
rats are hyperinsulinemic (see Results and Refs. 33, 34)
and also have increased plasma concentrations of corticosterone (16).
The effects of insulin and corticosterone on Agrp expression
are unknown, but elevated levels of these hormones may have different
effects on Agrp expression in
faf/faf
rats, compared with db/db mice. Species differences in gene
regulation, presumably caused by differences in the function of
regulatory elements, are known to occur in other physiological
circumstances. For example, mice show a 20-fold increase in circulating
leptin in late stages of pregnancy, whereas rats and humans only show a
modest 2-fold increase (35).
In the rat, as in the mouse, AGRP probably provides a tonic orexigenic
signal by antagonizing MC3R and MC4R. However, there is a noteworthy
difference between the mouse and rat amino sequence in the highly
conserved cysteine-rich C-terminal domain of the AGRP and ASP proteins.
The Cys-110 to Cys-117 octapeptide loop of human AGRP mimics the
conformation of
-MSH, and is critical in mediating its antagonism of
-MSH action (36). There is 100% homology of amino acid sequence in
this region between mouse, human, and bovine AGRP, but two conservative
substitutions and one amino acid deletion are detected in the rat
sequence (Fig. 1
). These changes may have functional significance,
although the rat sequence does maintain the RFF111113 triplet
presumably most critical in determining the binding affinity of AGRP to
the melanocortin receptors (36). The deletion of several amino acids in
the N-terminal of rat AGRP (Fig. 1
) probably does not have functional
significance, because this portion of the protein is not required for
antagonism of
-MSH (6, 37). The differences in the rat AGRP sequence
are authentic, given that only a single PCR product was obtained from
total RNA of rat MBH. Also, genomic clones were obtained that
corresponded to the cDNA, with intron/exon junctions observed in both
mice and humans (data not shown).
In the same experiments, we also quantified the levels of hypothalamic
Pomc mRNA and showed that its expression is decreased in
ad libitum fed obese
faf/faf
rats, compared with lean controls, and in food-restricted lean LA/N and
SD rats, compared with fed controls. We have previously shown that
levels of the anorexigenic peptide,
-MSH, are also decreased in the
hypothalamus of obese
faf/faf
rats (16). Because both POMC and AGRP fiber tracts project to the
same brain regions, it is likely that some of the biological effects of
leptin depend on the competitive interactions of
-MSH with AGRP at
the same melanocortin receptors (26, 38). Although Agrp mRNA
levels are not changed in the fed obese
faf/faf
rats, compared with fed lean LA/N controls, the ratio of
Pomc to Agrp mRNA is decreased by 57%. It would,
therefore, be of interest to also measure hypothalamic AGRP peptide
levels in these animals, because the peptide ratio of
-MSH to AGRP
may be an important modulator of food intake.
 |
Acknowledgments
|
|---|
We would like to thank Dr. Gregory S. Barsh for helpful
discussions, and Ritu Baral for excellent technical assistance.
 |
Footnotes
|
|---|
1 This work has been supported by NIH [Grants T-32-DK-07271 (to J.K.),
DA-07732 (to S.W.), and DK-52431 (to R.L.)], The New York Obesity
Research Center [DK26687 (to J.K, R.L., and S.C.)], and The Endocrine
Fellows Foundation Grant (to J.K.). 
Received December 1, 1999.
 |
References
|
|---|
-
Mountjoy KG, Mortrud MT, Low MJ, Simerly RB, Cone
RD 1994 Localization of the melanocortin-4 receptor (MC4-R) in
neuroendocrine and autonomic control circuits in the brain. Mol
Endocrinol 8:12981308[Abstract]
-
Fan W, Boston BA, Kesterson RA, Hruby VJ, Cone RD 1997 Role of melanocortinergic neurons in feeding and the
agouti obesity syndrome. Nature 385:165168[CrossRef][Medline]
-
Lu D, Willard D, Patel IR, Kadwell S, Overton L, Kost
T, Luther M, Chen W, Woychik RP, Wilkinson WO, Cone RD 1994 Agouti
protein is an antagonist of the melanocyte-stimulating-hormone
receptor. Nature 371:799802[CrossRef][Medline]
-
Manne J, Argeson AC, Siracusa LD 1995 Mechanisms
for the pleiotropic effects of the agouti gene. Proc Natl Acad Sci USA 92:47214724[Free Full Text]
-
Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH,
Fang Q, Berkemeier LR, Gu W, Kesterson RA, Boston BA, Cone RD, Smith
FJ, Campfield LA, Burn P, Lee F 1997 Targeted disruption of the
melanocortin-4 receptor results in obesity in mice. Cell 88:131141[CrossRef][Medline]
-
Ollmann MM, Wilson BD, Yang Y-K, Kerns JA, Chen Y,
Gantz I, Barsh GS 1997 Antagonism of central melanocortin
receptors in vitro and in vivo by agouti-related
protein. Science 278:135138[Abstract/Free Full Text]
-
Shutter JR, Graham M, Kinsey AC, Scully S, Lüthy
R, Stark KL 1997 Hypothalamic expression of ART, a novel gene
related to agouti, is up-regulated in obese and
diabetic mutant mice. Genes Dev 11:593602[Abstract/Free Full Text]
-
Graham M, Shutter JR, Sarmiento U, Sarosi I, Stark
KL 1997 Overexpression of agrt leads to obesity in
transgenic mice. Nat Genet 17:273274[CrossRef][Medline]
-
Fong TM, Mao C, MacNeil T, Kalyani R, Smith T, Weinberg
D, Tota MR, Van der Ploeg LHT 1997 ART (protein product of
agouti-related transcript) as an antagonist of MC-3 and MC-4 receptors.
Biochem Biophys Res Commun 237:629631[CrossRef][Medline]
-
Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield
LA, Burn P, Baskin DG 1997 Leptin increases hypothalamic
pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus.
Diabetes 46:21192123[Abstract]
-
Thornton JE, Cheung CC, Clifton DK, Steiner RA 1997 Regulation of hypothalamic proopiomelanocortin mRNA by leptin in
ob/ob mice. Endocrinology 138:50635066[Abstract/Free Full Text]
-
Mizuno TM, Kleopoulos SP, Bergen HT, Roberts JL, Priest
CA, Mobbs CV 1998 Hypothalamic pro-opiomelanocortin mRNA is
reduced by fasting in ob/ob and db/db mice, but
is stimulated by leptin. Diabetes 47:294297[Abstract]
-
Brady LS, Smith MA, Gold PW, Herkenham M 1990 Altered expression of hypothalamic neuropeptide mRNAs in
food-restricted and food-deprived rats. Neuroendocrinology 52:441447[Medline]
-
Bergendahl M, Wiemann JN, Clifton DK, Huhtaniemi I,
Steiner RA 1992 Short-term starvation decreases Pomc
mRNA but does not alter GnRH mRNA in the brain of adult male rats.
Neuroendocrinology 56:913920[Medline]
-
Kim E-M, Welch CC, Grace MK, Billington CJ, Levine
AS 1996 Chronic food restriction and acute food deprivation
decrease mRNA levels of opioid peptides in arcuate nucleus. Am J
Physiol 270:R1019R1024
-
Korner J, Chua Jr SC, Williams JA, Leibel RL, Wardlaw
SL 1999 Regulation of hypothalamic proopiomelanocortin by leptin
in lean and obese rats. Neuroendocrinology 70:377383[CrossRef][Medline]
-
Koletsky S 1973 Obese spontaneous hypertensive
rats: a model for the study of atherosclerosis. Exp Mol Pathol 19:5360[CrossRef][Medline]
-
Takaya K, Ogawa Y, Hiraoka J, Hosoda K, Yamori Y, Nakao
K, Koletsky RJ 1996 Nonsense mutation of leptin receptor in the
obese spontaneously hypertensive koletsky rat. Nat Genet 14:130131[CrossRef][Medline]
-
Wu-Peng XS, Chua Jr SC, Okada N, Liu S-M, Nicolson M,
Leibel RL 1997 Phenotype of the obese koletsky (f) rat due to
Tyr763Stop mutation in the extracellular domain of the leptin receptor
(Lepr). Diabetes 46:513518[Abstract]
-
Wardlaw SL, McCarthy KC, Conwell IM 1998 Glucocorticoid regulation of hypothalamic proopiomelanocortin.
Neuroendocrinology 67:5157[CrossRef][Medline]
-
Blum M, Roberts JL, Wardlaw SL 1989 Androgen
regulation of proopiomelanocortin gene expression and peptide content
in the basal hypothalamus. Endocrinology 124:22832288[Abstract]
-
Scarbrough K, Jakubowski M, Levin N, Wise PM, Roberts
JL 1994 The effect of time of day on levels of hypothalamic
proopiomelanocortin primary transcript, processing intermediate and
messenger ribonucleic acid in proestrous and estrous rats.
Endocrinology 134:555565[Abstract]
-
Autelitano DJ, Blum M, Lopingco M, Allen RG, Roberts
JL 1990 Corticotropin-releasing factor differentially regulates
anterior and intermediate pituitary lobe proopiomelanocortin gene
transcription, nuclear precursor RNA and mature mRNA in vivo.
Neuroendocrinology 51:123130[Medline]
-
Burke RE, Franklin SO, Inturrisi CE 1994 Acute and
persistent suppression of preproenkephalin mRNA expression in the
striatum following developmental hypoxic-ischemic injury. J
Neurochem 62:18781886[Medline]
-
Wilson BD, Bagnol D, Kaelin CB, Ollmann MM, Gantz I,
Watson SJ, Barsh GS 1999 Physiologic and anatomic circuitry
between Agouti-related protein and leptin signaling. Endocrinology 140:23872397[Abstract/Free Full Text]
-
Haskell-Luevano C, Chen P, Chien L, Chang K, Smith MS,
Cameron JL, Cone RD 1999 Characterization of the neuroanatomical
distribution of agouti-related protein immunoreactivity in the
rhesus monkey and the rat. Endocrinology 140:14081415[Abstract/Free Full Text]
-
Mizuno TM, Mobbs CV 1999 Hypothalamic
agouti-related protein messenger ribonucleic acid is inhibited by
leptin and stimulated by fasting. Endocrinology 140:814817[Abstract/Free Full Text]
-
Zhang YY, Leibel RL 1998 Molecular physiology of
leptin and its receptor. Growth: Genet Horm 14:1726
-
Mizuno TM, Makimura H, Silverstein J, Roberts JL,
Lopingco T, Mobbs CV 1999 Fasting regulates hypothalamic
neuropeptide Y, agouti-related peptide, and proopiomelanocortin in
diabetic mice independent of changes in leptin or insulin.
Endocrinology 140:45514557[Abstract/Free Full Text]
-
Hahn TM, Breininger JF, Baskin DG, Schwartz MW 1998 Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons.
Nat Neurosci 1:271272[CrossRef][Medline]
-
Williams G, Shellard L, Lewis DE, McKibbin PE, McCarthy
HD, Koeslag DG, Russell JC 1992 Hypothalamic neuropeptide Y
disturbances in the obese (cp/cp) JCR:LA corpulent rat.
Peptides 13:537540[CrossRef][Medline]
-
Schwartz MW, Marks JL, Sipols AJ, Baskin DG, Woods SC,
Kahn SE, Porte D 1991 Central insulin administration reduces
neuropeptide Y mRNA expression in the arcuate nucleus of food-deprived
lean (Fa/Fa) but not obese (fa/fa) Zucker rats. Endocrinology 128:26452647[Abstract]
-
Michaelis OE, Ellwood KC, Hallfrisch J, Hansen CT 1983 Effect of dietary sucrose and genotype on metabolic parameters of
a new strain of genetically obese rat: LA/N-corpulent. Nutrition Res 3:217228[CrossRef]
-
Ellwood KC, Michaelis IV OE, Emberland JJ, Bhathena
SJ 1985 Hormonal and lipogenic and gluconeogenic enzymatic
responses in LA/N-corpulent rats (42079). Proc Soc Exp Biol Med 179:163167[Abstract]
-
Gavrilova O, Barr Valarie, Marcus-Samuels B, Reitman
M 1997 Hyperleptinemia of pregnancy associated with the appearance
of a circulating form of the leptin receptor. J Biol Chem 272:3054630551[Abstract/Free Full Text]
-
Tota MR, Smith TS, Mao C, MacNeil T, Mosley RT, Van der
Ploeg LHT, Fong TM 1999 Molecular interaction of Agouti and
Agouti-related protein with human melanocortin receptors. Biochemistry 38:897904[CrossRef][Medline]
-
Rosenfeld RD, Zeni L, Welcher AA, Narhi LO, Hale C,
Marasco J, Delaney J, Gleason T, Philo JS, Katta V, Hui J, Baumgartner
J, Graham M, Stark KL, Karbon W 1998 Biochemical, biophysical, and
pharmacological characterization of bacterially expressed human
Agouti-related protein. Biochemistry 37:1604116052[CrossRef][Medline]
-
Broberger C, Johansen J, Johansson C, Schalling M,
Hökfelt T 1998 The neuropeptide Y/agouti gene-related
protein (AGRP) brain circuitry in normal, anorectic, and monosodium
glutamate-treated mice. Proc Natl Acad Sci USA 95:1504315048[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
V. Tolle and M. J. Low
In Vivo Evidence for Inverse Agonism of Agouti-Related Peptide in the Central Nervous System of Proopiomelanocortin-Deficient Mice
Diabetes,
January 1, 2008;
57(1):
86 - 94.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Goto, H. Arima, M. Watanabe, M. Hayashi, R. Banno, I. Sato, H. Nagasaki, and Y. Oiso
Ghrelin Increases Neuropeptide Y and Agouti-Related Peptide Gene Expression in the Arcuate Nucleus in Rat Hypothalamic Organotypic Cultures
Endocrinology,
November 1, 2006;
147(11):
5102 - 5109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Morrison, G. J. Morton, K. D. Niswender, R. W. Gelling, and M. W. Schwartz
Leptin inhibits hypothalamic Npy and Agrp gene expression via a mechanism that requires phosphatidylinositol 3-OH-kinase signaling
Am J Physiol Endocrinol Metab,
December 1, 2005;
289(6):
E1051 - E1057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R G P Denis, C Bing, S Brocklehurst, J A Harrold, R G Vernon, and G Williams
Diurnal changes in hypothalamic neuropeptide and SOCS-3 expression: effects of lactation and relationship with serum leptin and food intake
J. Endocrinol.,
October 1, 2004;
183(1):
173 - 181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Baran, E. Preston, D. Wilks, G. J. Cooney, E. W. Kraegen, and A. Sainsbury
Chronic Central Melanocortin-4 Receptor Antagonism and Central Neuropeptide-Y Infusion in Rats Produce Increased Adiposity by Divergent Pathways
Diabetes,
January 1, 2002;
51(1):
152 - 158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Hwa, L. Ghibaudi, J. Gao, and E. M. Parker
Central melanocortin system modulates energy intake and expenditure of obese and lean Zucker rats
Am J Physiol Regulatory Integrative Comp Physiol,
August 1, 2001;
281(2):
R444 - R451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Fekete, J. Kelly, E. Mihaly, S. Sarkar, W. M. Rand, G. Legradi, C. H. Emerson, and R. M. Lechan
Neuropeptide Y Has a Central Inhibitory Action on the Hypothalamic-Pituitary-Thyroid Axis
Endocrinology,
June 1, 2001;
142(6):
2606 - 2613.
[Abstract]
[Full Text]
[PDF]
|
 |
|