help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Valladares, A.
Right arrow Articles by Porras, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Valladares, A.
Right arrow Articles by Porras, A.
Endocrinology Vol. 141, No. 12 4383-4395
Copyright © 2000 by The Endocrine Society


ARTICLES

p38 Mitogen-Activated Protein Kinase Mediates Tumor Necrosis Factor-{alpha}-Induced Apoptosis in Rat Fetal Brown Adipocytes1

Amparo Valladares2, Alberto M. Álvarez, Juan José Ventura2, Cesar Roncero, Manuel Benito and Almudena Porras

Departamento de Bioquímica y Biología Molecular II, Instituto de Bioquímica, Centro Mixto del Consejo Superior de Investigaciones Científicas y de la Universidad Complutense de Madrid (A.V., J.J.V., C.R., M.B., A.P.); Centro de Citometría de Flujo y Microscopía Confocal, Universidad Complutense de Madrid (A.M.A.); Facultad de Farmacia, Universidad Complutense, Ciudad Universitaria, 28040 Madrid, Spain

Address all correspondence and requests for reprints to: Dr. Almudena Porras, Departamento de Bioquímica y Biología Molecular II, Instituto de Bioquímica, Centro Mixto del Consejo Superior de Investigaciones Científicas y de la Universidad Complutense de Madrid, Facultad de Farmacia, 28040 Madrid, Spain.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor necrosis factor-{alpha} (TNF{alpha}) induces apoptosis and cell growth inhibition in primary rat fetal brown adipocytes. Here, we examine the role played by some members of the mitogen-activated protein kinase (MAPK) superfamily. TNF{alpha} activates extracellular regulated kinase-1/2 (ERK1/2) and p38MAPK. Inhibition of p38MAPK by either SB203580 or SB202190 highly reduces apoptosis induced by TNF{alpha}, whereas ERK inhibition potentiates it. Moreover, cotransfection of an active MKK3 mutant and p38MAPK induces apoptosis. p38MAPK inhibition also prevents TNF{alpha}-induced cell cycle arrest, whereas MEK1 inhibition enhances this effect, which correlates with changes in proliferating cell nuclear antigen expression, but not in cyclin D1.

c-Jun and activating transcription factor-1 are potential downstream effectors of p38MAPK and ERKs upon TNF{alpha} treatment. Thus, TNF{alpha}-induced c-Jun messenger RNA expression requires ERKs activation, whereas p38MAPK inhibition enhances its expression. In addition, TNF{alpha}-induced activating transcription factor-1 phosphorylation is extensively decreased by SB203580. However, TNF{alpha}- induced NF-{kappa}B DNA-binding activity is independent of p38MAPK and ERK activation. On the other hand, C/EBP homology protein does not appear to mediate the actions of TNF{alpha}, because its expression is almost undetectable and even reduced by TNF{alpha}.

Finally, although TNF{alpha} induces c-Jun N-terminal kinase (JNK) activation, transfection of a dominant negative of either JNK1 or JNK2 had no effect on TNF{alpha}-induced apoptosis. These results suggest that p38MAPK mediates TNF{alpha}-induced apoptosis and cell cycle arrest, whereas ERKs do the opposite, and JNKs play no role in this process of apoptosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BROWN ADIPOSE tissue (BAT) is specialized in heat production by the mechanism called nonshivering thermogenesis that is carried out mainly by the uncoupling protein-1 (UCP-1) (1). BAT is active under some circumstances, such as in the perinatal period (1). Rat fetal brown adipocytes already express UCP-1, and this expression continues after birth (2). Among the different positive regulators of BAT, noradrenaline (3) and T3 (4, 5) are inducers of UCP-1 expression, and insulin-like growth factor I (IGF-I) and insulin are involved in proliferation and differentiation (6, 7). However, little is known about the negative regulators of BAT and the signals involved in the involution of this tissue.

Tumor necrosis factor-{alpha} (TNF{alpha}) may play an important role as a negative regulator of this tissue by different mechanisms. TNF{alpha} inhibits differentiation (7) in these cells as it does in white adipocytes and in some cell lines, such as 3T3-L1 cells, that can be induced to differentiate into adipocytes (8, 9). TNF{alpha} can also induce reversal of adipocytic differentiation (8). Additionally, we have demonstrated that TNF{alpha} inhibits cell growth and induces apoptosis in primary rat fetal brown adipocytes (10). In mature brown adipocytes, TNF{alpha} (in the presence of cycloheximide) also induces a process of apoptosis and the number of apoptotic cells is greater in obese animals than in lean rats (11). Therefore, by this mechanism, TNF{alpha} might play a relevant role in the control of the number of brown adipocytes during the perinatal period and/or in obese animals. A similar regulation might take place in white adipocytes, where TNF{alpha} is also able to induce apoptosis (12). However, the signaling pathways mediating these TNF{alpha} actions are not known.

TNF{alpha} activates different signaling pathways in different cell types, such as extracellular regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), p38 mitogen-activated protein kinases (p38MAPKs), nuclear factor-{kappa}B (NF-{kappa}B), and caspases (13, 14, 15, 16). ERKs are activated by many signals (15, 16), particularly by mitogens, and their activation is necessary for proliferation (17, 18, 19) or differentiation (18, 20), depending on the cell type, and could also play a role in survival (21). p38MAPK and JNKs are mainly activated by proinflammatory cytokines such as TNF{alpha} and cellular stresses (22, 23, 24) in different cell types, although recently p38MAPK has been demonstrated to play a role in a number of cellular functions, such as differentiation, cell motility, developmental processes, and survival. p38MAPK was identified as a kinase induced by stress signals (25), and it is now referred to as p38{alpha}MAPK or p38MAPK. Other isoforms have been described that belong to the p38 subfamily of MAPKs, constituted by different members: p38{alpha}, p38ß, p38{gamma} (ERK6/stress-activated protein kinase 3), and p38{delta} (reviewed in Ref. 24).Among these different members, p38{alpha}MAPK has been more widely characterized as have their different cellular effects. p38MAPKs have been implicated both as positive (21, 26, 27, 28) and negative (29, 30) regulators of apoptosis. They have also been reported to be involved in cell growth regulation (31, 32). On the other hand, the involvement of JNKs in TNF{alpha}-induced apoptosis or even in apoptosis induced by other stimuli has been controversial (21, 26, 33, 34, 35).

In this work we have analyzed the roles played by p38MAPK and ERKs in TNF{alpha}-induced apoptosis and cell cycle arrest in rat fetal brown adipocytes. We present here evidence that p38MAPK is activated by TNF{alpha} and is involved in TNF{alpha}-induced apoptosis and cell growth inhibition. In contrast, ERKs, which are also activated by TNF{alpha}, mediate cell growth and survival and, as a consequence, attenuate the effects of TNF{alpha}. As inhibition of p38MAPK did not block TNF{alpha}-induced apoptosis in all the cells, the participation of JNK in this process was also explored, but no role was found.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of fetal brown adipocytes and culture
Fetal brown adipocytes from 20-day-old rat fetuses were isolated as previously described (10, 17) and maintained in primary culture. Cells were grown in MEM supplemented with 10% FBS for 24 h. Then, cells were serum starved overnight and maintained in the absence or presence of TNF{alpha} (1–10 ng/ml), IGF-I (2.5 nM), insulin (20 nM), or combinations thereof for different time periods as indicated. To inhibit ERKs, cells were pretreated with the MEK1 inhibitor PD98059 (no. 513000, Calbiochem, La Jolla, CA) at concentrations between 5–50 µM for 1 h before the addition of signals. Similarly, to inhibit p38MAPK, cells were pretreated either with the specific inhibitor SB203580 (1–5 µM; SmithKline Beecham, Harlow, UK) or with SB202190 (2 µM; no. 559388, Calbiochem).

Culture of MB4.8.2 brown adipocyte derived cell line and transfection assays
The MB 4.8.2 brown adipocyte-derived cell line was grown in DMEM supplemented with 10% FBS. To determine apoptosis, cells were maintained in DMEM with 3% FBS and in the presence or absence of TNF{alpha} (10 ng/ml) for 48 h. To measure JNK activity, cells were serum starved overnight and then triggered with TNF{alpha} for 10 min.

Transient transfections were carried out using the Gene PORTER transfection reagent from Gene Therapy Systems (catalog no. T201007, San Diego, CA) following the protocol supplied by the manufacturer. Cells were transfected with an active MKK3 mutant (MKK3DD) plus a p38MAPK wild-type construct and with different JNKs constructs: JNK1 wild-type, JNK2 wild-type, and a dominant negative of JNK1 (JNK1APF) and JNK2 (JNK1APF) (36), subcloned in a green fluorescent protein (GFP) expression vector from CLONTECH Laboratories, Inc. (Palo Alto, CA).

Transfection efficiencies ranged between 50–70%, as determined by the ß-galactosidase histochemical staining assay or by quantification of GFP expression by cytometry and fluorescent microscopy.

Flow cytometric analysis
Analysis of DNA content, cell cycle, and proliferating cell nuclear antigen (PCNA) content of the cells in the different phases of the cell cycle was performed in a FACScan flow cytometer (Becton Dickinson and Co., San Jose, CA). DNA was stained with propidium iodide (PI) using the Bio-Rad Laboratories, Inc. reagent kit (Kinesis 50, 470-0023, Richmond, CA), following the manufacturer’s protocol. When PCNA content was analyzed in parallel to the cellular DNA content, the Bio-Rad Laboratories, Inc., reagent kit containing PI and an anti-PCNA antibody (PCNA/Kinesis 50, 470-0043) was used. Measurements were carried out using a Double Discriminator Module to discriminate doublets. Ten thousand cells were acquired per sample. Then, the percentage of cells with DNA content lower than 2C was calculated as well as the percentage of cells in the G0/G1, S, and G2/M phases of the cell cycle, using Multicycle software (Phoenix Software, Mountain View, CA). When PCNA and cellular DNA contents were simultaneously analyzed, the percentage of cells expressing PCNA with different DNA contents was also calculated using CellQuest software (Becton Dickinson and Co., Mountain View, CA).

The presence of phosphatidylserine in the outer layer of the plasma membrane (an early feature of apoptosis) was detected by specific binding to annexin V using the annexin V-Fluos kit from Roche Molecular Biochemicals (catalog no. 1828681, Indianapolis, IN). Cells were incubated with PI and/or annexin V and analyzed by flow cytometry. The percentage of cells positive for annexin V and negative or low positive for PI, considered apoptotic, and the percentage of those positive for annexin V and PI, considered necrotic, were determined.

Analysis of DNA fragmentation
DNA from the extranuclear fraction was isolated as previously described (10). Then DNA was electrophoresed in a 1.5% agarose gel.

Western blot analysis
Total cell extracts were obtained in a buffer containing 25 mM HEPES (pH 7.5), 0.3 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 0.5 mM dithiothreitol, 20 mM ß-glycerophosphate, 1 mM Na3VO4, leupeptin (2 µg/ml), and 1 mM phenylmethylsulfonylfluoride.

Active ERK (ERK1/2) levels were quantified in total cell extracts by Western blot analysis using an antiphospho-ERKs antibody from Promega Corp. (V6671, Madison, WI). After stripping of the membranes, total ERK levels were quantified by subsequent incubation with the anti-ERK1/2 antibody from Upstate Biotechnology, Inc. (06–182, Lake Placid, NY) as previously described (17, 37). Similarly, active p38MAPK was quantified in total cell extracts using an antiphopho-p38MAPK antibody from New England Biolabs, Inc. (no. 9211S, Beverley, MA), and total p38MAPK levels were quantified using an anti-p38MAPK{alpha} antibody from Santa Cruz Biotechnologies, Inc. (sc-535, Santa Cruz, CA).

PCNA, cyclin D1, CHOP (C/EBP homology protein) (GADD153), and phospho-cAMP response element-binding protein (phospho-CREB)/activating transcription factor-1 (ATF1) were also quantified in total cell extracts by Western blot analysis, using the following antibodies: a monoclonal anti-PCNA antibody from Roche (1486772), an antihuman cyclin D1 from PharMingen (66271A, San Diego, CA), a polyclonal anti-GADD153 from Santa Cruz Biotechnologies, Inc. (sc-793), and a phospho-CREB (Ser133) antibody from New England Biolabs, Inc. (9191S).

Blots were developed using the ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL). Autoradiograms were quantified using computer-assisted densitometry (Molecular Dynamics, Inc., Sunny- vale, CA).

MAPKAPK2 kinase assay
To measure MAPKAPK2 kinase activity, cell lysates were obtained as described for phospho-p38MAPK Western blot analysis. Then, they were immunoprecipitated with an anti-MAPKAPK2 antibody from StressGen Biotechnologies Corp. (Victoria, British Columbia, Canada) (KAP-MA015E). Immunoprecipitates were washed twice with the lysis buffer and twice with a kinase buffer containing 25 mM HEPES (pH 7.4), 25 mM MgCl2, 25 mM ß-glycerophosphate, 100 µM sodium orthovanadate, and 2 mM dithiothreitol. Then, samples were incubated at 30 C for 30 min with the kinase buffer containing 100 µM cold ATP, 10 µCi [{gamma}-32P]ATP, and 2 µg/assay of human recombinant 27-kDa heat shock protein (Hsp27) protein (StressGen Biotechnologies Corp., SPP-715) as substrate. The reaction was stopped by adding Laemmli sample buffer. Phosphorylated Hsp27 was visualized by autoradiography after electrophoresis on 12% SDS-polyacrylamide gels.

[3H]Thymidine incorporation assay
Cells were triggered for 4 h with IGF-I, insulin, TNF{alpha}, or combinations thereof in the presence or absence of the MEK or p38MAPK inhibitors as indicated and then incubated for 24 h with a mix of [3H]thymidine and cold thymidine at final concentrations of 1 µCi and 20 µM, respectively. Radioactivity present in trichloroacetic acid-insoluble material was quantitated in a ß-counter.

JNK assay
JNK activity was determined in cell lysates, obtained as described for Western blot analysis. A pull-down of JNKs was performed with glutathione-S-transferase (GST)-c-Jun 79 protein (containing the first 79 amino acids fused to GST) provided by Dr. Silvio Gutkind. Then, protein complexes were washed 3 times with PBS containing 1% Nonidet P-40 and 2 mM sodium vanadate, once with 100 mM Tris (pH 7.5) and 0.5 M LiCl, and once with the kinase buffer [12.5 mM 4-morpholine-propanesulfonic acid (pH 7.5), 12.5 mM ß-glycerophosphate, 7.5 mM MgCl2, 0.5 mM EGTA, 0.5 mM NaF, and 0.5 mM sodium vanadate]. The kinase assay was carried out in this kinase buffer containing 0.3 µCi [{gamma}-32P]ATP and 20 µM cold ATP. The reaction was stopped by adding Laemmli sample buffer. Phosphorylated c-Jun was visualized by autoradiography after electrophoresis on 10% SDS-polyacrylamide gels.

RNA extraction and Northern blot analysis
Northern blot analysis and total RNA extraction were performed as previously described (17). Blots were hybridized with a c-Jun probe given by Dr. M. Yaniv, then stripped and rehybridized with an 18S ribosomal probe to normalize. Radioactivity was quantitated in a Fuji Photo Film Co., Ltd. BAS-1000 apparatus (Tokyo, Japan).

NF-{kappa}B gel mobility shift assay
Nuclear extracts were obtained essentially as described previously (38). Then, these extracts were used for the NF-{kappa}B mobility shift assay, which was performed as previously described (38), using the double stranded oligonucleotide corresponding to the {kappa}B distal motif present in the murine iNOS promoter: TGCTAGGGGGATTTTCCCTCTCT CTGT.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TNF{alpha} activates ERKs
First, we studied ERK activity in cells treated with different doses of TNF{alpha} (0.5–20 ng/ml) for 10 min. The levels of active ERKs, analyzed by phospho-MAPK Western blot, increased after TNF{alpha} treatment, reaching a maximum with 10 ng/ml (Fig. 1AGo).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Dose response and time course of induction of ERK activity by TNF{alpha}; inhibition by the MEK1 inhibitor, PD98059. Amount of active ERK1/2 in total lysates from rat fetal brown adipocytes. Serum-starved cells were maintained untreated or were triggered with either different TNF{alpha} concentrations (0.5–20 ng/ml) for 10 min (A) or 10 ng/ml TNF{alpha} for 10 min (C) or other time periods (B). When indicated, cells were pretreated with PD98059 (5–50 µM) for 1 h. A, Dose response of ERKs activity. B, Time course of ERK activity. C, Inhibition of ERKs by PD98059. Upper and middle panels, Representative phospho-ERK1/2 and total ERK1/2 Western blots, respectively. Lower panels, Relative values of normalized phospho-ERK levels, determined by the ratio between phospho-ERK and total ERK levels and expressed as the fold increase. Results are the mean ± SEM of three different experiments. Statistical analysis was carried out by Student’s t test. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (vs. control cells).

 
A complete time course was carried out as well. The levels of active ERKs increased after 5 min of treatment with TNF{alpha} (10 ng/ml) and reached a peak at 10 min (Fig. 1BGo). Then, ERKs activity decreased after 30 min.

This TNF{alpha}-induced increase in ERK activity was completely blocked by pretreatment with the specific MEK1 inhibitor, PD98059, using a dose of 5–50 µM (Fig. 1CGo). Hence, we chose a dose of 20 µM PD98059 to study the role of ERKs in the TNF{alpha} actions, which inhibited ERKs and had no effect on the activity of other kinases, such as JNKs or p38MAPK (data not shown) in our cell system.

TNF{alpha} activates p38MAPK
p38MAPK can be activated by proinflammatory cytokines such as TNF{alpha} (23, 24, 25) in different cell types. Hence, we analyzed the levels of active p38MAPK in brown adipocytes upon treatment with TNF{alpha} by Western blot, using an anti-phospho-p38MAPK antibody.

As shown in Fig. 2AGo, after 5 min of treatment with a dose of TNF{alpha} as low as 1 ng/ml, p38MAPK was activated, reaching a maximum with 5–20 ng/ml. Thus, 10 ng/ml TNF{alpha} would be an optimal dose for our experiments, taking into account that maximum activation of p38MAPK and ERKs was obtained with this dose.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Dose response and time course of induction of p38MAPK activity by TNF{alpha}; inhibition of p38MAPK cascade by SB203580. The amount of active p38MAPK in total cell lysates from rat fetal brown adipocytes is shown. Serum-starved cells were maintained untreated or were triggered with different TNF{alpha} concentrations (0.5–20 ng/ml) for 5 min (A) or with 10 ng/ml TNF{alpha} for 5 min (C) or other time periods (B). When indicated, cells were pretreated with 1–5 µM SB203580. A, Dose response of p38MAPK activation. B, Time course of p38MAPK activation. Upper and middle panels, Representative phospho-p38MAPK and total p38MAPK Western blots, respectively. Lower panels, Relative values of normalized phospho-p38MAPK levels, determined by the ratio between phospho-p38MAPK and total p38MAPK levels, expressed as the fold increase. C, MAPKAPK-2 activity in immunoprecipitates. Upper panel, Representative autoradiogram showing phospho-Hsp27 after electrophoresis of the samples on 12% SDS-polyacrylamide gels. Lower panel, Relative values of phosphorylated Hsp27 after kinase assays, quantified using a Fuji Photo Film Co. Ltd. BAS-1000 apparatus, and expressed as the fold increase. Values are the mean ± SEM of three different experiments. Statistical analysis was carried out by Student’s t test. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (vs. control cells).

 
A complete time course of activation by TNF{alpha} was also performed. p38MAPK was activated very quickly, reaching a maximum at 5 min that was maintained until 10 min and decreasing thereafter (Fig. 2BGo).

To study the role played by p38MAPK in TNF{alpha} treatment of brown adipocytes, this pathway could be inhibited with the specific p38MAPK inhibitor, SB203580. This inhibitor is specific for the {alpha} isoform at low doses, but at higher doses it also inhibits p38ß. It acts by competition with ATP (39); therefore, to detect p38MAPK inhibition, it is necessary to look for inhibition of downstream targets such as MAPKAPK2 (25). Treatment of the cells with TNF{alpha} for 5 min activated MAPKAPK2, and this activation was completely blocked when cells were previously pretreated with doses of 2–5 µM SB203580 (Fig. 2CGo) or 2 µM SB202190 (data not shown). Thus, to analyze the effect of p38MAPK cascade inhibition on TNF{alpha}-induced apoptosis and cell growth arrest, we used 5 µM SB203580 (and 2 µM SB202190 to confirm apoptosis data). With this dose of inhibitor, the TNF{alpha}- induced p38MAPK cascade was specifically blocked; other MAPK pathways, such as ERKs and JNKs, were not affected (data not shown).

Roles of p38MAPK and ERKs in cell growth inhibition induced by TNF{alpha}
As ERKs and p38MAPK can regulate the cell cycle, we analyzed their roles in TNF{alpha}-induced cell cycle arrest in brown adipocytes using the p38MAPK inhibitor, SB203580, and the MEK1, PD98059. To do this, flow cytometric analysis of the cell cycle was performed (Fig. 3AGo). Treatment of brown adipocytes with TNF{alpha} for 24 h induced a significant decrease in the percentage of cells in the proliferative phases of the cell cycle compared with that in control cells (P < 0.05). However, pretreatment of these cells with the p38MAPK inhibitor abolished this effect. Moreover, the significant decrease observed in the percentage of cells in S+G2/M phases of the cell cycle in cells treated with IGF-I/insulin plus TNF{alpha} compared with that in IGF-I/insulin-treated cells (P < 0.01 and P < 0.05, respectively) was reversed when p38MAPK was inhibited. In contrast, MEK inhibition potentiated the effect of TNF{alpha}, significantly decreasing the percentage of cells in S+G2/M phases of the cell cycle under basal conditions (P < 0.05) and in cells treated either with IGF-I or insulin plus TNF{alpha} (P < 0.05 and P < 0.001, respectively). In addition, the IGF-I/insulin effect to increase the percentage of cells in the proliferative phases of the cell cycle was totally abolished by inhibition of ERKs.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Different effect of p38MAPK and ERK inhibition on TNF{alpha}-induced cell cycle arrest. Serum-starved cells, pretreated with 5 µM SB203580, 20 µM PD98059, or none as indicated, were triggered with 10 ng/ml TNF{alpha} for 24 h (or for 12 h to measure cyclin D1 expression) or were maintained untreated, and then cell cycle phases, DNA synthesis, cyclin D1, and PCNA expression were analyzed. A, Histogram showing the percentages of cells in the S+G2/M phases determined by flow cytometry. B, Histogram showing DNA synthesis quantified by [3H]thymidine incorporation and expressed as the fold increase, being the mean value for the control 1050 cpm. A and B, Results are the mean ± SEM of eight independent experiments. Statistical analysis was carried out by Student’s t test. Comparisons were made with respect to cells maintained (with or without IGF-I/insulin) in either the absence (*) or the presence of TNF{alpha} (+), but pretreated or not with either SB203580 or PD98059. *, P < 0.05; **, P < 0.01; ***, P < 0.001; +, P < 0.05; ++, P < 0.01; +++, P < 0,001. IGF-I/insulin treatment induced a significant increase in the percentage of cells in the S+G2/M phases (**) and [3H]thymidine (***) incorporation. C, Representative cyclin D1 Western blot. D, Representative PCNA Western blot.

 
Data from DNA synthesis assays, determined by [3H]thymidine incorporation, confirmed these results and are shown in Fig. 3BGo. TNF{alpha} decreased significantly [3H]thymidine incorporation, and this effect was partially abolished by pretreatment with the p38MAPK inhibitor (P < 0.05 compared with TNF{alpha}-treated cells), whereas MEK1 inhibition additionally decreased DNA synthesis (P < 0.01). TNF{alpha} also significantly decreased IGF-I- and insulin-induced DNA synthesis by 80% and 50–60%, respectively. This TNF{alpha} effect was not observed when cells were pretreated with the p38MAPK inhibitor, and it was significantly potentiated by pretreatment with PD98059 (P < 0.01). ERKs cascade inhibition also blocked the effects of IGF-I and insulin. Therefore, all of these data suggest that p38MAPK mediates TNF{alpha}-induced cell cycle arrest, whereas ERKs mediate cell growth in these cells.

In fibroblasts, regulation of cell growth by p38MAPK and ERKs pathways correlates with changes in cyclin D1 expression (31). However, no significant changes in the level of cyclin D1 (Fig. 3CGo) were observed in brown adipocytes upon TNF{alpha} treatment (at different time periods) in either the absence or presence of the p38MAPK and MEK inhibitors. Different from this, the level of another cell cycle-regulated protein, PCNA, decreased after treatment with TNF{alpha} (Fig. 3D). This effect was reversed by pretreatment of the cells with the p38MAPK inhibitor, and it was potentiated by MEK inhibition. Therefore, PCNA expression is regulated by p38MAPK and ERKs pathways, and it may be involved in the regulation of cell growth under these conditions.

TNF{alpha}-induced apoptosis is partially blocked by inhibition of p38MAPK, but it is potentiated by MEK inhibition
To study whether p38MAPK and ERKs played any role in TNF{alpha}-induced apoptosis in brown adipocytes, cells were treated with TNF{alpha} in the presence or absence of specific inhibitors of these pathways, and apoptosis was quantified by flow cytometry after staining with propidium iodide (Table 1Go). Treatment with TNF{alpha} for 48 h induced a 2.7-fold increase in the percentage of cells with DNA content lower than 2C, which was reduced by about 36% (compared with that in TNF{alpha}-treated cells) when p38MAPK was inhibited by SB203580. As SB203580 alone slightly increased apoptosis in control cells, protection from the TNF{alpha}-induced apoptosis with this inhibitor would be much higher. In addition, blockade of p38MAPK with another inhibitor, SB202190, led to a similar effect (Table 1Go). However, pretreatment with the MEK inhibitor enhanced the TNF{alpha} effect, leading to a 3.5-fold increase. Therefore, these data suggest that p38MAPK is involved in the mediation of apoptosis, whereas ERK activation might have a protective effect.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of p38MAPK and MEK inhibition on the TNF-{alpha}-induced increase in the percentage of cells with DNA content lower than 2C

 
These results were confirmed using other techniques: the presence of extranuclear fragmented DNA by electrophoresis analysis on agarose gels and the presence of phosphatidylserine residues in the outer plasma membrane by flow cytometry after binding to annexin V and staining with PI. Pretreatment of cells with the p38MAPK inhibitor, SB203580, decreased DNA fragmentation induced by TNF{alpha} (Fig. 4AGo), whereas MEK inhibition had the opposite effect. Similarly, the percentage of cells considered apoptotic (positive for annexin V and negative or low positive for PI) was decreased in TNF{alpha}-treated cells pretreated with the p38MAPK inhibitor and increased in cells pretreated with the MEK inhibitor (Fig. 4BGo).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 4. Effects of SB203580 and PD98059 on TNF{alpha}-induced DNA laddering and plasma membrane annexin V-FITC labeling. Serum-starved cells, pretreated with either 5 µM SB203580 or 20 µM PD98059 or not pretreated, as indicated, were triggered with 10 ng/ml TNF{alpha} for 48 h or with none. Then, DNA laddering and annexin V-FITC labeling were assayed. A, Representative DNA ladder. Cytoplasmic DNA from cells was extracted and analyzed by agarose-electrophoresis. B, Representative flow cytometric analysis of cells after labeling with annexin V-fluorescein isothiocyanate and PI. Annexin V-fluorescein isothiocyanate is detected in FL1-H, whereas PI is detected in FL3-H. Thus, apoptotic cells are located in the lower right in the diagrams. Values for the percentage of apoptotic cells under the different conditions are the mean ± SEM of three independent experiments. Statistical analysis was carried out by Student’s t test. **, P < 0.01 vs. control cells; +, P < 0.05 vs. TNF{alpha}-treated cells.

 
This evidence indicated that p38MAPK activation mediates apoptosis induced by TNF{alpha} in brown adipocytes. To confirm this by a different approach, transient transfections with wild-type p38MAPK plus an active mutant of MKK3 (MKK3DD), a kinase upstream of p38MAPK, were carried out in a brown adipocyte-derived cell line (MB 4.8.2) previously generated (40), as transfection efficiency is very low in primary brown adipocytes. The percentage of cells with DNA content lower than 2C was much higher in cells transfected with the active mutant of MKK3 (MKK3DD) plus wild-type p38 MAPK (Fig. 5BGo) than in cells transfected with the empty vector (Fig. 5AGo) in both untreated cells and cells treated with TNF{alpha}. The increase in the number of apoptotic cells in transfected cells correlated with an increase in the level of active p38MAPK (Fig. 5Go, upper panel). These data demonstrated that p38MAPK activation can induce apoptosis in brown adipocytes.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Cotransfection of an active MKK3 construct and p38MAPK wild-type induces apoptosis. The MB 4.8.2 brown adipocyte-derived cell line was transiently cotransfected with the MKK3DD and p38MAPK wild-type constructs (B) or with the empty vector (A). Then, cells were maintained untreated or were treated with 10 ng/ml TNF{alpha} for 10 min to measure the level of active p38MAPK or for 48 h for cell cycle analysis. Upper panels, Representative phospho-p38MAPK Western blots. Middle and lower panels, representative analysis of cell cycle, reflecting the percentage of cells with DNA content lower than 2C. Results are the mean ± SEM of three independent experiments. Statistical analysis was carried out using Student’s t test by comparing with cells transfected with the vector and treated in the same way. ***, P < 0.001.

 
TNF{alpha} induces apoptosis in nonproliferating brown adipocytes: effect of p38MAPK and ERK inhibition
We previously demonstrated that TNF{alpha} induces apoptosis in brown adipocytes, which do not express PCNA and, therefore, are not proliferating (10). Thus, to establish a possible relationship between the roles played by p38MAPK and ERKs in cell cycle and apoptosis, we simultaneously measured DNA content and PCNA expression by flow cytometry (Table 2Go). Under control conditions, half of the cells dying expressed PCNA. TNF{alpha} treatment highly increased the percentage of apoptotic cells; most of them were negative for PCNA expression, suggesting that TNF{alpha} induces cell death in nonproliferating cells, as previously demonstrated (10). Pretreatment with SB203580 did not change this effect significantly, whereas inhibition of MEK with PD98059 induced a decrease in the percentage of cells negative for PCNA expression, and most of the cells expressed PCNA. Therefore, although inhibition of p38MAPK decreases apoptosis induced by TNF{alpha}, cells that are not proliferating still die. In contrast, ERKs inhibition increases the number of apoptotic cells compared with TNF{alpha}, and most of these cells progress through the cell cycle.


View this table:
[in this window]
[in a new window]
 
Table 2. TNF{alpha} induces apoptosis in PCNA negative brown adipocytes: effect of p38MAPK and MEK inhibition

 
Effects of p38MAPK and MEK inhibition on NF-{kappa}B activation, c-Jun messenger RNA (mRNA) expression, CHOP protein levels, and CREB/ATF1 phosphorylation
Several transcription factors, such as CHOP/GADD153, the CREB/ATF family, and NF-{kappa}B, can be modulated by p38MAPK (41, 42, 43, 44, 45). On the other hand, ERKs have been shown to regulate the CREB/ATF family (45) as well as other transcription factors, such as the c-Jun family (46). Hence, they are putative targets of p38MAPK and/or ERKs.

c-Jun is one of the components of the transcription factor activating protein-1 and also forms Jun-ATF dimers, regulating gene expression and different cellular events, such as proliferation and apoptosis. Its regulation is very complex and includes changes in c-Jun expression and in protein phosphorylation. In brown adipocytes, we show in Fig. 6AGo, that treatment with TNF{alpha} for 30 min induced an increase in c-Jun mRNA level, which was prevented by pretreatment of the cells with PD98059, but was enhanced by SB203580.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Effect of TNF{alpha} on c-Jun mRNA expression and NF-{kappa}B binding activity. Regulation by ERKs and p38MAPK. Serum-starved brown adipocytes, pretreated with either 5 µM SB203580 or 20 µM PD98059 or nonpretreated as indicated, were triggered with 10 ng/ml TNF{alpha} for 30 min (A) or 15 min (B) or were maintained untreated. A, Upper panel, Representative Northern blot analysis of c-Jun mRNA; lower panel, fold increase in c-Jun normalized with 18S ribosomal probe. B, Upper panel, Representative NF-{kappa}B gel shift assay; lower panel, fold increase in NF-{kappa}B binding activity. A and B, Results are the mean ± SEM of three independent experiments. Statistical analysis was carried out using Student’s t test by comparing either with control cells (**, P < 0.01; ***, P < 0.001) or with TNF{alpha}-treated cells (+, P < 0.05; +++, P < 0.001).

 
Another transcription factor, NF-{kappa}B, plays a protective role in some processes of apoptosis (47, 48, 49), and its activity can be regulated by p38MAPK (29, 43, 50, 51) and ERKs (52). In brown adipocytes, we found that TNF{alpha} increased NF-{kappa}B binding activity, but neither pretreatment with SB203580 nor that with PD98059 modified this effect (Fig. 6BGo).

The transcription factor, CHOP/GADD153, could be another possible target for p38MAPK, for it can be regulated by p38MAPK-mediated phosphorylation (42) and by changes in gene expression (43). As shown in Fig. 7AGo, the CHOP protein level was very low in control cells and was additionally decreased by TNF{alpha} at 24 and 48 h (data not shown). p38MAPK inhibition and MEK inhibition slightly reduced this decrease. Therefore, it appears that CHOP could not be a mediator of TNF{alpha}-induced apoptosis, as it was almost undetectable in cells after TNF{alpha} treatment.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Effect of TNF{alpha} on CHOP expression and CREB/ATF1 phosphorylation. Regulation by ERKs and p38MAPK. Serum-starved brown adipocytes, pretreated with either 5 µM SB203580 or 20 µM PD98059 or nonpretreated as indicated, were triggered with 10 ng/ml TNF{alpha} for 24 h (A) or 10 min (B) or were maintained untreated. A, Upper panel, Representative CHOP Western blot analysis; lower panel, fold increase in CHOP protein levels. B, Upper panel, Representative phospho-CREB/ATF1 Western blot analysis; lower panel, fold increase in phosphorylated ATF1 levels. A and B, Results are the mean ± SEM of three independent experiments. Statistical analysis was carried out using Student’s t test by comparing either with control cells (**, P < 0.01; ***, P < 0.001) or with TNF{alpha}-treated cells (+++, P < 0.001).

 
CREB has been shown to be phosphorylated at Ser133 via ERKs (41), p38MAPK (41, 45), and other kinases, such as PKA. However, CREB was already phosphorylated in control cells, pretreated with either the p38MAPK inhibitor or the MEK inhibitor or nonpretreated (Fig. 7BGo). No change was observed after treatment of the cells with TNF{alpha} in either the presence or absence of these inhibitors. However, TNF{alpha} induced the phosphorylation of ATF-1 (Fig. 7BGo), which was highly reduced by inhibition of p38MAPK, but not by ERK inhibition. Therefore, ATF1 might be a mediator of the TNF{alpha} effects produced via p38MAPK.

TNF{alpha} activates JNKs: role of JNK1/2 in TNF{alpha}- induced apoptosis
TNF{alpha} activates JNKs in different cell types. In brown adipocytes, we studied JNK activity after treatment with different doses of TNF{alpha} (0.5–20 ng/ml) for 10 min, and the results are shown in Fig. 8AGo. TNF{alpha} treatment induced an increase in JNK activity, reaching a maximum with 5 ng/ml.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. Dose response and time course of JNK activation by TNF{alpha}. Representative autoradiograms showing phospho-c-Jun 79 after electrophoresis on 10% SDS-polyacrylamide gels. Serum-starved brown adipocytes were maintained untreated or were triggered with either different TNF{alpha} concentrations (0.5–20 ng/ml) for 10 min (A) or with 10 ng/ml TNF{alpha} for different time periods as indicated (B). Then, total cell extracts were obtained, and JNK activity was measured. Relative values obtained after quantification of the radioactivity are represented on top of each gel. Statistical analysis was carried out using Student’s t test by comparing with control cells (n = 3). Significant increases were only obtained when cells were treated with 5–20 ng/ml TNF{alpha} for 10–15 min (***, P < 0.001).

 
A complete time course was carried out as well. JNK activity was slightly increased after 5 min of treatment with TNF{alpha} (10 ng/ml) and reached a peak of maximum activation at 10–15 min, decreasing afterward (Fig. 8BGo).

As the TNF{alpha}-induced apoptosis in brown adipocytes was highly reduced by blockade of p38MAPK, but was not completely abolished, JNKs might play a role. Therefore, we determined whether JNKs could be involved in mediation of this process of apoptosis. To do this, JNK1 and JNK2 wild-type constructs and dominant negative APF mutants (36), subcloned in a GFP expression vector, were transfected in the brown adipocyte-derived cell line (MB 4.8.2) (40). The percentage of cells with DNA content lower than 2C did not change when wild-type JNK1 was overexpressed in either control or TNF{alpha}-treated cells. However, in cells overexpressing wild-type JNK2, a small increase in percentage was produced, which was additionally increased by TNF{alpha} similar to the one obtained in cells transfected with the vector (data not shown). This would suggest that JNK2, but not JNK1, might play a role in this process of apoptosis. However, the expression of the dominant negative JNKs mutants was unable to block TNF{alpha}-induced apoptosis (Fig. 9BGo), although TNF{alpha}-induced JNK endogenous activity was highly reduced by these JNKs mutants (Fig. 9AGo), indicating that this pathway is not involved in mediation of TNF{alpha}-induced apoptosis in brown adipocytes. All of these data were confirmed by flow cytometric analysis of the percentage of hypodiploid cells, only in the cells expressing GFP and therefore expressing the transfected JNKs constructs (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 9. Expression of transfected dominant negative mutants of JNK1 and JNK2 does not affect TNF{alpha}-induced apoptosis. The MB 4.8.2 brown adipocyte-derived cell line was transiently transfected with a dominant negative mutant of either JNK1 or JNK2 subcloned in a GFP vector or with the empty vector. Then, cells were maintained untreated or were treated with 10 ng/ml TNF{alpha} for 10 min to measure endogenous JNK activity or for 48 h for cell cycle analysis. A, representative JNK activity assay showing phospho-c-Jun 79 after electrophoresis on 10% SDS-polyacrylamide gels. B, Histogram showing relative values of cells with DNA content lower than 2C (apoptotic cells) quantified by flow cytometry. Results are the mean ± SEM of three independent experiments. Statistical analysis was carried out using Student’s t test by comparing with control cells transfected with the vector (**, P < 0.01).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TNF{alpha} induces apoptosis and cell cycle arrest in rat fetal brown adipocytes in primary culture (10). We have analyzed here the roles played by p38MAPK and ERKs as possible mediators of these TNF{alpha} actions as well as the role played by JNKs in this process of apoptosis. We have demonstrated that TNF{alpha} activates ERK1/2 in these cells with a peak at about 10 min. This activation is mediated by MEK1, as no ERK activity was detected when cells were pretreated with the MEK1-specific inhibitor, PD98059, at doses of 5–20 µM, which are high enough to completely inhibit MEK1, but not MEK2 (53). Similarly, TNF{alpha} activates ERKs in other cell types, such as 3T3-L1 cells (54), and in mouse macrophages, where MEK1 is also upstream of ERKs (15). We have also shown here that p38MAPK and its downstream kinase, MAPKAPK2, were activated by TNF{alpha}, with a peak at 5 min. MAPKAPK2 activation was totally blocked by the p38MAPK-specific inhibitor, SB203580, at doses of 2–5 µM, which do not affect other kinases (data not shown). However, in 3T3-L1 cells, the activation of p38MAPK by TNF{alpha} seems to be different depending on the differentiation state. Thus, in undifferentiated 3T3-L1 cells, TNF{alpha} highly activated p38MAPK (55), whereas in 3T3-L1 adipocytes (white adipocytes), either a small increase in this activity upon TNF{alpha} treatment (55) or even no activation at all (52) was found. Regarding this, the strong activation of p38MAPK induced by TNF{alpha} in fetal brown adipocytes is not surprising, because these cells are not fully differentiated and are still able to proliferate and differentiate in response to the appropriate signals. In addition, brown adipocytes can have a different response to TNF{alpha} than white adipocytes due to cell type differences. However, what is probably more likely is that discrepancies can be due to differences in the differentiation state of the cells. Among the different isoforms of p38MAPK described to date, it is very likely that the isoform activated by TNF{alpha} in brown adipocytes could be p38{alpha}MAPK, because the anti-p38MAPK antibody used for the Western blot was designed against a peptide with a sequence present in p38{alpha}MAPK and recognizes a band corresponding to that detected by the antiphospho-p38MAPK antibody. Moreover, MAPKAPK2, which was described to be preferentially activated by p38{alpha}, but not by p38ß, p38{gamma}, or p38{delta} (25), was inhibited by a dose of SB203580 that mainly affected the p38{alpha} isoform. Higher doses can also inhibit the p38ß isoform. Therefore, most of the interfering SB203580 effects on TNF{alpha} actions that we have described here might be due to inhibition of the p38{alpha} isoform, although participation of other p38 isoforms, such as p38ß, cannot be totally ruled out.

We found that ERKs and p38MAPK play opposite roles in TNF{alpha}-induced apoptosis in brown adipocytes. p38MAPK mediates this process, whereas ERKs seem to play a survival role. Regarding this, the DNA ladder shown in Fig. 4AGo appears to indicate that inhibition of MEK doubles the TNF{alpha}-induced DNA fragmentation, whereas data from Table 1Go, in which hypodiploid peaks are shown, indicate a 30% increase. However, it should be pointed out that the data presented in Table 1Go and Fig. 4BGo can be considered quantitative, whereas the DNA ladder presented in Fig. 4AGo is more qualitative than quantitative. Thus, these data do not reflect the precise percentage of cells undergoing apoptosis in each case, although an increase or decrease in DNA laddering always correlated with an increase or decrease in the percentage of cells with DNA content lower than 2C (Table 1Go). On the other hand, both quantifications have different meanings. DNA laddering in the gel reflects the extranuclear fragmented DNA accumulated during the treatment, whereas cytometric analysis of DNA content allows us to quantify the number of apoptotic cells at a particular moment. However, DNA laddering demonstrates that the process of cell death taking place is apoptosis, instead of necrosis. On the other hand, although the effects of the p38MAPK and ERKs inhibitors were not dramatic, they were highly significant for asynchronized cells maintained in primary culture, particularly if the high number of experiments carried out was considered. In addition, the role played by p38MAPK in this process of apoptosis was confirmed by the marked increase observed in basal and TNF{alpha}-induced apoptosis in cells transiently transfected with an active mutant of MKK3 (MKK3DD) plus wild-type p38{alpha}MAPK (Fig. 5Go). This is in agreement with the increased apoptosis observed in 3T3-L1 cells transfected with a constitutively active MKK6 (56). In addition, the roles proposed here for p38MAPK and ERKs agree with those described for PC12, in the apoptosis triggered by nerve growth factor withdrawal (21). In this case, it seems that the mediator of this process of apoptosis is Fas ligand, the expression of which is induced via p38MAPK and JNK (57). Regarding TNF{alpha}, early activation of p38MAPK and JNK was proposed to be necessary for the survival of L929-cyt16 cells, whereas ERKs activation might not play any role (58). Therefore, this role suggested for p38MAPK is opposite that we propose here. However, it should be pointed out that there are many differences between the process of apoptosis induced by TNF{alpha} in L929-cyt16 cells and the one induced in brown adipocytes, which can explain our different results. Thus, in L929, apoptosis induced by TNF{alpha}, requires the presence of actinomycin D, and it is produced at about 6 h. In brown adipocytes, it occurs at 48 h and does not require actinomycin D. In addition, a different kinetic for p38MAPK was found: a second peak of p38MAPK (and JNK) activation at 6 h was produced in L929-cyt 16, coincident with apoptosis, that was not present in brown adipocytes. The researchers argue that the first peak of activation of p38MAPK and JNK is necessary for protection against apoptosis by TNF{alpha}, but it is probably not enough, so the second peak could be important as well. Thus, the first peak of activation occurs regardless of whether the cells undergo apoptosis, whereas the second one only occurs in cells undergoing apoptosis. On the other hand, the concentration of SB203580 used in the experiments was higher than that we used here. We used 5 µM SB203580, whereas the potentiation of TNF{alpha}-induced apoptosis in L929-cyt16 was only clearly detected with a dose of 30 µM, which can potentially inhibit p38{alpha} and p38ß. As a consequence, the participation of p38ß cannot be excluded. In addition, L929-cyt16 cells are cells completely different from brown adipocytes: they are a different cell type, they are not primary cells, and they stably express a chimeric receptor consisting of the extracellular transmembrane domains of murine CD4 fused to the cytoplasmic domain of murine Fas. Hence, it is hard to compare the results obtained in these cells with our results. Thus, the enhancement of TNF{alpha}-induced apoptosis can be due to cell type differences that lead to different kinetics of p38MAPK and JNK activation and/or to the simultaneous inhibition of p38{alpha} and p38ß by SB203580. According to this, other studies suggest different roles for the p38{alpha} and p38ß isoforms; p38{alpha} appears to induce apoptosis while p38ß enhances survival (59, 60). In addition, in other processes of apoptosis, p38s have been implicated as both positive (21, 26, 27, 28) and negative (29, 30) regulators of apoptosis. Hence, all of these discrepancies may be due to cell type and/or stimuli differences or even to participation of different p38 isoforms.

Because the process of apoptosis induced by TNF{alpha} in brown adipocytes was not totally prevented by inhibition of p38MAPK, participation of other signaling pathways, different from p38MAPK, cannot be excluded. In fact, in some processes of apoptosis, it has been proposed that both p38MAPK and JNK are mediators of the process (21, 56). In others, sustained JNK activation could mediate the process by a previous increase in ceramide levels, or not (33, 34, 35), whereas in cells lacking the MEKK1 gene, in which no JNK activity exists, apoptosis was enhanced (61). On the other hand, some data indicate that JNK1 and JNK2 can play different roles depending on the cell type and/or apoptotic stimuli (36, 62). Our data do not suggest that JNKs are involved in this process, because although overexpression of JNK2, but not of JNK1, slightly enhanced basal apoptosis, the expression of a dominant negative mutant of JNK1 or JNK2, which highly decreased endogenous JNK activity, was unable to block TNF{alpha}-induced apoptosis. This can be related to the fact that TNF{alpha} did not induce sustained JNK activation in brown adipocytes. Thus, the activation of JNK was very strong at 10–15 min, but then decreased. The slight increase observed at 2, 5, and 24 h does not appear to be very important for this apoptotic process and could be just a consequence of caspase activation. Thus, other signaling pathways, different from p38MAPK, could be also involved in this process, although it cannot be ruled out that SB203580 could not completely inhibit TNF{alpha}-induced apoptosis due to its toxicity after long-term-treatment (57).

Regarding ERKs, although we found a protective role for ERKs in the TNF{alpha}-induced apoptosis in brown adipocytes, as in other cell systems (21, 22), ERKs do not always play a role in survival (63), and their actions probably depend on the cell type and/or the apoptotic signal. Moreover, in our cell system, it is very likely that other pathways activated by TNF{alpha}, such as NF-{kappa}B, may be involved in survival, as it occurs in other cell types (47, 48, 49). This would also explain why this process of apoptosis is not so dramatic, because antiapoptotic pathways attenuate those proapoptotic pathways that are activated simultaneously. This is very common for TNF{alpha}, and in some cases, it is required to block these antiapoptotic pathways (for example, by inhibition of protein synthesis) to induce apoptosis (11).

In relation to the roles played by ERKs and p38MAPK in the cell cycle in brown adipocytes, they have opposite effects as in the process of apoptosis. Thus, meanwhile, inhibition of the ERK cascade enhances the TNF{alpha}-induced inhibition of proliferation (basal and IGF-I/insulin-induced), and p38MAPK blockade abolishes this effect. Therefore, ERKs activated by TNF{alpha} play a positive role in the regulation of proliferation in brown adipocytes, as it occurs when activated by IGF-I and insulin (17). In contrast, p38MAPK mediates the TNF{alpha}-induced inhibition of cell cycle progression. Similarly, in fibroblasts, ERKs play a positive role, whereas p38MAPK has an inhibitory role in cell proliferation (31). Further evidence of inhibition of cell cycle by p38MAPK has been recently obtained using an estrogen-induced MEKK3 construct (32). It seems that most of these effects on cell cycle are correlated with changes in cyclin D1 expression (31, 32); however, our data do not indicate any regulation at the level of cyclin D1, whereas a regulation of PCNA exists. This agrees with the modulation of other cell cycle-regulated proteins by p38MAPK that has been described (32). On the other hand, p38s can also activate cell proliferation (64, 65); it is possible that depending on the cell type and the stimulus, p38s can have either a positive or a negative role in cell proliferation.

On the other hand, TNF{alpha} induces cell death in nonproliferating cells, and this effect remains unchanged when p38MAPK is inhibited. Therefore, it seems that inhibition of p38MAPK decreases the number of cells dying by a process of apoptosis induced by TNF{alpha}, but the cells that still die are not proliferating. In contrast, ERK inhibition increases the number of apoptotic cells compared with TNF{alpha}, but most of these cells are positive for PCNA and, hence, they are progressing through the cell cycle.

In relation to the possible mediators of p38MAPK and ERKs actions, c-Jun might play a role. Thus, inhibition of ERKs prevents TNF{alpha}-induced c-Jun mRNA expression, which would be correlated with inhibition of proliferation and enhancement of apoptosis. In contrast, p38MAPK blockade enhances TNF{alpha}-induced c-Jun mRNA expression, which could partially account for the reversion of cell cycle arrest and the reduction of apoptosis. These would be in agreement with the role proposed for c-Jun as a mediator of proliferation and survival in c-Jun null mouse embryo fibroblasts (66).

Another possible target for p38MAPK could be NF-{kappa}B, which plays a protective role in some processes of apoptosis (47, 48, 49). It has been described that p38MAPK can increase either its trans-activation activity (51) or its nuclear translocation (44) or can even inhibit its activation (67). However, in brown adipocytes, binding of NF-{kappa}B to DNA in response to TNF{alpha} is not regulated by either p38MAPK or ERKs.

p38MAPK can also regulate CHOP/GADD153 by phosphorylation (42) and/or by changes in gene expression (43). CHOP plays an essential role in apoptosis induced by endoplasmic reticulum stress (68); it seems also to play a role in some other processes of apoptosis, such as that induced by Fas and ceramides (26), as well as in cell cycle arrest induced by stress (27, 42). However, our data do not suggest that CHOP is involved in TNF{alpha}-induced apoptosis and cell cycle arrest, because the level of this protein is almost undetectable under these conditions.

CREB or other members of this CREB/ATF family of transcription factors can be phosphorylated by a mechanism dependent on ERKs (41), p38ßMAPK (45), phosphoinositol 3-kinase/protein kinase B pathway (69), ERK/p38/mitogen- and stress-activated protein kinase-1 (MSK1) pathway (41), protein kinase A, or other kinases, and in some cases this phosphorylation has been correlated with cell survival. In brown adipocytes, we have shown here that CREB is already phosphorylated under control conditions, and no changes are induced in response to TNF{alpha}. However, ATF1 is phosphorylated after TNF{alpha} treatment by a mechanism dependent on p38MAPK that could be involved in the regulation of cell cycle and/or apoptosis via p38MAPK. In fact, in Jurkat cells, anisomycin-induced p38MAPK activation is responsible for ATF1 phosphorylation and subsequent induction of early growth response gene-1 (70).

Based on the results presented here, it can be concluded that p38MAPK plays an important role as a mediator of TNF{alpha}-induced apoptosis and cell cycle arrest in brown adipocytes. In contrast, ERKs attenuate the TNF{alpha} effects, and JNKs do not seem to play a significant role in TNF{alpha}-induced apoptosis. Thus, in fetal brown adipocytes, the simultaneous activation of ERKs, an antiapoptotic pathway, and p38MAPK, a proapoptotic pathway, by TNF{alpha} might be very important for regulation of the number of cells during the development of BAT in the perinatal period or even under other circumstances, such as obesity. The balance between these opposite pathways and some others might determine the precise number of cells that should die. In addition, ERKs and p38MAPK play opposite roles in the inhibition of proliferation and differentiation (our unpublished data) of brown adipocytes. Thus, ERKs mediate proliferation and survival, and inhibit differentiation, whereas p38MAPK does the opposite. In this way, TNF{alpha} might regulate not only the number of cells in BAT, but also the differentiation state of these cells. On the other hand, depending on the presence of other extracellular signals, this balance can be modified, so the cells would preferentially proliferate, differentiate, or die.


    Acknowledgments
 
We thank Drs. A. Nebreda and I. Fabregat for critical reading of the manuscript, and A. Vázquez for flow cytometry analysis. We also thank Drs. L. E. Heasley, S. Gutkind, and M. Yaniv for providing the APF JNKs constructs, the GST-c-Jun expression vector, and the plasmid containing c-Jun, respectively. We are also in debt to SmithKline Beecham for giving us the SB203580.


    Footnotes
 
1 This work has been supported by Grants SAF97-0137 from CICYT (Comisión Interministerial de Ciencia y Tecnología from Spain) and from Fundación Ramón Areces. Back

2 Recipients of fellowships from the Ministerio de Educación y Cultura, Spain. Back

Received April 14, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Trayhurn P, Milner RE 1989 A commentary on the interpretation of in vitro biochemical measures of brown adipose tissue thermogenesis. Can J Physiol Pharmacol 67:811–8192[Medline]
  2. Porras A, Peñas M, Fernández M, Benito M 1990 Development of the uncoupling protein in the rat brown adipose tissue during the perinatal period: its relationship with the mitochondrial GDP-binding and GDP-sensitive ion permeabilities and respiration. Eur J Biochem 187:671–6753[Medline]
  3. Porras A, Fernández M, Benito M 1989 Adrenergic regulation of the uncoupling protein expression in foetal rat brown adipocytes in primary culture. Biochem Biophys Res Commun 163:541–5474[CrossRef][Medline]
  4. Guerra C, Porras A, Roncero C, Benito M, Fernández M 1994 Triiodothyronine induces the expression of the uncoupling protein in long term fetal rat brown adipocyte primary cultures: role of nuclear thyroid hormone receptor expression. Endocrinology 134:1067–10745[Abstract]
  5. Guerra C, Roncero C, Porras A, Fernández M, Benito M 1996 Triiodothyronine induces the transcription of the uncoupling protein gene and stabilizes its mRNA in fetal rat brown adipocyte primary cultures. J Biol Chem 271:2076–20816[Abstract/Free Full Text]
  6. Lorenzo M, Valverde AM, Teruel T, Benito M 1993 IGF-I is a mitogen involved in differentiation-related gene expression in fetal rat brown adipocytes. J Cell Biol 123:1567–15757[Abstract/Free Full Text]
  7. Valverde AM, Teruel T, Navarro P, Benito M, Lorenzo M 1998 Tumor necrosis factor-{alpha} causes insulin receptor substrate-2-mediated insulin resistance and inhibits insulin-induced adipogenesis in fetal brown adipocytes. Endocrinology 139:1–10
  8. Xing H, Northrop JP, Grove JR, Kilpatrick KE, Su JL, Ringold GM 1997 TNF alpha-mediated inhibition and reversal of adipocyte differentiation is accompanied by suppressed expression of PPAR{gamma} without effects on Pref-1 expression. Endocrinology 138:2776–2783[Abstract/Free Full Text]
  9. Zhang B, Berger J, Hu E, Szalkowski D, White-Carrington, Spiegelman BM, Moller DE 1996 Negative regulation of peroxisome proliferator-activated receptor-{gamma} gene expression contributes to the antiadipogenic effects of tumor necrosis-{alpha}. Mol Endocrinol 10:1457–1466[Abstract]
  10. Porras A, Álvarez AM, Valladares A, Benito M 1997 TNF-{alpha} induces apoptosis in rat fetal brown adipocytes in primary culture. FEBS Lett 416:324–328[CrossRef][Medline]
  11. Nisoli E, Briscini L, Tonello C, De Giuli-Morghen C, and Carruba MO 1997 Tumor necrosis factor-{alpha} induces apoptosis in rat brown adipocytes. Cell Death Differ 4:771–778
  12. Prins JB, Niesler CU, Winterford CM, Bright,NA, Siddle K, O'Rahilly S, Walker NI, Cameron DP 1997 Tumor necrosis factor-{alpha} induces apoptosis of human adipose cells. Diabetes 46:1939–1944[Abstract]
  13. Malinin NL, Boldin MP, Kovalenko AV, Wallach D 1997 MAP3K-related kinase involved in NF-{kappa}B induction by TNF, CD95 and IL-1. Nature 385:540–544[CrossRef][Medline]
  14. Nagata S 1997 Apoptosis by death factor. Cell 88:355–365[CrossRef][Medline]
  15. Winston BW, Remigio LK, Riches DWH 1995 Preferential involvement of MEK1 in the tumor necrosis factor-{alpha}-induced activation of p42mapk/erk2 in mouse macrophages. J Biol Chem 270:27391–27394[Abstract/Free Full Text]
  16. Brunet A, Pouysségur J 1997 Mammalian MAP kinase modules: how to transduce specific signals. Essays Biochem 32:1–16[Medline]
  17. Porras A, Álvarez AM, Valladares A, Benito M 1998 p42/p44 mitogen activated protein kinases (MAPKs) activation is required for the IGF-I/insulin induced proliferation, but inhibits differentiation, in rat fetal brown adipocytes. Mol Endocrinol 12:825–834[Abstract/Free Full Text]
  18. Pagès G, Lenormand P, L’Allemain G, Chambard JC, Meloche S, Pouyssegur J 1993 Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl Acad Sci USA 90:8319–8323[Abstract/Free Full Text]
  19. Cowley S, Paterson H, Kemp P, Marshall CJ 1994 Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77:841–852[CrossRef][Medline]
  20. Mansour SJ, Matten WT, Hermann AS, Candia JM, Rong S, Fukasawa K, Vande Woude GF, Ann NG 1994 Transformation of mammalian cells by constitutively active MAP kinase kinase. Science 265:966–970[Abstract/Free Full Text]
  21. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME 1995 Opposing effects of ERK and JNK-p38MAP kinases on apoptosis. Science 270:1326–1331[Abstract/Free Full Text]
  22. Gadner AM, Johnson GL 1996 Fibroblast growth factor-2 suppression of tumor necrosis factor {alpha}-mediated apoptosis requires Ras and the activation of mitogen-activated protein kinase. J Biol Chem 271:14560–14566[Abstract/Free Full Text]
  23. Kyriakis JM, Banerjee P, Nikolakaki E, Dai T, Rubie EA, Ahmad MF, Avruch J, Woodgett JR 1994 The stress-activated protein kinase subfamily of c-Jun kinases. Nature 369:156–160[CrossRef][Medline]
  24. Cohen P 1997 The search for physiological substrates of MAP and SAP kinases in mammalian cells. Trends Cell Biol 7:353–361
  25. Rouse J, Cohen P, Trigon S, Morange M, Alonso-LLamazares A, Zamanillo D, Hunt T, Nebreda AR 1994 A novel kinase