help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korner, J.
Right arrow Articles by Chua, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korner, J.
Right arrow Articles by Chua, S. C., Jr.
Endocrinology Vol. 141, No. 7 2465-2471
Copyright © 2000 by The Endocrine Society


ARTICLES

Effects of Leptin Receptor Mutation on Agrp Gene Expression in Fed and Fasted Lean and Obese (LA/N-faf) Rats1

Judith Korner, Sharon L. Wardlaw, Shun-Mei Liu, Irene M. Conwell, Rudolph L. Leibel and Streamson C. Chua, Jr.

Departments of Medicine (J.K., S.L.W., S.-M.L., I.M.C., R.L.L., S.C.C.) and Pediatrics (S.-M.L., R.L.L., S.C.C.), Columbia University College of Physicians & Surgeons, New York, New York 10032

Address all correspondence and requests for reprints to: Judith Korner M.D., Ph.D., Department of Medicine, Division of Endocrinology, Columbia University College of Physicians & Surgeons, 630 West 168th Street, Black Building Room 905, New York, New York 10032. E-mail: jk181{at}columbia.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Agouti-related protein provides an orexigenic signal, probably through interaction with central melanocortin receptors. Expression of Agrp is markedly increased in the hypothalamus of mice deficient in leptin (Lepob/Lepob) or its receptor (Leprdb/Leprdb), suggesting that leptin mediates signals suppressing Agouti-related protein production. The regulation of Agrp expression in the rat hypothalamus has not been reported. We, therefore, analyzed the expression of Agrp in the medial basal hypothalamus of lean (+/+, +/faf) and obese leptin receptor-deficient (faf/faf) LA/N rats. Using a sensitive solution hybridization/S1 nuclease protection assay, we found no significant difference in Agrp messenger RNA (mRNA) levels (pg/µg total RNA ± SEM) in obese rats (n = 5), compared with lean controls (n = 5): 0.46 ± 0.06 vs. 0.47 ± 0.06 (P = 0.9). Similarly, no difference in Agrp expression was found using in situ hybridization or semiquantitative RT-PCR. In contrast to Agrp, Pomc mRNA levels were significantly suppressed in the obese, compared with the lean, rats (P = 0.001). Thus, the ratio of Pomc to Agrp mRNA is decreased in the obese rats and may be an important modulator of food intake. To assess the physiological regulation of Agrp in rats, we examined the effect of food deprivation in lean Sprague Dawley (SD) rats. There was a 273% increase in medial basal hypothalamus Agrp mRNA in SD rats fasted for 48 h (n = 8), compared with rats fed ad libitum (n = 8): 0.82 ± 0.23 vs. 0.30 ± 0.08 (P = 0.0001). Lean LA/N rats (n = 7) fasted for 48 h also showed a 231% increase in Agrp expression, compared with fed lean controls (n = 8): 0.74 ± 0.11 vs. 0.32 ± 0.03 (P = 0.002), whereas Pomc expression was decreased by 32% in fasted animals from the same experiment (0.34 ± 0.05 vs. 0.50 ± 0.07; P = 0.03). There were no significant differences in Agrp or Pomc mRNA levels between fasted and fed obese LA/N-faf rats. These results suggest that, in the rat, the Agrp response to fasting may involve leptin-mediated phenomena, but factors in addition to leptin must also be involved in the regulation of Agrp gene expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE REGULATION OF food intake and energy metabolism is a complex process that involves multiple neurohormonal signals. Several lines of evidence implicate the melanocortin system as an important regulator of eating behavior. There are five known members of the melanocortin receptor family. The expression of Mc3r and Mc4r is localized to the central nervous system (CNS), whereas expression of Mc1r and Mc2r is primarily limited to the skin and adrenal gland, respectively (1). Mc5r is expressed in various non-CNS tissues. Agonists of MC3R and MC4R inhibit food intake, whereas antagonists increase food intake (2). The Agouti protein is a potent antagonist of {alpha}-MSH ({alpha}-MSH) action at several members of the melanocortin receptor family (3). Expression of the Agouti gene in mice is normally limited to the skin, where the gene product, Agouti signaling protein (ASP), blocks the action of {alpha}-MSH at MC1R, resulting in pheomelanin synthesis (3). Ectopic overexpression of ASP in mice segregating for dominant mutations of Agouti produces pleiotropic effects including yellow coat color, hyperphagic obesity, hyperinsulinemia, diabetes, and increased body length. These effects are presumably caused by antagonism of {alpha}-MSH action in both the periphery (at MC1R) and in the hypothalamus (at MC4R) (4). The obesity-related (but not coat color) phenotypes are recapitulated by deletion of the Mc4r gene (5).

A gene with high sequence homology to Agouti, Agouti-related protein (Agrp; 6) or agouti-related transcript (Art; 7), was isolated from mouse and human expression libraries by homology searches. Expression of Agrp is limited primarily to the hypothalamus and the adrenal gland and is increased in the hypothalamus of obese mice deficient in leptin (Lepob/Lepob) or its receptor (Leprdb/Leprdb). Ubiquitous overexpression of Agrp complementary DNA (cDNA) in transgenic mice causes obesity without affecting coat pigmentation (6, 8). Recombinant Agouti-related protein (AGRP) protein is a potent inhibitor of {alpha}-MSH action on the CNS-specific melanocortin receptors, MC3R and MC4R, but has no apparent attenuating activity for {alpha}-MSH at the peripheral receptors, MC1R and MC2R (6, 9). These data suggest that AGRP may be a physiological regulator of feeding through modulation of {alpha}-MSH action at central melanocortin receptors.

Further support for the role of the melanocortin system in the regulation of energy homeostasis are studies showing a decrease in Pomc gene expression in the hypothalamus of ad libitum fed ob/ob and db/db mice and food-restricted lean rodents (10, 11, 12, 13, 14, 15). We have previously shown that Pomc gene expression and peptide products, including {alpha}-MSH, are also decreased in the medial basal hypothalamus (MBH) of the obese leptin receptor-deficient LA/N-faf/faf rat (16). The LA/N-faf/faf rat (also known as Koletsky or corpulent, cp) is characterized by an autosomal recessive phenotype that includes early-onset severe obesity, insulin resistance, and strain-dependent diabetes (17). This phenotype is attributable to a point mutation resulting in a premature termination codon in the extracellular domain of the leptin receptor (18, 19). In this report, we analyze the expression of both Agrp and Pomc in the MBH of LA/N (lean and obese) and Sprague Dawley (SD) rats in ad libitum and food-restricted states.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Male 2- to 3-month-old lean (+/+, +/faf) and obese (faf/faf) rats (provided by Julie Williams, Vassar College, Poughkeepsie, NY) were the result of serial backcrosses (N10 equivalent) of the mutation Lepr-faf (also known as Koletsky, faf, f, or cp) to the inbred rat strain, LA/N (19). Gene dosage for the faf allele was assessed by PCR-RFLP with a mutagenic primer (rLepr 14A) that introduces a DraI site into the mutant allele. The sequences of the primers were: rLepr 14A—CTGGACACTGTCACCTAATGTTT and rLepr 14B—CATGGATATAATACTTGTTAACAT. Genomic DNA (10–100ng) was amplified with the specified primers, using Taq DNA polymerase according to the manufacturer’s recommendations, for 35 cycles (94 C - 55 C - 72 C for 30 sec each). The PCR product was digested with DraI overnight and size fractionated on agarose gels. The wild-type allele is uncut (125 bp), whereas the mutant allele is digested to yield two fragments (102 bp + 23 bp). This assay readily distinguishes all three genotypes (+/+, +/faf, faf/faf). Male SD rats (mean weight, 265g) were purchased from Charles River Laboratories, Inc. (Wilmington, MA). FVB/NJ-db mice were the result of 10 backcross generations from C57BLKS/J-m db to FVB/NJ (developed by S. C. Chua, Jr.). Animals were housed on a natural light/dark cycle and had ad libitum access to water and Purina Rodent Chow 5001 except where indicated. Rats were killed by decapitation after a 30-sec exposure to CO2. All animal experiments were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and were approved by the Columbia University Institutional Animal Care and Use Committee.

Cloning of partial cDNA for rat Agrp
Total RNA from rat MBH (LA/N strain) was reverse transcribed and subjected to PCR using oligonucleotide primers from coding sequences conserved between mouse and human AGRP genes within exon 2 (5'-AGGGCATCAGAAGGCCTGACCAGG-3') and exon 3 (5'-CTTGAAGAAGCGGCAGTAGCACGT-3'). The partial rat cDNA was then subcloned into the pBluescript plasmid vector containing T3 and T7 promoters (Stratagene, San Diego, CA). One clone was selected that bore no alterations in sequence from the primary amplified cDNA. The sequence data has been submitted to GenBank, accession number AF206017. Sequence alignments were performed with the BLAST program.

Preparation of messenger RNA (mRNA)
The MBH was dissected, as described previously (20), and immediately homogenized in 1 ml cold homogenization buffer [10 mM Tris (pH 8.0), 3 mM CaCl2, 2 mM MgCl2, 0.5 mM dithiothreitol, 0.15% Triton X-100] containing 0.3 M sucrose and 50 U of human placental ribonuclease inhibitor. The homogenate was layered over 0.3 ml of homogenization buffer containing 0.4 M sucrose and centrifuged at 2,500 x g, for 10 min at 4 C, to pellet the cell nuclei. The supernatant was incubated with proteinase K and extracted twice with phenolchloroform (1:1), and the cytoplasmic RNA was precipitated with isopropanol. Total RNA was quantified by spectrophotometry.

S1 Nuclease protection assay
RNA used to generate standard curves and 32P-labeled RNA probes were synthesized using commercial transcription kits (Promega Corp., Madison, WI). Sense and antisense 175-base Agrp RNAs were synthesized from the plasmid vector containing T3 and T7 polymerase described above. Sense and antisense Pomc RNAs were synthesized from plasmid vectors containing the Sp6 promoter and a 538-bp Pomc cDNA fragment spanning part of exon 3 (obtained from M. Blum and J. L. Roberts, Mt. Sinai School of Medicine, New York, NY; Ref. 21). Sense RNAs were quantified spectrophotometrically and used to generate standard curves in the hybridization assays. Components of the hybridization reaction included: 4 µg cytoplasmic RNA in 5 µl H2O; 24.5 µl hybridization buffer containing 80% formamide, 40 mM PIPES (pH 7.4), 400 mM NaCl, 1 mM EDTA; 5 µg yeast RNA; and 32P-labeled riboprobe (22). Reaction mixtures were heated at 85 C for 5 min, then incubated for 16 h at 45 C. After hybridization, 300 µl S1 buffer [300 mM NaCl, 30 mM NaAc (pH 4.8), 3 mM ZnCl2, 20 µg/ml salmon sperm DNA] and 400–800 U S1 nuclease (Roche Molecular Biochemicals, Mannheim, Germany) were added and incubated for 1 h at 56 C. Reaction mixtures were phenol-chloroform extracted, precipitated, resuspended in 5 mM Tris (pH 7.5), 10 mM EDTA, and heated for 5 min at 68 C before electrophoresis on a 4% nondenaturing acrylamide gel. Protected bands were quantified by visualization with an autoradiogram, followed by excision of the corresponding bands from the gel and liquid scintillation counting (Packard 1500 Analyzer, Downers Grove, IL) and comparison with the standard curve. Because the protected hybrids were smaller than the cellular transcripts, 32P counts were normalized to the full-length RNA species: 0.7 kb for full-length mouse Agrp cytoplasmic RNA (6); 1.1 kb for full-length Pomc cytoplasmic RNA (23). Results are presented as pg cytoplasmic RNA/µg total RNA. The total mass of RNA isolated from the MBH of experimental and control animals was not significantly different in any experiment.

In situ hybridizations with Agrp. In situ hybridizations were performed as described by Burke et al. (24). Brains were rapidly removed and frozen by immersion in isopentane on dry ice and then serially sectioned on a cryostat through the hypothalamus at 14 µm. For hybridization, sections were fixed by immersion in 4% paraformaldehyde 0.1 M phosphate buffer (pH 7.1) for 5 min, rinsed twice in PBS, and delipidated by successive immersion in increasing concentrations of ethanol and then chloroform. Sections were rehydrated and immersed in 2 x SSC, and then prehybridized at 50 C for 2 h with 1:1 formamide/prehybridization mix, consisting of 0.6 M NaCl, 10 mM Tris (pH 7.5), 0.04% Ficoll, 0.04% polyvinylpyrrolidone, 0.2% BSA, 2 mM EDTA, 1 mg/ml salmon sperm DNA, 1 mg/ml total yeast RNA, and 0.1 mg/ml yeast transfer RNA. Sections were then hybridized with 1:1 formamide/hybridization mix at 50 C for 16–18 h. Hybridization mix was similar to prehybridization mix but contained 20% dextran, 0.2 mg/ml salmon sperm DNA, 0.1 mg/ml total yeast RNA, and 35S-labeled Agrp cRNA probe at a final activity of approximately 12,000 cpm/ml. Riboprobes were synthesized as described above, except that 35S-uridine 5'-triphosphate, rather than 32P-uridine 5'-triphosphate, was used. After hybridization, brain sections were washed by immersion in 4 liters of 2 x SSC for 60 min at 40 C, followed by treatment with 30 µg/ml RNAase for 40 min at 37 C. Sections were then washed in 4 liters of 0.1 x SSC/0.05% sodium pyrophosphate/14 mM mercaptoethanol, dehydrated in ethanol, vacuum dried, and exposed in a cassette to Amersham Pharmacia Biotech (Piscataway, NJ) Hyperfilm b-max at -80 C for 3 weeks. The specificity of the hybridization was assessed by hybridization with sense riboprobe. The autoradiograms were analyzed on a Loats Associates image analysis system with Inquiry Software. 14C standards were included in each cassette to ensure that the optical densities recorded on the film from exposure to the labeled brain sections were within the linear response range, and to enable expression of optical densities in 14C-dpm equivalents. Exposure intensities were quantified by placing a fixed circular window over the arcuate nucleus and measuring the relative optical density. Background optical density was measured by placing the window over the VMN, an area devoid of AGRP neurons (7, 25, 26).

Semiquantitative RT-PCR
cDNA synthesis was performed with 2 µg MBH RNA using ribonuclease-H-reverse transcriptase (Superscript II, Life Technologies, Inc. Rockville, MD) and an anchored oligo-dT primer (Not PA, Promega Corp.). cDNA templates, the equivalent of 20 ng total RNA, were amplified with Agrp- and Actin-specific primers (spanning at least 1 intron) and Taq DNA polymerase for 28 (Agrp) or 20 cycles (Actin) in the presence of 35S-deoxy-ATP. These conditions were previously determined to be within the linear range of amplification and will measure relative message levels. The products were size-fractionated on 4% polyacrylamide gels, dried, and exposed to x-ray film. Bands corresponding to the Agrp and Actin cDNAs were quantified with a scanning densitometer (Bio-Rad Laboratories, Inc., Hercules, CA; GS700) and QuantOne software (Bio-Rad Laboratories, Inc.).

Plasma insulin and glucose
Plasma insulin concentrations were measured with an RIA kit using mouse insulin as a standard (Sensitive Insulin RIA Kit, Linco, St. Charles, MO). Plasma glucose concentrations were measured with a Glucometer Elite (Bayer Corp., Pittsburgh, PA).

Statistical analysis
Relative chemical concentrations of mRNA are reported as mean values (pg/µg total RNA) ± SEM. For experiments using solution hybridization and in situ hybridization, significant differences between groups were determined by ANOVA, followed by the Bonferroni/Dunn all-means test when more than two groups were compared. Statistical analysis of RT-PCR was performed by the Mann-Whitney test (one-sided with significance set at P <= 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of rat Agrp partial cDNA
Oligonucleotide primers, based on coding sequences conserved between mouse and human AGRP genes within exons 2 and 3, were used to generate a single PCR product from reverse-transcribed rat hypothalamic RNA. The predicted 78-amino-acid sequence is 87% and 72%, identical to the mouse and human orthologs, respectively (Fig. 1Go). Within the amino terminus of the rat sequence, there is a 3-amino-acid deletion, compared with the mouse sequence. This region of the protein is not required for antagonism of {alpha}-MSH (6). The highly conserved cysteine-rich motif in the carboxyl terminus is maintained, with the exception of a 2-amino-acid difference and a single amino acid deletion (Fig. 1Go; shaded box).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Comparison of AGRP amino acid sequences. Asterisks, Conserved cysteine residues.

 
Agrp mRNA expression in the MBH of lean and obese LA/N-faf rats
Cytoplasmic RNA in the MBH of lean (+/+, +/faf) and obese (faf/faf) LA/N rats was quantified by solution hybridization and S1 nuclease protection assay. There was no significant difference in Agrp mRNA levels in obese rats (n = 5), compared with lean controls (n = 5): 0.46 ± 0.06 vs. 0.47 ± 0.06 pg/ug total RNA ± SEM (P = 0.9; Fig. 2Go). In these dissections, the total RNA content (12.11 ± 81 vs. 12.10 ± 41 ug,) and the absolute amount of Agrp mRNA in the MBH (5.54 ± 0.59 vs. 5.54 ± 0.62 pg) were also not significantly different in the obese rats, compared with lean controls. Because the absence of an increase in Agrp expression in the obese (faf/faf) LA/N rat was not the predicted result (levels of Agrp mRNA are increased in the MBH of mice homozygous for inactivating mutations of Lepr; Refs. 7, 27), the anatomical localization of Agrp RNA in the rat brain was analyzed by in situ hybridization using the same rat probe. Similar to the mouse, Agrp RNA expression was restricted to the arcuate nucleus (Fig. 3Go). However, in support of the results with solution hybridization, there was no significant difference in levels of Agrp expression (mean optical densities expressed in 14C-dpm equivalents and measured in the linear range) in the MBH between lean (258 ± 33; n = 4) and obese faf/faf (304 ± 40; n = 3) rats (P = 0.4). There was also no significant regional difference in Agrp RNA expression when the rostral and caudal arcuate were analyzed separately. Semiquantitative RT-PCR was performed to further confirm these results. Again, no difference in hypothalamic Agrp mRNA expression was detected between lean and obese faf/faf rats, whereas db/db mice exhibited a 3-fold increase, compared with lean controls (Fig. 4Go).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Mean Agrp cytoplasmic RNA levels (pg/µg total RNA ± SEM) from the MBH of lean (+/+, +/faf) and obese (faf/faf) LA/N rats.

 


View larger version (87K):
[in this window]
[in a new window]
 
Figure 3. In situ hybridization with antisense Agrp cRNA probe in the arcuate nucleus of lean (A) and obese (B) (faf/faf) LA/N rats.

 


View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Agrp mRNA levels in the hypothalamus of lean and obese rodents, as detected by semiquantitative RT-PCR. Actin mRNA content was determined for each sample and used for normalization. The Agrp mRNA content of each animal is expressed relative to the median Agrp mRNA content of the appropriate lean group (lean rats or lean mice), which was set to 1.00. There was no significant difference in Agrp mRNA content between lean (n = 4) and faf/faf (n = 5) rats. The difference between lean (n = 5) and db/db (n = 4) mice was significant, P < 0.008. AU, Arbitrary units.

 
Effect of food restriction on Agrp and Pomc mRNA expression in the MBH of nonobese Sprague Dawley rats
To assess physiological regulation of Agrp expression in rats, the effect of food restriction was analyzed in nonobese SD rats. After a 48-h period of food restriction, SD rats exhibited a mean 14.3% reduction in body weight, as opposed to a 6.7% body-weight gain in rats given free access to food during the same time period. There was a 273% increase in MBH Agrp mRNA in SD rats fasted for 48 h (n = 8), compared with rats fed ad libitum (n = 8): 0.82 ± 0.23 vs. 0.30 ± 0.08 pg/µg total RNA (P = 0.0001; Figs. 5Go and 6AGo). In contrast, Pomc mRNA within the same dissections was decreased by 25% in fasted vs. fed rats: 0.51 ± 0.04 vs. 0.68 ± 0.03 pg/µg total RNA (P=0.006; Fig. 6BGo).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. Autoradiogram of a gel, showing the standard curve and protected bands from MBH mRNA samples hybridized with antisense Agrp riboprobe. Lanes 1–6, Agrp standard curve (0–4 pg); lanes 7–13, cytoplasmic RNA from the MBH of Sprague Dawley rats fed ad libitum (+) or fasted for 48 h (-).

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. A, Mean Agrp mRNA levels in the MBH of fed and fasted SD rats; B, mean Pomc mRNA levels in the MBH of the same animals presented in A; *, significant difference (P < 0.05), compared with fed controls.

 
Effect of food restriction on Agrp and Pomc mRNA expression in the MBH of lean and obese LA/N-faf rats
Lean (+/+, +/faf; mean weight, 261 g) LA/N rats exhibited an 11.4 ± 0.5% body weight reduction after a 48 h fast (Table 1Go) and showed a 231% increase in Agrp mRNA expression, compared with fed controls showing a 4.1 ± 0.7% gain in body weight: 0.74 ± 0.11 vs. 0.32 ± 0.03 pg Agrp mRNA/µg total RNA (P = 0.002; Fig. 7AGo). However, there was no significant difference in Agrp mRNA levels between fasted and fed obese (faf/faf; mean weight, 350 g) LA/N rats exhibiting a 12.1 ± 0.6% decrease and a 4.7 ± 0.7% increase in body weight, respectively: 0.41 ± 0.05 vs. 0.36 ± 0.05 pg/µg total RNA (P = 0.5; Fig. 7AGo). Again, no difference was detected in Agrp expression in fed obese LA/N rats, compared with fed lean controls. After the 48-h fast, there was a significant decline in plasma insulin levels in both lean and obese rats (Table 1Go; P < 0.0001). Insulin levels were significantly higher in the fed and food-restricted obese LA/N rats, compared with their respective lean controls. Plasma glucose levels also declined after the 48-h fast in both lean and obese rats.


View this table:
[in this window]
[in a new window]
 
Table 1. Mean weight, plasma insulin and glucose levels in LA/N rats after 48 h of ad libitum feeding or food restriction

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. A, Mean Agrp mRNA levels in the MBH of lean (+/+, +/faf) and obese (faf/faf) LA/N rats fed ad libitum or fasted for 48 h; B, mean Pomc mRNA levels in the MBH of the same animals presented in A; *, significant difference (P < 0.05), compared with lean fed controls.

 
In MBH extracts from the same experiment, there was a significant decrease in Pomc mRNA levels in fed obese LA/N rats, compared with fed lean controls: 0.24 ± 0.03 vs. 0.50 ± 0.07 pg/µg total RNA (P = 0.001; Fig. 7BGo). There was also a significant decrease in Pomc mRNA levels in food-restricted lean LA/N rats, compared with lean LA/N rats fed ad libitum: 0.34 ± 0.05 vs. 0.50 ± 0.07 pg/µg total RNA (P = 0.03; Fig. 7BGo). No change, however, was detected in Pomc mRNA levels in 48-h food-restricted obese LA/N rats, compared with obese rats fed ad libitum: 0.25 ± 0.02 vs. 0.24 ± 0.03 pg/µg total RNA (P = 0.9; Fig. 7BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have demonstrated in fed obese leptin receptor-deficient (faf/faf) rats that there is no increase in hypothalamic Agrp mRNA expression, compared with lean controls, using solution hybridization, in situ hybridization, and semiquantitative RT-PCR. Furthermore, Agrp expression does not increase when the obese faf/faf animals are food restricted. These results differ markedly from those reported in fed leptin receptor-deficient (db/db) mice, which exhibit an up-regulation in Agrp mRNA expression, compared with lean controls, and a further increase in Agrp expression upon food restriction (7, 27). As in mice, however, fasting results in up-regulation of Agrp mRNA in lean LA/N and SD rats. The data in mice suggest that leptin tonically suppresses Agrp expression in the fed state, and that this suppression is released in the absence of leptin or a functional leptin receptor, or during fasting when circulating leptin levels are decreased (7, 25, 27). In addition, leptin treatment of nonmutant and ob/ob mice decreases Agrp mRNA (25, 27). In the faf/faf rat, however, unlike the db/db mouse, leptin receptor deficiency alone does not lead to an increase in Agrp gene expression, compared with lean (+/+, +/faf) controls, and Agrp expression does not increase with fasting in faf/faf animals. There also does not seem to be a difference in Agrp mRNA expression between lean homozygote (+/+) or heterozygote (+/faf) animals. However, the number of animals in these experiments may have been too small to detect a subtle gene-dosage effect.

Because the faf mutation is a null variant (28), it is unlikely that the lack of an increase in basal Agrp expression in faf/faf animals is caused by suppression from partial leptin activity at the mutant rat leptin receptor, as might be the case with the Leprfa mutation (though we did not examine this possibility). Thus, in the rat, the normal Agrp response to fasting may involve leptin receptor-mediated phenomena, but factors in addition to the leptin-leptin receptor axis must also be important for the regulation of Agrp gene expression. If leptin were the sole regulator of Agrp expression, then levels of Agrp mRNA would be increased in the hypothalamus of fed leptin receptor-deficient rats. It has also been shown that factors other than leptin-leptin receptor are involved in the regulation of hypothalamic Agrp gene expression in mice: in db/db mice, Agrp gene expression is further increased upon fasting, although the animals are leptin insensitive (27); and in streptozotocin-induced diabetic mice, fasting stimulates hypothalamic Agrp mRNA, whereas plasma leptin levels remain unchanged (29).

So important to survival is the drive to eat, that there likely exist redundant mechanisms to ensure that this drive is maintained. Orexigenic factors other than AGRP, such as neuropeptide Y (NPY), which is coexpressed with AGRP in the same neurons of the medial arcuate nucleus (30), may contribute to the obesity syndrome in the faf rat. In fact, NPY peptide levels are significantly increased in the arcuate nucleus of ad libitum fed obese faf/faf rats compared with lean controls (31). Intracerebroventricular administration of insulin suppresses the fasting-induced increase in NPY gene expression in the arcuate nucleus of lean, but not obese, Zucker (fa/fa) rats (32). Obese faf/faf rats are hyperinsulinemic (see Results and Refs. 33, 34) and also have increased plasma concentrations of corticosterone (16). The effects of insulin and corticosterone on Agrp expression are unknown, but elevated levels of these hormones may have different effects on Agrp expression in faf/faf rats, compared with db/db mice. Species differences in gene regulation, presumably caused by differences in the function of regulatory elements, are known to occur in other physiological circumstances. For example, mice show a 20-fold increase in circulating leptin in late stages of pregnancy, whereas rats and humans only show a modest 2-fold increase (35).

In the rat, as in the mouse, AGRP probably provides a tonic orexigenic signal by antagonizing MC3R and MC4R. However, there is a noteworthy difference between the mouse and rat amino sequence in the highly conserved cysteine-rich C-terminal domain of the AGRP and ASP proteins. The Cys-110 to Cys-117 octapeptide loop of human AGRP mimics the conformation of {alpha}-MSH, and is critical in mediating its antagonism of {alpha}-MSH action (36). There is 100% homology of amino acid sequence in this region between mouse, human, and bovine AGRP, but two conservative substitutions and one amino acid deletion are detected in the rat sequence (Fig. 1Go). These changes may have functional significance, although the rat sequence does maintain the RFF111–113 triplet presumably most critical in determining the binding affinity of AGRP to the melanocortin receptors (36). The deletion of several amino acids in the N-terminal of rat AGRP (Fig. 1Go) probably does not have functional significance, because this portion of the protein is not required for antagonism of {alpha}-MSH (6, 37). The differences in the rat AGRP sequence are authentic, given that only a single PCR product was obtained from total RNA of rat MBH. Also, genomic clones were obtained that corresponded to the cDNA, with intron/exon junctions observed in both mice and humans (data not shown).

In the same experiments, we also quantified the levels of hypothalamic Pomc mRNA and showed that its expression is decreased in ad libitum fed obese faf/faf rats, compared with lean controls, and in food-restricted lean LA/N and SD rats, compared with fed controls. We have previously shown that levels of the anorexigenic peptide, {alpha}-MSH, are also decreased in the hypothalamus of obese faf/faf rats (16). Because both POMC and AGRP fiber tracts project to the same brain regions, it is likely that some of the biological effects of leptin depend on the competitive interactions of {alpha}-MSH with AGRP at the same melanocortin receptors (26, 38). Although Agrp mRNA levels are not changed in the fed obese faf/faf rats, compared with fed lean LA/N controls, the ratio of Pomc to Agrp mRNA is decreased by 57%. It would, therefore, be of interest to also measure hypothalamic AGRP peptide levels in these animals, because the peptide ratio of {alpha}-MSH to AGRP may be an important modulator of food intake.


    Acknowledgments
 
We would like to thank Dr. Gregory S. Barsh for helpful discussions, and Ritu Baral for excellent technical assistance.


    Footnotes
 
1 This work has been supported by NIH [Grants T-32-DK-07271 (to J.K.), DA-07732 (to S.W.), and DK-52431 (to R.L.)], The New York Obesity Research Center [DK26687 (to J.K, R.L., and S.C.)], and The Endocrine Fellows Foundation Grant (to J.K.). Back

Received December 1, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mountjoy KG, Mortrud MT, Low MJ, Simerly RB, Cone RD 1994 Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic control circuits in the brain. Mol Endocrinol 8:1298–1308[Abstract]
  2. Fan W, Boston BA, Kesterson RA, Hruby VJ, Cone RD 1997 Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature 385:165–168[CrossRef][Medline]
  3. Lu D, Willard D, Patel IR, Kadwell S, Overton L, Kost T, Luther M, Chen W, Woychik RP, Wilkinson WO, Cone RD 1994 Agouti protein is an antagonist of the melanocyte-stimulating-hormone receptor. Nature 371:799–802[CrossRef][Medline]
  4. Manne J, Argeson AC, Siracusa LD 1995 Mechanisms for the pleiotropic effects of the agouti gene. Proc Natl Acad Sci USA 92:4721–4724[Free Full Text]
  5. Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q, Berkemeier LR, Gu W, Kesterson RA, Boston BA, Cone RD, Smith FJ, Campfield LA, Burn P, Lee F 1997 Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88:131–141[CrossRef][Medline]
  6. Ollmann MM, Wilson BD, Yang Y-K, Kerns JA, Chen Y, Gantz I, Barsh GS 1997 Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278:135–138[Abstract/Free Full Text]
  7. Shutter JR, Graham M, Kinsey AC, Scully S, Lüthy R, Stark KL 1997 Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice. Genes Dev 11:593–602[Abstract/Free Full Text]
  8. Graham M, Shutter JR, Sarmiento U, Sarosi I, Stark KL 1997 Overexpression of agrt leads to obesity in transgenic mice. Nat Genet 17:273–274[CrossRef][Medline]
  9. Fong TM, Mao C, MacNeil T, Kalyani R, Smith T, Weinberg D, Tota MR, Van der Ploeg LHT 1997 ART (protein product of agouti-related transcript) as an antagonist of MC-3 and MC-4 receptors. Biochem Biophys Res Commun 237:629–631[CrossRef][Medline]
  10. Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn P, Baskin DG 1997 Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46:2119–2123[Abstract]
  11. Thornton JE, Cheung CC, Clifton DK, Steiner RA 1997 Regulation of hypothalamic proopiomelanocortin mRNA by leptin in ob/ob mice. Endocrinology 138:5063–5066[Abstract/Free Full Text]
  12. Mizuno TM, Kleopoulos SP, Bergen HT, Roberts JL, Priest CA, Mobbs CV 1998 Hypothalamic pro-opiomelanocortin mRNA is reduced by fasting in ob/ob and db/db mice, but is stimulated by leptin. Diabetes 47:294–297[Abstract]
  13. Brady LS, Smith MA, Gold PW, Herkenham M 1990 Altered expression of hypothalamic neuropeptide mRNAs in food-restricted and food-deprived rats. Neuroendocrinology 52:441–447[Medline]
  14. Bergendahl M, Wiemann JN, Clifton DK, Huhtaniemi I, Steiner RA 1992 Short-term starvation decreases Pomc mRNA but does not alter GnRH mRNA in the brain of adult male rats. Neuroendocrinology 56:913–920[Medline]
  15. Kim E-M, Welch CC, Grace MK, Billington CJ, Levine AS 1996 Chronic food restriction and acute food deprivation decrease mRNA levels of opioid peptides in arcuate nucleus. Am J Physiol 270:R1019–R1024
  16. Korner J, Chua Jr SC, Williams JA, Leibel RL, Wardlaw SL 1999 Regulation of hypothalamic proopiomelanocortin by leptin in lean and obese rats. Neuroendocrinology 70:377–383[CrossRef][Medline]
  17. Koletsky S 1973 Obese spontaneous hypertensive rats: a model for the study of atherosclerosis. Exp Mol Pathol 19:53–60[CrossRef][Medline]
  18. Takaya K, Ogawa Y, Hiraoka J, Hosoda K, Yamori Y, Nakao K, Koletsky RJ 1996 Nonsense mutation of leptin receptor in the obese spontaneously hypertensive koletsky rat. Nat Genet 14:130–131[CrossRef][Medline]
  19. Wu-Peng XS, Chua Jr SC, Okada N, Liu S-M, Nicolson M, Leibel RL 1997 Phenotype of the obese koletsky (f) rat due to Tyr763Stop mutation in the extracellular domain of the leptin receptor (Lepr). Diabetes 46:513–518[Abstract]
  20. Wardlaw SL, McCarthy KC, Conwell IM 1998 Glucocorticoid regulation of hypothalamic proopiomelanocortin. Neuroendocrinology 67:51–57[CrossRef][Medline]
  21. Blum M, Roberts JL, Wardlaw SL 1989 Androgen regulation of proopiomelanocortin gene expression and peptide content in the basal hypothalamus. Endocrinology 124:2283–2288[Abstract]
  22. Scarbrough K, Jakubowski M, Levin N, Wise PM, Roberts JL 1994 The effect of time of day on levels of hypothalamic proopiomelanocortin primary transcript, processing intermediate and messenger ribonucleic acid in proestrous and estrous rats. Endocrinology 134:555–565[Abstract]
  23. Autelitano DJ, Blum M, Lopingco M, Allen RG, Roberts JL 1990 Corticotropin-releasing factor differentially regulates anterior and intermediate pituitary lobe proopiomelanocortin gene transcription, nuclear precursor RNA and mature mRNA in vivo. Neuroendocrinology 51:123–130[Medline]
  24. Burke RE, Franklin SO, Inturrisi CE 1994 Acute and persistent suppression of preproenkephalin mRNA expression in the striatum following developmental hypoxic-ischemic injury. J Neurochem 62:1878–1886[Medline]
  25. Wilson BD, Bagnol D, Kaelin CB, Ollmann MM, Gantz I, Watson SJ, Barsh GS 1999 Physiologic and anatomic circuitry between Agouti-related protein and leptin signaling. Endocrinology 140:2387–2397[Abstract/Free Full Text]
  26. Haskell-Luevano C, Chen P, Chien L, Chang K, Smith MS, Cameron JL, Cone RD 1999 Characterization of the neuroanatomical distribution of agouti-related protein immunoreactivity in the rhesus monkey and the rat. Endocrinology 140:1408–1415[Abstract/Free Full Text]
  27. Mizuno TM, Mobbs CV 1999 Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140:814–817[Abstract/Free Full Text]
  28. Zhang YY, Leibel RL 1998 Molecular physiology of leptin and its receptor. Growth: Genet Horm 14:17–26
  29. Mizuno TM, Makimura H, Silverstein J, Roberts JL, Lopingco T, Mobbs CV 1999 Fasting regulates hypothalamic neuropeptide Y, agouti-related peptide, and proopiomelanocortin in diabetic mice independent of changes in leptin or insulin. Endocrinology 140:4551–4557[Abstract/Free Full Text]
  30. Hahn TM, Breininger JF, Baskin DG, Schwartz MW 1998 Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci 1:271–272[CrossRef][Medline]
  31. Williams G, Shellard L, Lewis DE, McKibbin PE, McCarthy HD, Koeslag DG, Russell JC 1992 Hypothalamic neuropeptide Y disturbances in the obese (cp/cp) JCR:LA corpulent rat. Peptides 13:537–540[CrossRef][Medline]
  32. Schwartz MW, Marks JL, Sipols AJ, Baskin DG, Woods SC, Kahn SE, Porte D 1991 Central insulin administration reduces neuropeptide Y mRNA expression in the arcuate nucleus of food-deprived lean (Fa/Fa) but not obese (fa/fa) Zucker rats. Endocrinology 128:2645–2647[Abstract]
  33. Michaelis OE, Ellwood KC, Hallfrisch J, Hansen CT 1983 Effect of dietary sucrose and genotype on metabolic parameters of a new strain of genetically obese rat: LA/N-corpulent. Nutrition Res 3:217–228[CrossRef]
  34. Ellwood KC, Michaelis IV OE, Emberland JJ, Bhathena SJ 1985 Hormonal and lipogenic and gluconeogenic enzymatic responses in LA/N-corpulent rats (42079). Proc Soc Exp Biol Med 179:163–167[Abstract]
  35. Gavrilova O, Barr Valarie, Marcus-Samuels B, Reitman M 1997 Hyperleptinemia of pregnancy associated with the appearance of a circulating form of the leptin receptor. J Biol Chem 272:30546–30551[Abstract/Free Full Text]
  36. Tota MR, Smith TS, Mao C, MacNeil T, Mosley RT, Van der Ploeg LHT, Fong TM 1999 Molecular interaction of Agouti and Agouti-related protein with human melanocortin receptors. Biochemistry 38:897–904[CrossRef][Medline]
  37. Rosenfeld RD, Zeni L, Welcher AA, Narhi LO, Hale C, Marasco J, Delaney J, Gleason T, Philo JS, Katta V, Hui J, Baumgartner J, Graham M, Stark KL, Karbon W 1998 Biochemical, biophysical, and pharmacological characterization of bacterially expressed human Agouti-related protein. Biochemistry 37:16041–16052[CrossRef][Medline]
  38. Broberger C, Johansen J, Johansson C, Schalling M, Hökfelt T 1998 The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proc Natl Acad Sci USA 95:15043–15048[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
DiabetesHome page
V. Tolle and M. J. Low
In Vivo Evidence for Inverse Agonism of Agouti-Related Peptide in the Central Nervous System of Proopiomelanocortin-Deficient Mice
Diabetes, January 1, 2008; 57(1): 86 - 94.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Goto, H. Arima, M. Watanabe, M. Hayashi, R. Banno, I. Sato, H. Nagasaki, and Y. Oiso
Ghrelin Increases Neuropeptide Y and Agouti-Related Peptide Gene Expression in the Arcuate Nucleus in Rat Hypothalamic Organotypic Cultures
Endocrinology, November 1, 2006; 147(11): 5102 - 5109.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. D. Morrison, G. J. Morton, K. D. Niswender, R. W. Gelling, and M. W. Schwartz
Leptin inhibits hypothalamic Npy and Agrp gene expression via a mechanism that requires phosphatidylinositol 3-OH-kinase signaling
Am J Physiol Endocrinol Metab, December 1, 2005; 289(6): E1051 - E1057.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R G P Denis, C Bing, S Brocklehurst, J A Harrold, R G Vernon, and G Williams
Diurnal changes in hypothalamic neuropeptide and SOCS-3 expression: effects of lactation and relationship with serum leptin and food intake
J. Endocrinol., October 1, 2004; 183(1): 173 - 181.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. Baran, E. Preston, D. Wilks, G. J. Cooney, E. W. Kraegen, and A. Sainsbury
Chronic Central Melanocortin-4 Receptor Antagonism and Central Neuropeptide-Y Infusion in Rats Produce Increased Adiposity by Divergent Pathways
Diabetes, January 1, 2002; 51(1): 152 - 158.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. J. Hwa, L. Ghibaudi, J. Gao, and E. M. Parker
Central melanocortin system modulates energy intake and expenditure of obese and lean Zucker rats
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2001; 281(2): R444 - R451.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Fekete, J. Kelly, E. Mihaly, S. Sarkar, W. M. Rand, G. Legradi, C. H. Emerson, and R. M. Lechan
Neuropeptide Y Has a Central Inhibitory Action on the Hypothalamic-Pituitary-Thyroid Axis
Endocrinology, June 1, 2001; 142(6): 2606 - 2613.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korner, J.
Right arrow Articles by Chua, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korner, J.
Right arrow Articles by Chua, S. C., Jr.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals