Endocrinology Vol. 140, No. 5 2415-2421
Copyright © 1999 by The Endocrine Society
The Gonadotropin-Releasing Hormone Receptor Gene Promoter Directs Pituitary-Specific Oncogene Expression in Transgenic Mice1
Constance T. Albarracin2,
Matthew P. Frosch and
William W. Chin
Division of Genetics (C.T.A., W.W.C.), Departments of Medicine and
Pathology (M.P.F.), Brigham and Women’s Hospital and Harvard Medical
School, Boston, Massachusetts 02115
Address all correspondence and requests for reprints to: Dr. William W. Chin, G. W. Thorn Research Building, Room 1019, Brigham and Women’s Hospital, 20 Shattuck Street, Boston, Massachusetts 02115.
 |
Abstract
|
|---|
Our previous work has shown that 1.2 kb of the 5' flanking region of
the mouse GnRH receptor (mGnRH-R) gene is sufficient to direct
tissue-specific expression in vitro. In this study, we
have used the cell-specific regulatory sequences of the mGnRH-R gene
promoter to target the expression of the simian virus 40 virus T
antigen (TAg) to the pituitary gland of transgenic mice. A hybrid
transgene, GnRH-R/TAg, was prepared using the -1164/+52 region of the
mGnRH-R gene and +2533/+5234 sequences encoding the large T antigen of
the simian virus 40. Two founders developed tumors of apparent
pituitary origin at 44 (M28, female) and 50 (M25, male) days of age.
M28 and M25 mice were about 50% underweight, and their gonads were
grossly underdeveloped compared with wild-type litter mates. A third
male founder, M29, developed a tumor at a later time (109 days). M29
was able to breed successfully and stably transmit the GnRH-R/TAg
transgene. Mice of the M29 transgene line developed tumors at 4–5
months of age. Gross examination showed that the tumors extend from the
sella and infiltrate into the inferior surface of the brain. In small
tumors collected from young transgenic animals, normal pituitary cells
as well as transition areas of increasing cellular atypia are evident.
Frankly malignant cells are seen in all tumors. The pituitary tumors
express the 
-, FSHß-, and LHß-subunits and the GnRH-R messenger
RNA, all markers of a gonadotrope but not of other anterior pituitary
cell lineages. In summary, our studies indicate that 1.2 kb of the
5'-flanking region of the mGnRH-R gene can be used to target expression
specifically to the gonadotropes of the pituitary gland in transgenic
mice. The GnRH-R gene promoter-directed expression appears to be
cell-specific and results in the formation of tumors that are primarily
of gonadotropic origin.
|
Introduction
|
|---|
THE GnRH receptor (GnRH-R) gene is
expressed in a tissue- and cell-specific manner. GnRH-Rs are abundantly
expressed in the anterior pituitary and are restricted to the
gonadotrope. The presence of GnRH-Rs in pituitary gonadotropes dictates
cell-specific responsiveness to GnRH. Although it is well known that
the GnRH-R is highly expressed in the pituitary, the regulatory
mechanisms determining the pituitary-specific expression of this
receptor have not been delineated.
GnRH binding activity and GnRH-R messenger RNA (mRNA) expression have
also been identified in other tissues. The expression of extrapituitary
GnRH-R is variable among different species. For example, GnRH-Rs have
been detected in the hippocampus and Leydig cells of the rat, but not
those of the mouse (1). GnRH-R has also been detected in granulosa
cells and corpora lutea of the rat (2, 3) and human (4) ovary. However,
similar studies in the mouse ovary have garnered conflicting results
(5, 6).
We have previously identified and characterized the promoter region of
the mouse GnRH-R gene (7). This enabled us to initiate studies on the
mechanisms involved in the transcriptional regulation of mGnRH-R gene
expression. In particular, we examined the tissue- and cell-specific
expression of the mouse GnRH-R gene in vitro using
transfection methods. Our studies showed that the mGnRH-R gene promoter
is highly expressed in cell lines of pituitary origin, and is
transcriptionally more active in a gonadotropic cell line (T3–1)
than in a somatolactotropic cell line (GH3) (7). The
results of these experiments indicate that the regulatory elements for
pituitary- and gonadotrope-specific expression are present within a
1.2-kb 5'-flanking region of the mGnRH-R gene.
To extend these in vitro studies, we have generated a
transgenic mouse model in which the cell-specific regulatory sequences
of the mGnRH-R gene promoter were used to direct the expression of the
simian virus 40 (SV40) large T antigen (TAg). Such promoter-specific
targeting of oncogene expression has been used extensively to study
tissue-specific transcriptional regulation (8, 9). We derived a stable
transgenic mouse line from one of the founders that permitted the
examination of GnRH-R gene promoter-directed TAg expression. These mice
will be used to measure transgene as well as endogenous GnRH-R,
gonadotropin and TSH subunits, and PRL and GH gene expression. These
experiments were performed to determine whether the 1.2-kb 5'-flanking
region of the mGnRH-R gene can direct gene expression to the pituitary,
specifically to gonadotropes, in an in vivo system.
|
Materials and Methods
|
|---|
Constructs
A genomic clone containing -1164/+52 of the mGnRH-R gene was
digested with StyI and filled in with the Klenow fragment of
Escherichia coli DNA polymerase I. The 5'-end at -1164 was
digested with HindIII to free the mGnRH-R gene promoter
fragment. The mGnRH-R gene fragment (-1164/+52) was subcloned into
pBluescript KS and then fused with gene sequences coding for the SV40
TAg (+2533/+5234). The SV40 TAg sequences were obtained from a
construct provided by Dr. Douglas Hanahan (University of California-San
Francisco) (9). The GnRH-R/TAg transgene was separated from the vector
pBluescript SK by digestion with BamHI. This 4.1-kb
transgene DNA was gel purified using GeneClean (BIO 101, La Jolla CA),
phenol-extracted twice, and then precipitated in ethanol (10). The DNA
was then diluted in 10 mM Tris-HCl (pH 7.4) and 0.25
mM EDTA and submitted to the Brigham and Women’s Hospital
Transgenic Core Facility (Boston, MA). The DNA was injected into the
pronuclei of fertilized one-cell embryos from FVB mice. Two-cell stage
embryos were then implanted into oviducts of pseudopregnant
Swiss-Webster mice (11).
Identification of transgenic mice
Transgenic mice were identified by PCR analysis of tail genomic
DNAs that were isolated as previously described (12). The presence of
the transgene was screened using a sense primer corresponding to
-349/-365 of the mouse GnRH-R (mGnRH-R) gene promoter and an
antisense primer corresponding to +4720/+4741 of the SV40 TAg to
generate a 900-bp product. One volume of TaqStart antibody
(CLONTECH Laboratories, Inc., Palo Alto, CA) to 1 vol
Taq DNA polymerase was used in all reactions. PCR was
performed by denaturation at 94 C for 1 min and cycling 30 times at 58
C for 2 min and at 72 C for 3 min. PCR analysis of the mGnRH-R gene
served as a positive control.
RNA isolation and RT-PCR for TAg mRNA
Individual pituitary and tumor tissues were homogenized in
guanidine isothiocyanate, and total RNA was extracted using an RNeasy
total RNA extraction (Qiagen, Madison, WI) which
simplified the extraction of small amounts of RNA in some tissues.
Total RNA was treated with 2 µl ribonuclease-free deoxyribonuclease I
(Boehringer Mannheim, Indianapolis, IN) for 1 h to
remove genomic DNA contamination. The samples were then extracted with
phenol-chloroform and ethanol precipitated. Total RNA was then analyzed
for TAg expression by RT-PCR. One microgram of the total RNA was
reverse transcribed into complementary DNA (cDNA) using an
oligo(deoxythymidine)12–18 primer (Pharmacia Biotech, Piscataway, NJ). Control experiments were performed in
which reverse transcriptase was not added. TAg cDNA was then amplified
by PCR using primers corresponding to +4620/+5225 of the coding region
of TAg, using the conditions described above.
Preparation of cDNAs and oligonucleotide probes
cDNA probes for the -subunit were generated by PCR using a
sense primer, TCTTCCTGATGGAGACTTTATTATTCAG, and an antisense primer,
CGACTTGTGGTAGTAGCAAGTGCTAC, to generate a 288-bp fragment (13). The PCR
fragment for TAg corresponded to +4620/+5225 of the coding region of
SV40 TAg. The PCR fragments were subcloned into the pGEMT vector
(Promega Corp., Madison, WI). The mouse FSHß and LHß
cDNAs were obtained from Dr. Malcolm Low (University of Oregon Health
Sciences Center, Portland, OR) (14, 15, 16). For the mouse GnRH-R
probe, we obtained a PstI-PstI fragment from a
full-length cDNA that had been previously cloned by PCR (7). The GnRH-R
cDNA fragment was subcloned into pBluescript (Stratagene,
La Jolla, CA). Antisense probes were generated from cDNA encoding the
-subunit, FSHß, LHß, TAg, and GnRH-R. In vitro
transcription was performed using either T3 or T7 RNA polymerase
following the manufacturer’s instructions (Stratagene, La
Jolla, CA). Oligonucleotide probes were synthesized by the Biopolymer
Laboratory (Department of Genetics, Harvard Medical School). The
oligonucleotide sequences for GH, PRL, POMC, and TSHß have been
previously described (17). These probes (0.3 pmol each) were
end-labeled with 25 pmol [-35S]thiodeoxy-ATP (1300
Ci/mmol; New England Nuclear, Boston, MA) using 50 U
terminal deoxynucleotidyl transferase (Boehringer Mannheim, Indianapolis, IN). Each reaction was incubated for 30
min, and the tailing reaction was terminated by adding 2 µl 0.2
M EDTA. Specific hybridization was assessed in control
experiments using a 200-fold excess of unlabeled probe.
In situ hybridization
Deparaffinized tissue sections (6–8 µm) were incubated with
different probes. The oligonucleotide probes (3000 cpm/µl) were
incubated overnight in hybridization solution containing 50% (vol/vol)
formamide, 4 x SSC (standard saline citrate), 1 x (vol/vol)
Denhardt’s solution, 0.5 mg/ml herring sperm DNA, 10% (wt/vol)
dextran, 0.1% (wt/vol) sodium pyrophosphate, and 0.2 mg/ml
polyadenylate overnight at 37 C. The sections were then washed four
times in 1 x SSC for 15 min for 4 at room temperature, four times
in 2 x SSC-50% formamide for 15 min at 37 C, and three times in
1 x SSC for 30 min at room temperature.
Complementary RNA (cRNA) probes (
20,000 cpm) were incubated with
tissue sections in hybridization solution containing 50% (vol/vol)
formamide, 0.3 M sodium chloride, 10 mM
Tris-HCl (pH 7.4), 10 mM NaH2PO4, 5
mM EDTA, 0.2% (wt/vol) Ficoll 400, 0.2% (wt/vol)
polyvinylpyrrolidone, 50 µg/ml yeast transfer RNA, 10% (wt/vol)
dextran sulfate, and 0.5 mg/ml polyadenylate. Sections were then washed
four times at 65 C in 50% formamide, 2 x SSC, and 20
mM ß-mercaptoethanol for 40 min each; three times at 37 C
in 4 x SSC, 20 mM Tris-HCl (pH 7.6), and 1
mM EDTA for 10 min each; and once at 37 C in 2 x SSC
for 10 min. The slides were then coated with Kodak NTB-2 emulsion and
exposed to Kodak Biomax MR or on CRONEX 3 film (Eastman Kodak Co., Rochester, NY). The sections were then developed and
counterstained with Hoecsht for 2 min, rinsed in water, and embedded in
Canada balsam and methyl salicylate.
Histological approaches
Animals were killed by approved methods, and cranial contents
were exposed. In cases of large tumors, the brain with attached tumor
mass was removed and fixed in 4% paraformaldehyde. In animals in which
tumors were not grossly detected, the brain was removed, and the region
of the sella turcica was dissected en bloc along with its
contents. These tissues were similarly fixed in 4% paraformaldehyde
and subjected to mild decalcification. Tissue was processed according
to standard protocols, and 4- to 6-mm sections were cut from paraffin
blocks. Sections were stained with hematoxylin and eosin and for
reticulin fibers, using standard methods.
|
Results
|
|---|
Generation of transgenic mice
Transgenic mice were generated using a hybrid transgene containing
1.2 kb of the 5'-flanking region of the mGnRH-R gene and +5234/+2533 of
the SV40 genome, which encodes the large TAg (GnRH-R/TAg; Fig. 1
). Three founders were identified by PCR
analysis of tail genomic DNA. Two of the founders, mouse 28 (M28,
female) and mouse 25 (M25, male), were stunted in growth and were
sterile (Table 1). These mice developed
grossly enlarged crania with intracranial tumors at 37 and 50 days of
age, respectively. In contrast to these two founders, mouse 29 (M29,
male) was fertile and attained a normal body size. M29 developed a
grossly enlarged cranium, and an apparent pituitary mass was seen at
103 days. All transgenic mice displayed decreased locomotor activity,
sluggish responses to external stimuli, and difficulty in maintaining
balance, with a tendency to fall or veer to one side. Gross examination
of other organs failed to show any other tumor formation.
View larger version (7K):
[in this window]
[in a new window]
|
Figure 1. The mouse GnRH-R gene promoter and SV40 large TAg
transgene. A fragment of the mouse GnRH-R gene promoter (-1164/+52)
was subcloned into pBluescript KS and then fused with sequences coding
for the large TAg of SV40 (+2533/+5234).
|
|
Derivation and characterization of the M29 transgenic
line
Transgenic mice heterozygous for the GnRH-R/TAg transgene were
bred from the M29 founder. This transgenic line was denoted the M29
line. Homozygous mice were not obtained because all heterozygote
females were infertile in the presence or absence of grossly evident
pituitary tumors. The M29 heterozygote females exhibited a grossly
normal appearance of the external genitalia and the reproductive tract.
However, light microscopy of ovaries from 8-week-old mice showed
numerous preovulatory follicles, but no corpus luteum formation (Fig. 2), in contrast to corpora lutea and
follicles at various stages of development in comparable age-matched
nontransgenic animal controls. Superovulatory doses of gonadotropins
(PMSG and hCG) induced follicular maturation, ovulation, and corpus
luteum formation in M29 mice (data not shown). These studies indicate
that the ovaries can respond appropriately to gonadotropin stimulation,
and that abnormal ovarian development in M29 females is probably due to
abnormal and/or deficient pituitary gonadotropin secretion.
View larger version (74K):
[in this window]
[in a new window]
|
Figure 2. Comparison of M29 ovary with wild-type ovary.
Histological examination shows cross-sections from an ovary from an
8-week-old M29 transgenic mouse (A) and an ovary from a littermate
wild-type mouse (B). Sections (7 µm) were stained with hematoxylin
and eosin.
|
|
Mating of heterozygote M29 males and wild-type females resulted in 14
litters with 147 offspring, of which 79 mice expressed the transgene.
The development of tumors did not appear to be affected by gender (42
males and 37 females). There was no significant fetal or perinatal
death, and the affected/unaffected ratio followed the expected
Mendelian ratio. All of the transgenic mice developed tumors in the
anterior pituitary by 4–5 months of age, with the exception of those
animals that were killed at an early age. Tumor size was highly
variable in both animals from the same litter and those from different
litters. These tumors attained 3- to 5-fold the size of the normal
pituitary.
Development of pituitary tumors
The availability of the M29 transgenic line allowed us to obtain
tumors at different stages of development. Mice were killed at
different ages and examined for the presence of tumors. At early stages
of tumor formation in the M29 transgenic line, there was no distortion
of the cranium. The tumor was found centered on the sella turcica, with
minimal displacement of the optic tract or other structures (Fig. 3).
View larger version (137K):
[in this window]
[in a new window]
|
Figure 3. Suprasellar location of the tumors. In A, the
cranium is reflected to reveal a small tumor (T) that sits on the sella
turcica at the base of the brain with minimal displacement cranial
nerve V (arrows) running laterally on either side. In B,
the sella (S) is expanded in association with the enlarging tumor
mass.
|
|
Larger tumors were observed in older M29 transgenic mice as well as the
three founders. The larger tumors were observed at an earlier age in
the founders compared with individual mice of the M29 transgenic line
(4–5 months). Upon dissection of the head, reflection of the skin
showed an enlarged cranium with attenuated bony structures. Removal of
the bone showed normally formed cerebral hemispheres with evidence of a
sizable mass effect on the basal surface of the skull. The main tumor
mass was nodular and irregular with a variegated surface. The tumors
were fairly well circumscribed with the inferior portion of larger
lesions having an irregular, infiltrating edge. In contrast, the normal
pituitary was ovoid and had a smooth, homogeneous appearance. Despite
the size of the tumors and their close proximity to the brain, even the
larger tumors could be easily separated from the surrounding brain.
Microscopically, the smaller tumors showed areas of normal pituitary
tissue with single tumor cell infiltration as well as transition areas
of increasing atypia (Fig. 4). The tumor
cells were heterogeneous with two main cell populations. There was a
predominance of small round cells with scant cytoplasm and large,
bizarre giant cells with hyperchromatic vacuolated nuclei, abundant
eosinophilic cytoplasm, and prominent nucleoli. The larger cells were
more prominent at the infiltrating edge of the tumor. The tumor cells
were mostly mononuclear, but nuclear pleomorphism with multilobulation
was evident. A fibrous stroma surrounded the cells. Larger tumors
presented the same histology, with little if any identifiable normal
pituitary tissue.
View larger version (66K):
[in this window]
[in a new window]
|
Figure 4. Histological appearance of a representative
pituitary tumor. A coronal section of the entire brain and pituitary
tumor from a 5-month-old M29 transgenic mouse is shown. The samples
were decalcified, and the tissues were sectioned and then stained with
hematoxylin and eosin. A shows a low powered view (x2.5) of a well
circumscribed tumor with infiltrating inferior margins. The tumor is in
close approximation with the surrounding brain parenchyma. On higher
magnification (B; x100), as indicated by the right
arrow, one can see normal pituitary tissue with transitional
areas of increasing atypia. The left arrow indicates a
large giant cell, which is common throughout the tumor.
|
|
In situ hybridization for pituitary hormones
To characterize tumor expression of genes encoding pituitary
hormones as well as GnRH-R and TAg, in situ hybridization
was performed using 35S-labeled cRNA and oligonucleotide
probes. We were particularly interested in the glycoprotein hormone
-, FSHß-, and LHß-subunits mRNAs encoding; and the GnRH-R,
all of which are markers of a mature pituitary gonadotrope.
In Figure 5, in situ
hybridization of sagittal sections of the entire brain and tumor from a
5-month-old M29 transgenic mouse was performed. The results
demonstrated that the -subunit and GnRH-R mRNAs were specifically
and abundantly expressed in the tumor. The surrounding brain did not
hybridize with any of these probes and provided an internal negative
control. The tumor also expressed FSHß, LHß, and TAg mRNAs over the
entire tumor, albeit in lesser amounts. The same probes were used to
examine hormone and GnRH-R expression in wild-type pituitary (data not
shown); the results of these experiments were similar to those
previously reported by Japon et al. (17).
Additional in situ hybridization studies of a larger tumor
from another 5-month-old transgenic mouse showed that the different
pituitary hormones were expressed in a heterogeneous pattern (Fig. 6). This tumor largely expressed -,
FSHß-, and LHß-subunits and GnRH-R mRNAs. Both FSHß and
LHß mRNAs were expressed in all tumors, although the pattern of
expression in each tumor varied. In the tumor shown in Fig. 6, both
gonadotropins were diffusely expressed over the entire tumor. This
contrasts with the focal and minimal expression of the other pituitary
hormones mRNAs: GH, PRL, POMC, and TSHß. Such discrete areas of
expression may represent the presence of remnants of the normal
pituitary that are still functional. The prevalence of gonadotrope
markers with the virtual absence of GH, PRL, POMC, and TSHß mRNAs
indicated that these tumors were of gonadotropic origin.
Tumor-specific expression of TAg
Tumors and various tissues were obtained from the transgenic mice
and analyzed for GnRH-R gene promoter-directed TAg expression by
RT-PCR. Deoxyribonuclease treatment of total RNA samples was performed
to eliminate contamination with genomic DNA. Normal pituitary from
wild-type animals was used as a negative control. mRNA from T3 cells
was used as a positive control for TAg expression. Both small and large
pituitary tumors were assessed. RT-PCR analysis of the different
tissues showed that TAg was expressed only in pituitary tumors (Fig. 7). TAg was not detected in the male and
female gonads or in any of the other tissues obtained from transgenic
mice. These results indicate that 1.2 kb of the 5'-flanking region of
the mGnRH-R gene promoter direct TAg expression specifically to the
pituitary gland.
View larger version (16K):
[in this window]
[in a new window]
|
Figure 7. Transgene expression in transgenic tissues. Total
RNA from various endocrine and nonendocrine tissues of the M29
transgenic mice were prepared. RT-PCR analysis was performed to detect
TAg mRNA expression. Control experiments were also performed in which
reverse transcriptase was not added (-). TAg cDNA was then amplified
by PCR. mRNA for L19, a ribosomal protein, was used as a positive
control for all of the samples.
|
|
|
Discussion
|
|---|
In summary, our studies indicate that 1.2 kb of the 5'-flanking
region of the mGnRH-R gene can target oncogene expression specifically
to the pituitary in vivo. This was demonstrated by both
in situ hybridization and RT-PCR analysis. The GnRH-R gene
promoter-directed expression also appears to be cell-specific and
results in the formation of pituitary tumors that are primarily of
gonadotropic origin. These results correlate with our previous studies,
in which the GnRH-R gene promoter dictates pituitary cell-specific
transcriptional activation (7).
The promoter-specific targeting of oncogene expression in transgenic
mice has been used extensively to study tissue-specific and
developmental patterns of transcriptional regulation as well as to
generate specific immortalized cell lines. The SV40 TAg is particularly
effective in inducing tumor formation in a variety of tissues in
conjunction with its own promoter as well as heterogeneous promoters
(8, 18). In the pituitary, Mellon and colleagues (19, 20, 21, 22) have obtained
targeted oncogenesis to specific cell types using the and LHß
promoters. Cell lines generated from these studies have been extremely
useful in the characterization of gondotrope cell function.
The M29 transgenic mice developed pituitary tumors that were grossly
evident at 4–5 months of age. However, the effects of TAg oncogene
expression are apparent before this stage, as evidenced by the
inability of the mice to reproduce. As the TAg is expressed in the M29
pituitary but not in the ovary, infertility in females is most likely
due to a defect in pituitary function. The absence of corpora lutea
probably indicates the absence of ovulatory signals. Pituitary
secretion of physiological levels of gonadotropins may be altered so
that further follicular differentiation and ovulation do not occur. The
response of the ovaries in M29 females to large doses of gonadotropin
is consistent with this view.
The glycoprotein hormones, -, FSHß-, and LHß-subunits, and the
GnRH-R are all expressed in gonadotropes. Although the -subunit is
common to both thyrotropes and gonadotropes, the FSHß- and
LHß-subunits are found exclusively in gonadotropes (17). GnRH-Rs are
also abundantly and specifically expressed in the gonadotrope. Our
in situ hybridization studies show that the tumors express
all four gonadotrope-specific markers. The -subunit and GnRH-R mRNAs
are strongly expressed, which is consistent with their abundant
expression in the normal pituitary. Also, the lower levels of
expression of the FSHß- and LHß-subunits are consistent with the
relatively lower transcriptional activities of these hormone
subunits.
In contrast to pituitary tumors generated using the - and
LHß-subunit promoters (19, 22), the GnRH-R/TAg induces tumors that
express both FSHß- and LHß-subunits. In the rodent embryo (17, 23),
GnRH-R binding sites in the pituitary have been detected on embryonic
day 12, one day after -subunit expression and 4 days before the
expression of LH and FSHß-subunits. It is possible that the later
transcriptional activation of the GnRH-R gene promoter, compared with
that of the -subunit gene promoter, allows further gonadotrope
differentiation. It is also possible that the higher transcriptional
activity of the -subunit promoter results in the expression of
higher levels of TAg and arrests further differentiation of the
gonadotrope. Indeed, TAg has been proposed to inhibit differentiation
of precursor neuron cells in olfactory neuroepithelium (24). Therefore,
the later expression of the GnRH-R gene promoter as well as its weaker
promoter activity may allow differentiation of the gonadotrope to one
that can express both ß-subunits.
Grossly, the pituitaries of the transgenic mice have a normal
appearance in the initial stages. As the pituitaries enlarged and the
tumors became grossly evident, changes in pituitary hormone expression
occurred. Gonadotropin subunit mRNA expression was diffusely abundant
in all tumors examined. Their expression levels persisted, but varied
in the different tumors. In contrast, the other pituitary hormones had
focal and minimal expression in the same tumors. GH and PRL mRNA
expression had similar discrete patterns of expression, which suggested
the presence of somatolactotropes. The expression of both of these
hormones was low in most tumors. TSHß mRNA expression was minimal,
although its pattern of expression was similar to that seen in normal
pituitary. POMC mRNA was also usually found focally along the periphery
on one edge of the tumor and probably represented rim tissue that had
been pushed aside by the central expanding tumor mass. These localized
areas of hormone gene expression may represent remnants of normal
pituitary tissue. Indeed, transition areas of normal pituitary cells
and tumor can be seen in most samples. The persistence of gonadotropin
expression and the prevalence of gonadotrope markers as well as the
discrete expression of POMC, TSHß, GH, and PRL suggest that the
pituitary tumors are of gonadotropic origin.
As the expression of TAg is driven by the GnRH-R gene promoter, the
levels of TAg mRNA can therefore be used to evaluate mGnRH-R gene
promoter activation and consequently the level of mGnRH-R mRNA
expression. As expected, TAg and GnRH-R mRNAs had a similar diffuse
pattern of expression throughout the tumor, as shown by in
situ hybridization in Figs. 5
and 6. In addition, RT-PCR analysis
for TAg mRNA suggests that the GnRH-R gene promoter directed transgene
expression solely to the mouse pituitary. TAg mRNA was not detected in
any other extrapituitary tissues examined, including ovary and testis.
In the rat, extrapituitary GnRH-Rs have been identified in the ovary,
testis, and hippocampus (1, 2, 3). However, studies in the mouse failed
to establish the presence of receptors in these extrapituitary tissues
(1, 5). Thus, the results of these studies are consistent with the
presence of GnRH-R in various tissues with patterns of expression that
may be distinct for different species.
In this study we have shown that 1.2 kb of the 5'-flanking region of
the mGnRH-R gene contains regulatory sequences that direct gene
expression specifically to the pituitary in vivo. We have
developed a stable transgenic mouse model that consistently develops
pituitary tumors. These tumors are capable of expressing the -,
FSHß-, and LHß-subunits and GnRH-R mRNAs, all of which are markers
of a gonadotrope. As such, this transgenic line may provide a useful
model for studies of the transcriptional regulation of the genes
encoding GnRH-R and the glycoprotein hormone subunits. The pituitary
tumors may also be useful for the development of functional gonadotrope
cell lines.
|
Acknowledgments
|
|---|
We thank the members of Dr. Dick Maas’ laboratory for their
invaluable technical advice throughout this project; Dr. Lisa Halvorson
for initial transfection studies; and Drs. Gumersindo
Fernandez-Vasquez, Ursula Kaiser, Akira Sugawara, and Jabeen Jafri for
helpful comments. Thanks also to Steve Gisselbrecht for help with the
figures.
|
Footnotes
|
|---|
1 This work was supported in part by NIH Grant HD-19938 (to W.W.C.)
from the NICHD and a Lalor Foundation Fellowship Award (to C.T.A.). 
2 Present address: Department of Pathology, University of Chicago
Hospitals, 5812 South Maryland, Chicago, Illinois 60637.
Received October 22, 1998.
|
References
|
|---|
-
Reubi JC, Palacios JM, Maurer R 1987 Specific
luteinizing-hormone-releasing hormone receptor binding sites in
hippocampus and pituitary: an autoradiographical study. Neuroscience 21:847–856[CrossRef][Medline]
-
Bauer-Dantoin AC, Jameson JL 1995 Gonadotropin-releasing hormone receptor messenger ribonucleic acid
expression in the ovary during the rat estrous cycle. Endocrinology 136:4432–4438[Abstract]
-
Jones PB, Conn PM, Marian J, Hsueh AJ 1980 Binding of gonadotropin releasing hormone agonist to rat ovarian
granulosa cells. Life Sci 27:2125–2132[CrossRef][Medline]
-
Peng C, Fan N, Ligier M, Vanaanen J, Leung
PCK 1994 Expression and regulation of gonadotropin-releasing
hormone (GnRH) and GnRH-R messenger ribonucleic acids in human
granulosa-luteal cells. Endocrinology 135:1740–1746[Abstract]
-
Ackerman RC, Johnson GA, Kirk EAV, Asirvatham
AL, Murdoch WJ 1994 Induction of apoptotic or lytic death in an
ovarian adenocarcinoma cell line by antibodies against a synthetic N
terminal extracellular domain gonadotopin-releasing hormone receptor
peptide. Cancer Lett 81:177–184[CrossRef][Medline]
-
Murdoch WJ 1995 Immunolocalization of a
gonadotropin-releasing hormone receptor site in murine endometrium that
mediates apoptosis. Cell Tissue Res 282:527–529[Medline]
-
Albarracin CT, Kaiser UB, Chin WW 1994 Isolation and characterization of the 5'-flanking region of the mouse
gonadotropin-releasing hormone receptor gene. Endocrinology 135:2300–2306[Abstract]
-
Suda Y, Aizawa S, Hirai S, Inoue T, Suzuki M,
Hirohashi S, Ikawa Y 1987 Driven by the same Ig enhancer and SV40
T promoter ras induced lung adenomatous tumors,
myc induced pre-B cell lymphomas and SV40 large T gene a
variety of tumors in transgenic mice. EMBO J 6:4055–4065[Medline]
-
Hanahan D 1985 Heritable formation of
pancreatic ß-cell tumours in transgenic mice expressing recombinant
insulin/simian virus 40 oncogenes. Nature 315:115–122[CrossRef][Medline]
-
DePamphilis ML, Herman SA, Martinez-Salas E,
Chalifour LE, Wirak DO, Cupo DY, Miranda M 1988 Microinjecting DNA
into mouse ova to study DNA replication and gene expression and to
produce transgenic animals. Biotechniques 6:662–680[Medline]
-
Hogan B, Costantini F, Lacy E 1986 Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor
Laboratory, Cold Spring Harbor
-
Laird PW, Zijderveld A, Linders K, Rudnicki
MA, Jaenisch R, Berns A 1991 Simplified mammalian DNA isolation
procedure. Nucleic Acids Res 19:4293–4295[Free Full Text]
-
Chin WW, Kronenberg HM, Dee PC, Maloof F,
Habener JF 1981 Nucleotide sequence of the mRNA encoding the
pre--subunit of mouse thyrotropin. Proc Natl Acad Sci USA 9:5329–5333
-
Chin WW, Godine JE, Klein DR, Chang AS, Tan
LK, Habener JF 1983 Nucleotide sequence of the mRNA encoding the
precursor of the ß subunit of rat lutropin. Proc Natl Acad Sci USA 80:4649–4653[Abstract/Free Full Text]
-
Gharib SD, Roy A, Wierman ME, Chin WW 1989 Isolation and characterization of the gene encoding the
ß-subunit of rat follicle-stimulating hormone. DNA 8:339–349[Medline]
-
Kumar TR, Low MJ 1993 Gonadal steroid
hormone regulation of human and mouse follicle-stimulating hormone
ß-subunit gene expression in vivo. Mol Endocrinol 7:898–906[Abstract]
-
Japon MA, Rubinstein M, Low MJ 1994 In situ hybridization analysis of anterior pituitary hormone
gene expression during fetal mouse development. J Histochem
Cytochem 42:1117–1125[Abstract]
-
Hanahan D 1988 Dissecting multistep
tumorigenesis in transgenic mice. Annu Rev Genet 22:479–519[CrossRef][Medline]
-
Windle JJ, Weiner R, Mellon PL 1990 Cell
lines of the pituitary gonadotrope lineage derived by targeted
oncogenesis in transgenic mice. Mol Endocrinol 4:597–602[CrossRef][Medline]
-
Turgeon JL, Kimura Y, Waring DW, Mellon
PL 1996 Steroid and pulsatile gonadotropin-releasing (GnRH)
regulation of luteinizing hormone and GnRH receptor in a novel
gonadotrope cell line. Mol Endocrinol 10:439–450[Abstract]
-
Alarid ET, Windle JJ, Whyte DB, Mellon PL 1996 Immortalization of pituitary cells at discrete stages of
development by directed oncogenesis in transgenic mice. Development 122:3319–3329[Abstract]
-
Turgeon J, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH)
regulation of luteinizing hormone and GnRH receptor in a novel
gonadotrope cell line. Mol Endocrinol 10:439–450
-
Aubert ML, Begeot M, Winiger BP, Morrel G,
Sizonenko PC, Dubois PM 1985 Ontogeny of hypothalamic luteinizing
hormone-releasing hormone (GnRH) and pituitary GnRH receptors in fetal
and neonatal rats. Endocrinology 116:1565–1576[Abstract]
-
Largent BL, Sosnowski RG, Reed RR 1993 Directed expression of an oncogene to the olfactory neuronal lineage in
transgenic mice. J Neurosci 13:300–312[Abstract]
Top
Abstract
Introduction
