help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Håkansson-Ovesjö, M.-L.
Right arrow Articles by Meister, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Håkansson-Ovesjö, M.-L.
Right arrow Articles by Meister, B.
Endocrinology Vol. 141, No. 11 3946-3955
Copyright © 2000 by The Endocrine Society

ARTICLES

Down-Regulated STAT3 Messenger Ribonucleic Acid and STAT3 Protein in the Hypothalamic Arcuate Nucleus of the Obese Leptin-Deficient (ob/ob) Mouse1

Marie-Louise Håkansson-Ovesjö, Maria Collin and Björn Meister

Department of Neuroscience, Karolinska Institutet, SE-171 77 Stockholm, Sweden

Address all correspondence and requests for reprints to: Björn Meister (Assoc. Prof.; M.D., Ph.D.), Department of Neuroscience, Karolinska Institutet, SE-171 77 Stockholm, Sweden. E-mail: bjorn.meister{at}neuro.ki.se


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin is a weight-reducing hormone produced by adipose tissue, which reduces food intake via hypothalamic leptin receptors and the JAK-STAT signaling pathway. In vivo studies have shown that leptin activates specifically STAT3 in the hypothalamus. We have studied the cellular localization of STAT3 messenger RNA (mRNA) and STAT3 protein in the mouse mediobasal hypothalamus using, respectively, in situ hybridization and immunohistochemistry. Strong STAT3 mRNA and STAT3 immunoreactivity was demonstrated in neurons located in the ventral part of the mouse arcuate nucleus. Comparison of STAT3 mRNA levels in the arcuate nucleus of lean control mice and obese leptin-deficient ob/ob mice showed that the levels of STAT3 mRNA in the arcuate nucleus were significantly lower (31% less in ob/ob mice), compared with control mice. Hybridization with a probe specific for STAT3{alpha} mRNA showed that the down-regulated STAT3 expression in the arcuate nucleus of ob/ob mice is represented by STAT3{alpha}. There was a marked difference in numbers and intensity of STAT3-immunoreactive cell bodies, with virtually no STAT3-immunoreactive cell bodies in the mediobasal hypothalamus of ob/ob mice, compared with control mice. Direct double-labeling immunofluorescence histochemistry of sections from control mice, combining a goat antiserum raised against a peptide sequence present in all leptin receptor isoforms (Ob-R) or a guinea pig antiserum generated to a peptide sequence specific for Ob-Rb with rabbit STAT3 antiserum, demonstrated colocalization of STAT3 and Ob-R as well as colocalization of STAT3 and Ob-Rb, in many cell bodies of the arcuate nucleus. The results suggest that circulating leptin acts via leptin receptor-/STAT3-containing neurons in the ventral arcuate nucleus and that congenital leptin deficiency, as seen in obese ob/ob mice, results in a down-regulation of STAT3 mRNA and protein levels.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
LEPTIN, the ob gene product, is a hormone that is produced and secreted primarily by adipocytes (1). Circulating leptin acts via specific leptin receptors in the hypothalamus (2, 3, 4) to reduce body weight by inhibiting food intake (5, 6, 7). The ob/ob mouse, which has a mutation in the ob gene, lacks functional leptin and displays a phenotype including severe obesity, insulin resistance, and infertility (1). Administration of recombinant leptin corrects all of the above mentioned defects in ob/ob mice and induces weight reduction in mice with diet-induced obesity, as well as in normal mice (5, 6, 7, 8, 9). The observation that lower doses of leptin are required to reduce food intake when centrally administered, compared with peripherally, and the fact that mice with hypothalamic lesions are leptin resistant support a hypothalamic site of action for leptin in body weight homeostasis regulation (5, 6, 9, 10, 11).

The db/db mice are defective in reception of the leptin signal because of a mutation in the db gene (3, 4), which results in a phenotype indistinguishable from the one seen in ob/ob mice (12). The leptin receptor is a single transmembrane-spanning receptor and belongs to the class I cytokine receptors (gp130 family) (2, 3, 4). There are at least five different isoforms of the leptin receptor (Ob-Ra through Ob-Re), which are generated via alternative splicing (4). Ob-Rb, which contains a long cytoplasmic domain and is primarily expressed in the hypothalamus, is considered to be the most important leptin receptor isoform in leptin signaling via the JAK-STAT pathway (JAK, Janus kinase; STAT, signal transducers and activators of transcription) (13, 14, 15). The mutation in db/db mice results in abnormally spliced Ob-Rb messenger RNA (mRNA), which is predicted to cause absence of Ob-Rb protein (3, 4, 14). Cytokines, such as leptin, induce receptor aggregation, leading to activation of members of the JAK family of cytoplasmic tyrosine kinases. STAT proteins are phosphorylated by JAKs, dimerize, and translocate into the nucleus, where they activate transcription of genes with STAT recognition sites in their promoters (see Ref. 16). In vitro, leptin has been shown to activate STAT1, STAT3, STAT5, and STAT6 (14, 15). However, in vivo, leptin has been shown to specifically activate hypothalamic STAT3, as demonstrated by DNA-binding activity assay (17) or by Western blotting using a phospho-specific STAT3 antibody (18). Two different STAT3 isoforms, STAT3{alpha} and STAT3ß, have been identified (19). In the rat hypothalamus, STAT3-immunoreactive cell bodies are present in areas (20, 21, 22) that also contain leptin receptors (20, 21, 23, 24, 25) and which early were implicated in regulation of food intake (see Ref. 26).

Previous studies have only demonstrated STAT3 activation in whole mouse or rat hypothalamus after iv administration (17, 18). In this study, we wanted to investigate the detailed anatomical localization of STAT3 mRNA and protein in the hypothalamus and compare STAT3 levels in the mediobasal hypothalamus of obese leptin-deficient ob/ob and lean control mice. In situ hybridization and immunohistochemistry, combined with confocal laser microscopy, were used to study the cellular localization of STAT3 mRNA and protein in the mediobasal hypothalamus of ob/ob and control mice. To further identify the hypothalamic cell populations that are targets for circulating leptin, we have determined the colocalization of STAT3 and leptin receptors in mice, using both an antiserum generated to a peptide sequence found in all leptin receptor isoforms and an antiserum generated to a peptide sequence only found in the long form of the leptin receptor (Ob-Rb). The results show that there are marked differences in the levels of hypothalamic STAT3 mRNA and STAT3 protein when comparing obese ob/ob mice with their lean littermates.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
In situ hybridization histochemistry
Male 8-week-old C57BL/6JBom-ob mice and lean littermates (M & B, Ry, Denmark; and B & K, Stockholm, Sweden) were decapitated, and the brains were rapidly dissected out and frozen. The brains were sectioned at 14-µm thickness, in a cryostat (Dittes, Heidelberg, Germany), and thaw-mounted onto pretreated glass slides (ProbeOn, Fisher Scientific, Pittsburgh, PA). Using MacVector software (IBI, New Haven, CT) oligonucleotide probes were selected based on optimum ratio of guanosine + cytosine/total nucleotide numbers (50–65%) and minimal homology (not greater than 80%) with GenBank-entered sequences. Oligonucleotide probes were made reversed and complementary to nucleotides: ACGACCTGCAGCAATACCATTGACCTGCCGA-TGTCCCCCCGCACTTTA of mouse STAT3{alpha} (19, 27) and ATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGT, a sequence common to mouse STAT3{alpha} and STAT3ß (19, 27, 28), and synthesized (CyberGene, Stockholm, Sweden). The probes were labeled with 33P-dATP or 35S-dATP (NEN Life Science Products, Boston, MA) at the 3'-end using terminal deoxynucleotidyltransferase (Amersham Pharmacia Biotech, Amersham, UK) and purified using a QIAquick Nucleotide Removal Kit (QIAGEN, Hilden, Germany).

In situ hybridization was carried out essentially as described (29). Tissue sections were air-dried and incubated with a hybridization solution containing 0.5 ng of labeled probe/slide. The hybridization solution contained 50% deionized formamide (J. T. Baker Chemicals, Deventer, The Netherlands), 4x SSC (1x SSC = 0.15 M sodium chloride, 0.015 M sodium citrate), 1x Denhardt’s solution [0.02% BSA, 0.02% Ficoll (Amersham Pharmacia Biotech, Uppsala, Sweden), 0.02% polyvinylpyrrolidone], 1% N-lauroylsarcosine, 0.02 M NaPO4 (pH 7.0), 10% dextran sulfate (Pharmacia), 500 µg/ml denatured salmon testis DNA (Sigma, St. Louis, MO), and 200 mM dithiothreitol (LKB, Stockholm, Sweden). After 16 h of incubation, the slides were rinsed in 1x SSC for 4 times 15 min at 56 C and allowed to cool down to room temperature, washed in distilled water, transferred rapidly through 60% and 95% ethanol. The 33P-dATP-labeled sections were apposed to ß-max autoradiography film (Amersham Pharmacia Biotech). The films were exposed for 7 weeks (STAT3) or 18 days (STAT3{alpha}) and developed with LX 24 and fixed with AL4, both from Eastman Kodak Co. (Kodak). The 35S-dATP-labeled sections were dipped in Kodak NTB2 emulsion, exposed for 10 weeks, developed in Kodak D 19 (3 min), and fixed in Kodak 3000 (7 min). The slides were rinsed in distilled water and coverslipped with glycerol. In addition, some of these sections were counterstained with cresyl violet, dehydrated in graded series of ethanol, and coverslipped with Entellan (Merck, Darmstadt, Germany). All sections were examined in a Nikon Microphot-SA microscope (Nikon Corp., Tokyo, Japan) equipped for bright-field and dark-field microscopy. Photographs were taken with Kodak Tmax 100 ASA black-and-white film.

Quantification of mRNA levels
Quantification of mRNA levels was made from film autoradiograms. The films were scanned at 2000 dots per inch (dpi) (UMAX Powerlook 3000, software UMAX Magic Scan DA 4.2; UMAX Technologies, Inc., Fremont, CA) and analyzed with a Macintosh G4 computer using the public domain NIH Image program (developed at the NIH and available on the Internet at http://rsb.info.nih.gov/nih-image/). The mean optical density was measured in the arcuate nucleus. The gray levels corresponding to the 14C-plastic standards (Amersham Pharmacia Biotech) that were within the exposure range of the films were determined and used for calibration.

Statistical analysis
Statistical analysis was carried out by using Mann-Whitney’s U test (Systat software 5.2.1, SPSS, Inc., Chicago, IL); **, P < 0.01. Data are shown as percent of controls, mean ± % SEM.

Immunofluorescence histochemistry and confocal laser microscopy
Male 8-week-old C57BL/6JBom-ob mice and lean littermates (M & B, and B & K) (n = 4 in each group) were anesthetized with sodium pentobarbital (40 mg/kg; ip) and perfused, via the ascending aorta, with 10 ml Ca2+-free Tyrode’s solution (37 C) followed by 10 ml formalin-picric acid fixative (37 C) (4% paraformaldehyde and 0.4% picric acid in 0.16 M phosphate buffer, pH 6.9) and 50 ml of the same fixative (ice-cold). The brain was rapidly dissected out, postfixed in the same fixative for 90 min, and rinsed for at least 24 h in 0.1 M phosphate buffer (pH 7.4) containing 10% sucrose, 0.02% Bacitracin (Sigma), and 0.01% sodium azide (Merck) in 0.1 M phosphate buffer (pH 7.4). The brains were mounted in pairs, one ob/ob and one control, and sections were cut (14-µm) in a cryostat (Dittes) and incubated at 4 C overnight with rabbit polyclonal antiserum to STAT3 (1:10,000; sc-482; Santa Cruz Biotechnology, Inc.; see Refs. 20, 21, 22). Direct double-labeling immunofluorescence histochemistry was performed by combining rabbit polyclonal antiserum to STAT3 with goat antiserum to Ob-R (diluted 1:500; sc-1834; Lot. no. G116; Santa Cruz Biotechnology, Inc.; see Refs. 24, 30, 31, 32) or guinea pig polyclonal antiserum to Ob-Rb (1:5,000). The Ob-Rb antiserum was raised against a peptide sequence corresponding to carboxyterminal amino acids QSCSTHSHKIIENKMCDLTV of rat Ob-Rb (33). The peptide was conjugated (10 mg/ml) to bovine thyroglobulin (Sigma; 40 mg/ml) using 7% glutaraldehyde (Sigma; 30 µl/ml). The peptide-thyroglobulin conjugate was emulsified with an equal volume of Freund’s incomplete adjuvant (Sigma) and injected sc in guinea pigs. In addition, a rabbit antiserum raised to the human Ob-Rb (diluted 1:400; Cat. no. 4781-L, Lot. no. HLR-L13–25P-1; Linco Research, Inc., St. Charles, MO) was used. After rinsing the sections in PBS (0.1 M phosphate buffer, pH 7.4, 0.15 M NaCl), the single-stained sections were incubated for 1 h at room temperature with Cy3-conjugated donkey antirabbit (dilution 1:250; Jackson ImmunoResearch Laboratories, Inc.) secondary antibodies. For the double-stained sections, Cy3- or Cy5-conjugated donkey antirabbit (final dilution 1:250, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) and Cy3-conjugated donkey antigoat and Cy5-conjugated antirabbit (final dilution 1:250; Jackson ImmunoResearch Laboratories, Inc.) secondary antibodies were used. After rinsing in PBS, the sections were mounted in a mixture of PBS and glycerol (1:3) containing 0.1% p-phenylenediamine to prevent fading of immunofluorescence. Sections were examined in a RadiancePlus confocal laser scanning system (Bio-Rad Laboratories, Inc., Hercules, CA). The excitation wavelength was 543 nm for Cy3- and 638 nm for Cy5-induced fluorescence. The images were produced using a Pictrography 3000 printer (Fuji Photo Film Co., Ltd.).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
In situ hybridization
In the hypothalamus of control mice, very strong hybridization signal was detected in the arcuate nucleus when hybridizing sections with an oligonucleotide probe to a sequence present in both STAT3{alpha} and STAT3ß (Figs. 1AGo and 2AGo). There was particularly strong expression in the ventromedial part of the arcuate nucleus (Figs. 1AGo and 2AGo). Weaker labeling was observed in the supraoptic nucleus, the paraventricular nucleus, the ventromedial nucleus (with a condensation in the medial part), and the lateral hypothalamic area (data not shown). There was also strong hybridization signal in the hippocampal formation and the medial habenula (data not shown). Analysis of emulsion-dipped and cresyl violet counterstained sections revealed that silver grains were overlying neurons in the ventromedial division of the arcuate nucleus (Fig. 1CGo). The localization of STAT3 mRNA was identical in control and ob/ob mice, however, the levels of STAT3 mRNA in the arcuate nucleus were significantly lower in ob/ob mice (in Fig. 1Go, compare A and C, with B and D; in Fig. 2Go, compare A with B; Fig. 3Go). Quantitative analysis of film autoradiograms revealed that the levels of STAT3 mRNA were 31 ± 4.3% (P < 0.01) lower in the arcuate nucleus of ob/ob mice, compared with control mice (Fig. 3AGo).



View larger version (137K):
[in this window]
[in a new window]
  		Figure 1. A–D, Dark-field and bright-field photomicrographs of sections of the mediobasal hypothalamus from a control mouse (A and C) and an ob/ob mouse (B and D) after hybridization with a probe to STAT3 mRNA. A and C, In the lean control mouse, there is strong STAT3 mRNA labeling in the ventromedial part of the arcuate nucleus (ARC), with somewhat less intense hybridization signal in the ventrolateral part. B and D, Note that the expression of STAT3 mRNA in the ARC is considerably lower in the ob/ob mouse, compared with the control mouse (compare A and C with B and D). ME, Median eminence; 3V, third ventricle. Bar, 50 µm.

 


View larger version (137K):
[in this window]
[in a new window]
  		Figure 2. A–D, Autoradiograms of sections of the mediobasal hypothalamus from control (A and C) and ob/ob (B and D) mice after hybridization with a probe to nucleotide sequence common to both STAT3{alpha} and STAT3ß (A and B), hence called STAT3, and a probe specific for STAT3{alpha} (C and D). In control animals, there is a strong hybridization signal for both STAT3 and STAT3{alpha} mRNA in the ventromedial part of the Arc. Note that the levels of STAT3 mRNA and STAT3{alpha} mRNA are down-regulated in ob/ob mice (compare arrows in A and C with B and D). Bar, 100 µm.

 


View larger version (11K):
[in this window]
[in a new window]
  		Figure 3. A and B, Relative levels of STAT3 mRNA expressed as percent of control in the hypothalamic Arc of control (CON) and ob/ob mice. The levels of STAT3 mRNA (A) and STAT3{alpha} mRNA (B) in the Arc are significantly lower in ob/ob mice, compared with controls (n = 6 in each group, for STAT3 mRNA; n = 5 in each group, for STAT3{alpha} mRNA). Bars represent the mean ± SEM. **, P < 0.01.

 
Hybridization with an oligonucleotide probe to a sequence present in STAT3{alpha} mRNA, but not in STAT3ß mRNA, showed strong labeling in the arcuate nucleus of control mice (Fig. 2CGo). The expression of STAT3{alpha} mRNA was significantly lower in ob/ob mice, compared with control mice (Fig. 2Go, compare C with D). Quantitative analysis of film autoradiograms showed that the levels of STAT3{alpha} mRNA in the arcuate nucleus were 40 ± 4.2% (P < 0.01) lower in the arcuate nucleus of ob/ob mice, compared with control mice (Fig. 3BGo).

Immunohistochemistry
Incubation of sections from control mouse mediobasal hypothalamus with a rabbit antiserum to mouse STAT3 revealed many strongly STAT3-immunoreactive neuronal cell bodies in the arcuate nucleus (Figs. 4Go, A and C; 5, A and C; and 6, A and C). Weakly STAT3-immunoreactive cells were also detected in the ventromedial hypothalamic nucleus (Fig. 4AGo) and in the supraoptic nucleus, the paraventricular nucleus, and the lateral hypothalamic area (data not shown). Comparison of sections from lean control mice and obese ob/ob mice showed that there was a marked difference in numbers and intensity of STAT3-immunoreactive cell bodies, with virtually no STAT3-immunoreactive cell bodies in mediobasal hypothalamus of the ob/ob mouse, compared with the control mouse (Fig. 4Go, compare A and C, with B and D).



View larger version (132K):
[in this window]
[in a new window]
  		Figure 4. A–D, Images of sections of the mediobasal hypothalamus from control (A and C) and ob/ob (B and D) mice, obtained via confocal laser microscopy, after incubation with an antiserum to STAT3. A and C, In the control mouse, there are many strongly STAT3 immunoreactive cell bodies in the ventral part of the Arc. There are also a few weakly STAT3-immunoreactive cell bodies in the ventromedial nucleus (VMH). B and D, Note that there are virtually no STAT3-immunoreactive cell bodies in the mediobasal hypothalamus of the ob/ob mouse, compared with the control mouse (compare A and C with B and D). Bars, 100 µm.

 
Direct double-labeling immunofluorescence histochemistry of sections from control mice combining a goat antiserum recognizing all leptin receptor isoforms (Ob-R) or a guinea pig antiserum specific for Ob-Rb with rabbit STAT3 antiserum demonstrated colocalization of STAT3 and Ob-R immunoreactivity (Fig. 5Go, compare A and C with B and D), as well as colocalization of STAT3 and Ob-Rb immunoreactivity (compare Fig. 6Go, A and C, with B and D) in many cell bodies of the arcuate nucleus. However, there were also some cells that were STAT3-negative/Ob-R-positive (Fig. 5Go, compare C with D). In general, the STAT3 immunoreactivity was punctate in the cytoplasm, whereas the Ob-R and Ob-Rb immunoreactivity was seen in the cell periphery (Fig. 5Go, compare C with D; and Fig. 6Go, C with D). There were also differences between the subcellular staining pattern obtained with the Ob-R and Ob-Rb antisera. The Ob-R antiserum resulted in labeling in the perinuclear region, but also in a region of the cell periphery, possibly coinciding with the plasma membrane, whereas the guinea pig Ob-Rb antiserum resulted in staining of the cell periphery and cytoplasm (Figs. 6DGo and 7AGo). The rabbit Ob-Rb antiserum showed predominantly a cytoplasmic staining pattern (Fig. 7BGo).



View larger version (177K):
[in this window]
[in a new window]
  		Figure 5. A–D, Images of sections of the Arc from a control mouse, obtained via confocal laser microscopy, after direct double-labeling combining rabbit antiserum to STAT3 with a goat antiserum recognizing all leptin receptor (Ob-R) isoforms. A and B, There are many STAT3- and Ob-R-immunoreactive cell bodies in the ventromedial part of the Arc. C and D, High magnification shows that the STAT3 immunoreactivity is punctate in the cytoplasm, whereas Ob-R immunoreactivity is confined to the cell periphery. Comparison of C with D reveals colocalization of STAT3 and Ob-R immunoreactivity in several arcuate cell bodies (compare long arrows in C and D). Note also the presence of STAT3-negative/Ob-R positive cell bodies (compare short arrows). Bar in A and B, 100 µm; bar in C and D, 50 µm.

 


View larger version (187K):
[in this window]
[in a new window]
  		Figure 6. A and D, Images of sections of the Arc from a control mouse, obtained via confocal laser microscopy, after direct double-labeling combining rabbit antiserum to STAT3 with a guinea pig antiserum specific for the long leptin receptor isoform. A and B, There are many STAT3- and Ob-Rb-immunoreactive cell bodies in the ventral part of the Arc. Few Ob-Rb-immunoreactive cell bodies are also seen in the VMH. Note overlap of STAT3- and Ob-Rb-immunoreactive cell bodies in the Arc. C and D, High magnification shows that the STAT3 immunoreactivity is punctate in the cytoplasm, whereas Ob-Rb immunoreactivity is confined to the cell periphery. Comparison of C with D shows colocalization of STAT3 and Ob-Rb immunoreactivity in several arcuate cell bodies (compare arrows in C and D). Bar in A and B, 100 µm; bar in C and D, 5 µm.

 


View larger version (148K):
[in this window]
[in a new window]
  		Figure 7. A and B, Images of sections of the Arc from a control mouse, obtained via confocal laser microscopy, after direct double-labeling combining guinea pig antiserum to rat Ob-Rb (A) with rabbit antiserum to human Ob-Rb (B). There are many neurons in the Arc that are labeled with the two different Ob-Rb antisera (A and B). The guinea pig Ob-Rb antiserum results in staining located mainly in the cell periphery (A), whereas the rabbit Ob-Rb antiserum labels the entire cytoplasm (B). Comparison of A with B reveals that there is colocalization of the two different Ob-Rb immunoreactivities in many neurons of the Arc (see arrows). Bar, 50 µm.

 
Preabsorption of the guinea pig Ob-Rb antiserum with immunogen peptide (10-5 M) resulted in a complete disappearance of the immunoreactivity (data not shown). To further validate the specificity of the guinea pig antiserum to rat Ob-Rb, a commercially available rabbit antiserum to human Ob-Rb was used. The latter antiserum showed staining in cell bodies of the mouse arcuate nucleus (Fig. 7BGo). Double-staining of mouse sections of the arcuate nucleus showed colocalization of staining in virtually all arcuate cell bodies obtained with the two Ob-Rb antisera (Fig. 7Go, compare A with B).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This study shows that STAT3 mRNA and STAT3 protein are present in neuronal cell bodies of the mouse arcuate nucleus. We and others have earlier shown that STAT3 protein is present in cells of the rat mediobasal hypothalamus, as demonstrated with immunohistochemistry (20, 22). The presence of STAT3 in the arcuate nucleus is in agreement with leptin specifically activating hypothalamic STAT3 in vivo (17, 18) and with the presence of neurons in the rat arcuate nucleus containing leptin receptor immunoreactivity (20). STAT3/leptin receptor-containing neurons in the arcuate nucleus also contain neuropeptide Y (NPY) or POMC (20, 24). Both NPY and POMC-derived peptides, such as {alpha}-MSH and ß-endorphin, have been shown to be important regulators of food intake and hypothalamic down-stream mediators of leptin (26). Here we demonstrate that leptin receptor immunoreactivity, detected both with an antiserum generated to a sequence common to all receptor isoforms and a guinea pig antiserum raised to a peptide sequence exclusively present in rat Ob-Rb, is present in STAT3-containing neurons of the mouse arcuate nucleus. The specificity of the guinea pig Ob-Rb antiserum was supported by the presence of Ob-Rb immunoreactivity in neurons previously described to contain Ob-Rb mRNA (25) and Ob-R immunoreactivity (24), as well as the demonstration of colocalization of Ob-Rb immunoreactivities obtained with the guinea pig and rabbit Ob-Rb antisera. Furthermore, preliminary results, using Western blotting on transfected cell homogenates, have shown that the guinea pig Ob-Rb antiserum detects a single band at the predicted size corresponding to the intracellular part of Ob-Rb (Håkansson-Ovesjö et al., in preparation). Using another antiserum raised against human Ob-Rb, Baskin et al. (34) have earlier shown that NPY neurons in the rat arcuate nucleus are Ob-Rb-immunoreactive. The findings mentioned above support the view that neurons located in the ventral region of the arcuate nucleus contain functional leptin receptors and STAT3 and are thereby important targets for circulating leptin.

The Ob-R and Ob-Rb antisera resulted in distinct subcellular staining patterns. It has earlier been described that the Ob-R antiserum used in this study is concentrated in perikarya and dendrites and, at the subcellular levels, gives a predominant staining in the Golgi area (35, 36, 37) but also labels plasma membrane, rough endoplasmic reticulum, and cytoplasmic matrix (37). The two Ob-Rb antisera also showed distinct subcellular patterns, with the guinea pig Ob-Rb antiserum staining mainly the cell periphery and the rabbit Ob-Rb antiserum preferentially, resulting in a more cytoplasmic staining. It is possible that the differences in subcellular distribution between the antisera is reflected by differences in the affinity for the posttranslationally modified leptin receptor protein.

The marked difference in both STAT3 mRNA levels and the numbers and intensity of STAT3-immunoreactive neurons in the arcuate nucleus of control vs. ob/ob mice is interesting and suggests that the absence of functional leptin in ob/ob mice results in a down-regulation of STAT3 mRNA and consequently also of STAT3 protein levels. The observations indicate that the levels of STAT3 reflect serum levels of leptin and that STAT3 is an important mediator of leptin in the hypothalamus. The findings raise the question of whether the down-regulated hypothalamic STAT3 system of the ob/ob mouse can be up-regulated in the presence of exogenous leptin. Because the obesity seen in ob/ob mice can be corrected by administration of leptin (5, 6, 7), it is tempting to conclude that the STAT3 mRNA and protein may reach normal levels in the presence of leptin. However, Emilsson et al. (38) showed recently that 48-h administration of leptin significantly reduces body weight of ob/ob mice, without altering STAT3 mRNA levels when measuring STAT3 mRNA in whole hypothalamus by RT-PCR. These observations indicate that there may exist signal transduction molecules other than STAT3 that can be activated by leptin and induce weight reduction. On the other hand, alterations in STAT3 mRNA levels in the arcuate nucleus may escape detection when analyzing extracts of whole hypothalamus.

Down-regulation of STAT3 mRNA and protein in ob/ob mice should be put in context with phosphorylation of STAT3. It has been shown that there is no difference in leptin-induced DNA-binding activity in the hypothalamus of ob/ob mice, compared with normal mice (17). Even if the levels of STAT3 in hypothalamic neurons are lower in the leptin-deficient state, these neurons may rapidly (within 15–30 min) (17) become activated in the presence of leptin. The down-regulation of STAT3 mRNA and protein, paralleled by a normal leptin-induced STAT3 activation, may be explained by an up-regulation of leptin receptors in ob/ob mice (39, 40).

There are at least two isoforms of STAT3 that are generated via alternative splicing (19, 27). STAT3ß is a truncated isoform of STAT3 that differs from the longer form (STAT3{alpha}) by the replacement of the 55 carboxyterminal amino acid residues of STAT3{alpha} by 7 amino acids specific to STAT3ß (19). STAT3{alpha} and STAT3ß have significantly different properties attributable to the presence or absence of the acidic carboxyterminal tail of STAT3{alpha} (41). For instance, STAT3ß is transcriptionally active under conditions where STAT3{alpha} is not (19). Both isoforms are activated via phosphorylation of tyrosine residue 705 for DNA binding and transcription by the same set of growth factors and cytokines, and both STAT3 isoforms can form homodimers and heterodimers (41). However, Schaefer et al. (41) have shown that STAT3ß, but not STAT3{alpha}, is active in the absence of added cytokine or growth factors and that the activated form STAT3ß has greater specific DNA-binding activity and stability than activated STAT3{alpha}; but STAT3{alpha}, relative to DNA-binding activity, is transcriptionally more active than STAT3ß. However, Caldenhoven et al. (27) have shown that STAT3ß is completely unable to mediate transcriptional activation in COS cells and that STAT3ß is a dominant negative regulator of transcription.

Using an oligonucleotide probe recognizing STAT3{alpha}, but not STAT3ß mRNA, we could demonstrate that the STAT3 mRNA expression in the arcuate nucleus is represented by at least STAT3{alpha} mRNA. The presence of STAT3{alpha}, a ligand-activated STAT3 isoform, in neurons of the arcuate nucleus is in agreement with the demonstration of the down-regulated STAT3 mRNA in the ob/ob mice, which lack leptin ligand. Hence, it seems that STAT3{alpha} is the STAT3 isoform that mediates the action of leptin in the mediobasal hypothalamus. However, the coexpression of STAT3{alpha}/STAT3ß mRNA in the arcuate nucleus can, at present, not be excluded. It is important to point out that the magnitude of the down-regulation of STAT mRNA levels was greater for STAT3{alpha} (40%), compared with STAT3{alpha}/STAT3ß (31%). This finding may be explained by the additional presence of STAT3ß but also other STAT3 isoforms. If STAT3ß also is present in the arcuate neurons, our findings may indicate a differential regulation of STAT3{alpha} and STAT3ß in the ob/ob mouse. This would be in agreement with the observation that STAT3ß is a repressor of STAT3-mediated transcription (27). One may speculate that, under physiological conditions, leptin up-regulates STAT3{alpha} mRNA and down-regulates STAT3ß mRNA, with a net effect to enhance transcription in arcuate neurons.

SOCS-3 (suppressor of cytokine signaling) is a member of the family of cytokine-inducible inhibitors of signaling, which are activated after activation of the JAK-STAT pathway and which switch off cytokine signal transduction (42, 43). In vitro, SOCS-3 blocked leptin-induced signal transduction (44). Neurons of the rodent arcuate nucleus express SOCS-3 mRNA (44), and the distribution of SOCS-3 mRNA-containing neurons suggests colocalization with STAT3 mRNA. Administration of leptin [2 h (42) and 48 h (38)] induces hypothalamic SOCS-3 mRNA, but not SOCS-1 or SOCS-2 mRNA. It has been suggested that SOCS-3 is a potential mediator of central leptin resistance (44), which has been proposed to be essential in the pathogenesis of human obesity (see Ref. 45). It is possible that an altered STAT3 regulation may participate in leptin resistance and obesity.

In conclusion, this study demonstrates that leptin target neurons in the ventral part of the mouse hypothalamic arcuate nucleus contain STAT3 mRNA and protein and that the STAT3 mRNA is represented by at least STAT3{alpha}, a ligand-activated STAT3 isoform. Absence of functional leptin, as seen in obese ob/ob mice, results in a down-regulated STAT3 signaling system.


   Footnotes
 
1 This research was supported by grants from the Swedish Medical Research Council (334X-10358) and the Swedish Society of Medical Research and by funds from the Karolinska Institutet. Back

Received April 26, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  2. Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J, Muir C, Sanker S, Moriarty A, Moore KJ, Smutko JS, Mays GG, Woolf EA, Monroe CA, Tepper RI 1995 Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263–1271[CrossRef][Medline]
  3. Chen H, Charlat O, Tartaglia LA,Woolf EA, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP 1996 Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491–495[CrossRef][Medline]
  4. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM 1996 Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632–635[CrossRef][Medline]
  5. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269:546–549[Abstract/Free Full Text]
  6. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chalt BT, Rabinowitz D, Lallone RL, Vurley SK, Friedman JM 1995 Weight reducing effects of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  7. Pelleymonter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269:540–543[Abstract/Free Full Text]
  8. Chehab FF, Lim ME, Lu R 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12:18–20[CrossRef]
  9. Stephens TW, Basinski M, Bristow PK, Bue-Vallesky JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, MacKellar W, Rosteck Jr PR, Schoner B, Smith D, Tinsley FC, Zhang X-Y, Heiman M 1995 The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377:530–532[CrossRef][Medline]
  10. Maffei M, Fei H, Lee GH, Dani C, Leroy P, Zhang Y, Proenca R, Negrel R, Ailhaud G, Friedman JM 1995 Increased expression in adipocytes of ob RNA in mice with lesions of the hypothalamus and with mutations at the db locus. Proc Natl Acad Sci USA 92:6957–6960[Abstract/Free Full Text]
  11. Satoh N, Ogawa Y, Katsuura G, Tsuji T, Masuzaki H, Hiraoka J, Okazaki T, Tamaki M, Hayase M, Yoshimasa Y, Nishi S, Hosoda K, Nakao K 1997 Pathophysiological significance of the obese gene product, leptin, in ventromedial hypothalamus (VMH)-lesioned rats: evidence for loss of its satiety effect in VMH-lesioned rats. Endocrinology 138:947–954[Abstract/Free Full Text]
  12. Hummel KP, Dickie MM, Coleman DL 1966 Diabetes, a new mutation in the mouse. Science 153:1127–1128[Abstract/Free Full Text]
  13. Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Kim HK, Lai CF, Tartaglia LA 1996 The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci USA 93:8374–8378[Abstract/Free Full Text]
  14. Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC 1996 Defective STAT signaling by the leptin receptor in diabetic mice. Proc Natl Acad Sci USA 93:6231–6235[Abstract/Free Full Text]
  15. Rosenblum CI, Tota M, Cully D, Smith T, Collum R, Quereshi S, Hess JF, Philips MS, Hey PJ, Vongs A, Fong TM, Xu L, Chen HY, Smith RG, Schindler C, Van der Ploeg LHT 1996 Functional STAT 1 and 3 signaling by the leptin receptor (OB-R); reduced expression of the rat fatty leptin receptor in transfected cells. Endocrinolgy 137:5178–5181[Abstract]
  16. Darnell JE 1997 STATs and gene regulation. Science 277:1630–1635[Abstract/Free Full Text]
  17. Vaisse C, Halaas JL, Horvath CM, Darnell JE, Stoffel M, Friedman JM 1996 Leptin activation of STAT3 in the hypothalamus of wild-type and ob/ob mice but not db/dbmice. Nat Genet 14:95–97[CrossRef][Medline]
  18. McCowen KC, Chow JC, Smith RJ 1998 Leptin signaling in the hypothalamus of normal rats in vivo. Endocrinology 139:4442–4447[Abstract/Free Full Text]
  19. Schaefer TS, Sanders LK, Park OK, Nathans D 1995 Cooperative transcriptional activity of JUN and STAT3ß, a short form of STAT 3. Proc Natl Acad Sci USA 98:9097–9101
  20. Håkansson M-L, Meister B 1998 Transcription factor STAT3 in leptin target neurons of the rat hypothalamus. Neuroendocrinology 68:420–427[CrossRef][Medline]
  21. Håkansson M-L, de Lecea L, Sutcliffe JG, Yanagisawa M, Meister B 1999 Leptin receptor- and STAT3-immunoreactivities in hypocretin/orexin neurones of the lateral hypothalamus. J Neuroendocrinol 11:653–663[CrossRef][Medline]
  22. Strömberg H, Svensson SP, Hermanson O 2000 Distribution of the transcription factor signal transducer and activator of transcription 3 in the rat central nervous system and dorsal root ganglia. Brain Res 853:105–114[CrossRef][Medline]
  23. Håkansson M-L, Hulting A-L, Meister B 1996 Expression of leptin receptor mRNA in the hypothalamic arcuate nucleus—relationship with NPY neurones. Neuroreport 7:3087–3092[Medline]
  24. Håkansson M-L, Brown H, Ghilardi N, Skoda RC, Meister B 1998 Leptin receptor immunoreactivity in chemically defined target neurons of the hypothalamus. J Neurosci 18:559–572[Abstract/Free Full Text]
  25. Elmquist JK, Bjørbæck C, Ahima RS, Flier JS, Saper CB 1998 Distributions of leptin receptor mRNA isoforms in the rat brain. J Comp Neurol 395:535–547[CrossRef][Medline]
  26. Meister B 2000 Control of food intake via leptin receptors in the hypothalamus. Vitam Horm 59:266–304
  27. Caldenhoven E, van Dijk TB, Solari R, Armstrong J, Raaijmakers JAM, Lammers JWJ, Koenderman L, de Groot RP 1996 STAT3beta, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J Biol Chem 271:13221–13227[Abstract/Free Full Text]
  28. Zhong Z, Wen Z, Darnell JE 1994 STAT3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264:95–98[Abstract/Free Full Text]
  29. Dagerlind Å, Friberg K, Bean AJ, Hökfelt T 1992 Sensitive mRNA detection using unfixed tissue: combined radioactive and non-radioactive in situ hybridization histochemistry. Histochemistry 98:39–49[CrossRef][Medline]
  30. Diano S, Kalra SP, Horvath TL 1998 Leptin receptor immunoreactivity is associated with the Golgi apparatus of hypothalamic neurones and glial cells. J Neuroendocrinol 10:647–650[CrossRef][Medline]
  31. Shioda S, Funahashi H, Nakajo S, Yada T, Maruta O, Nakai Y 1998 Immunohistochemical localization of leptin receptor in the rat brain. Neurosci Lett 243:41–44[CrossRef][Medline]
  32. Yarnell DO, Knight DS, Hamilton K, Tulp O, Tso P 1998 Localization of leptin receptor immunoreactivity in the lean and the obese Zucker rat brain. Brain Res 785:80–90[CrossRef][Medline]
  33. Takaya K, Ogawa Y, Isse N, Okazaki T, Satoh N, Masuzaki H, Mori K, Tamura N, Hosoda K, Nakao K 1996 Molecular cloning of rat leptin receptor isoform complementary DNAs: identification of a missense mutation in Zucker fatty (fa/fa) rats. Biochem Biophys Res Commun 225:75–83[CrossRef][Medline]
  34. Baskin DG, Schwartz MW, Seeley RJ, Woods SC, Porte Jr D, Breininger JF, Jonak Z, Schaefer J, Krouse M, Burghardt C, Campfield LA, Burn P, Kochan JP 1999 Leptin receptor long-form splice-variant protein expression in neuron cell bodies of the brain and co-localization with neuropeptide Y mRNA in the arcuate nucleus. J Histochem Cytochem 47:353–362[Abstract/Free Full Text]
  35. Diano S, Kalra SP, Horvath TL 1998 Leptin receptor immunoreactivity is associated with the Golgi apparatus of hypothalamic neurons and glial cells. J Neuroendocrinol 10:647–650
  36. De Matteis R, Cinti S 1998 Ultrastructural immunolocalization of leptin receptor in mouse brain. Neuroendocrinology 68:412–419[CrossRef][Medline]
  37. Funahashi H, Ryushi T, Mizushima H, Katoh S, Shioda S 2000 Ultrastructural localization of the receptor for leptin in the rat hypothalamus. Horm Behav 37:327–334[CrossRef][Medline]
  38. Emilsson V, Arch JRS, de Groot RP, Lister CA, Cawthorne MA 1999 Leptin treatment increases suppressors of cytokine signaling in central and peripheral tissues. FEBS Lett 455:170–174[CrossRef][Medline]
  39. Mercer JG, Moar KM, Rayner DV, Trayhurn P, Hoggard N 1997 Regulation of leptin receptor and NPY gene expression in hypothalamus of leptin-treated obese ob/ob mice and cold-exposed lean mice. FEBS Lett 402:185–188[CrossRef][Medline]
  40. Baskin DG, Seely RJ, Kuijper JL, Lok S, Weigle DS, Erickson JC, Palmiter RD, Schwartz MW 1998 Increased expression of mRNA for the long form of the leptin receptor in the hypothalamus is associated with leptin hypersensitivity and fasting. Diabetes 47:538–543[Abstract]
  41. Schaefer TS, Sanders LK, Park OK, Nathans D 1997 Functional differences between STAT3{alpha} and STAT3ß. Mol Cell Biol 17:5307–5316[Abstract]
  42. Matsumoto A, Tanimura S, Ohtsubo M, Misawa H, Miyazaki T, Leonor N, Taniguchi T, Fujita T, Kanakura Y, Komiya S, Yoshimura A 1997 A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387:921–924[CrossRef][Medline]
  43. Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A, Nishimoto N, Kajita T, Taga T, Yoshizaki K, Akira S, Kishimoto T 1997 Structure and function of a new STAT-induced STAT inhibitor. Nature 387:924–929[CrossRef][Medline]
  44. Bjørbæck C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS 1998 Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619–625[CrossRef][Medline]
  45. Considine RV 1997 Weight regulation, leptin and growth hormone. Horm Res [Suppl 5] 48:116–121



This article has been cited by other articles:


Home page
 EndocrinologyHome page
F. Guo, K. Bakal, Y. Minokoshi, and A. N. Hollenberg
Leptin Signaling Targets the Thyrotropin-Releasing Hormone Gene Promoter in Vivo
Endocrinology, May 1, 2004; 145(5): 2221 - 2227.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Cui, L. Huang, F. Elefteriou, G. Yang, J. M. Shelton, J. E. Giles, O. K. Oz, T. Pourbahrami, C. Y. H. Lu, J. A. Richardson, et al.
Essential Role of STAT3 in Body Weight and Glucose Homeostasis
Mol. Cell. Biol., January 1, 2004; 24(1): 258 - 269.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Håkansson-Ovesjö, M.-L.
Right arrow Articles by Meister, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Håkansson-Ovesjö, M.-L.
Right arrow Articles by Meister, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals