| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada
Address all correspondence and requests for reprints to: Dr. R. E. Peter, Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada. E-mail: dick.peter{at}ualberta.ca
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
SRIF is also a phylogenetically ancient and multigene family of peptides in vertebrates. SRIF-14 has been identified, with the same amino acid sequence, in representative species of all classes of vertebrate (5, 6). In addition, four molecular variants of SRIF-14, [Ser12]SRIF-14, [Ser5]SRIF-14, [Pro2, Met13]SRIF-14 and [Pro2]SRIF-14, have been isolated in nonmammalian vertebrates (7, 8, 9, 10). To date, cDNAs for preprosomatostatin-I (PSS-I), which contains SRIF-14 at its C-terminus, have been cloned in several mammalian species (11, 12, 13, 14), chicken (15), frog (16), and two teleost species (17, 18, 19). The gene for PSS-I has also been characterized in mouse, rat, and human (20, 21, 22).
In addition to having PSS-I, teleost fish possess a second SRIF precursor, PSS-II, a molecule that is thought to be processed to a large form of SRIF (SRIF-28 or SRIF-25) with [Tyr7, Gly10]SRIF-14 sequence at its C-terminus. The cDNA sequence for PSS-II has been identified in anglerfish (18) and rainbow trout (23), providing evidence that somatostatins arose from a multigene family. Amino acid sequences for processing products of PSS-II obtained directly from isolates of islet extracts are also known for several teleost species (24, 25, 26, 27). Recently, a second SRIF messenger RNA (mRNA) encoding a SRIF-14 variant, [Pro2, Met13]SRIF-14, was identified in frog brain (9). In addition, a SRIF-related gene termed as cortistatin (CST) has been described in human, rat and mouse, which gives rise to a precursor that contains a tetradecapeptide at its C-terminus with an 11 amino acid homology with SRIF-14 (28, 29, 30). This suggests the existence of a multigene family for SRIF in tetrapods.
In teleosts, most of the physiological studies of SRIF have been focused on the regulation of pancreatic hormone and metabolism in salmonids (31, 32) and the regulation of GH secretion and growth in goldfish (33). In goldfish, immunoreactive SRIF-14 has been observed in the brain, with fiber tracts that terminate at the proximal pars distalis of pituitary (34, 35). SRIF-14 is a potent inhibitor of basal and stimulated GH release in goldfish (33). In addition, the concentrations of immunoreactive SRIF-14 in various brain regions vary on a seasonal basis inverse to the seasonal variation in serum GH levels (36). The inhibitory actions of SRIF-14 on GH secretion in vitro or in vivo have also been reported in tilapia, rainbow trout, and several other teleost species (33).
In the present study, three distinct SRIF cDNAs were cloned from goldfish brain RNA or cDNA library. The differential brain distribution and seasonal variation of the three SRIF mRNAs were also examined. In addition, the actions of a cDNA-deduced SRIF-14 variant on pituitary GH secretion were investigated using an in vitro perifusion system.
| Materials and Methods |
|---|
|
|
|---|
Reagents and test substances
SRIF-14
(Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys) was obtained
from Sigma Chemical Co. (St. Louis, MO).
[Pro2]SRIF-14 was a gift from Professor H. Kawauchi
(Kitasato University, Sanriku, Japan). SRIF peptides were dissolved in
HBSS immediately before use. sGnRH ([Trp7,
Leu8]GnRH) was purchased from Peninsula Laboratories, Inc. (Belmont, CA). sGnRH was dissolved in 0.1
M acetic acid. Subsequent dilution of all peptides to
appropriate concentrations with culture medium was performed
immediately before drug treatment. Dopamine (DA) D1 receptor agonist,
SKF 38393 (1-phenyl-2,3,4,5-tetrahydro-(1H)-3-benzazepine-7,8-diol
hydrochloride), was purchased from Research Biochemicals International, Inc. (Wayland, MA). SKF 38393 was first dissolved
in dimethyl sulfoxide (DMSO), and then diluted to appropriate
concentration with culture medium. Final levels of DMSO was less than
0.1%, and did not alter basal GH release from goldfish pituitary
fragments (unpublished results). Trizol Reagent, Taq DNA
polymerase and SuperScript Preamplification System were purchased from
Life Technologies (Gaithersburg, MD). T7QuickPrime Kit was
obtained from Pharmacia Biotech (Baie dUrfe,
Québec, Canada). Nybond Nylon membranes and discs, ECL direct
nucleic acid labeling and detection system,
[
-32P]deoxy-CTP (dCTP) were obtained from
Amersham Life Science (Buckinghamshire, UK). JM109
competent cells and pGEM-T vector system were purchased from
Promega Corp. (Madison, WI). Other reagents were of the
highest degree of purity available from commercial sources.
Preparation of total RNA and genomic DNA
Total RNA was extracted from goldfish forebrain (telencephalon,
including optic nerve and preoptic region, and hypothalamus) using
Trizol Reagent, based on the acid guanidinium
thiocyanate-phenol-chloroform extraction method (37). The integrity of
the RNA was verified by ethidium bromide staining of 28s and 18s
ribosomal bands on a denaturing agarose gel. Genomic DNA was isolated
from liver tissue of single fish using Trizol Reagent according to the
manufacturers instruction.
Cloning of three goldfish SRIF cDNAs
For cloning of goldfish PSS-I cDNA, RT-PCR was used to prepare a
DNA probe for screening the goldfish brain cDNA library. cDNA was
synthesized from 4 µg of total RNA from goldfish forebrain using the
SuperScript Preamplification System. For PCR, forward primer SS1-F1
(5'CGGATCCAGTGCGCCCTGGC3') and reverse primer SS1-R1
(5'GTGAAAGTTTTCCAGAAGAA3') were designed on the basis of the coding
region of the catfish PSS-I cDNA sequence (19). Thirty cycles of PCR
amplification were performed with denaturation for 1 min at 94 C,
annealing for 1 min at 50 C, extension for 1.5 min at 73 C, and final
extension for 10 min at 73 C after the last cycle. Amplification
products were separated by agarose gel, and the band of desired size
was excised and purified using a Geneclean II kit (Bio 101, La Jolla,
CA). The purified DNA fragment (323 bp) was subcloned into pGEM-T
vector. The nucleotide sequence analysis indicated that the cloned PCR
product (323 bp) contained a partial coding region for a precursor with
a partial SRIF-14 sequence at its C-terminus. This DNA fragment was
then used as a probe to screen the cDNA library.
A goldfish brain cDNA library (kindly provided by Dr. H. R. Habibi, University of Calgary, Calgary, Alberta, Canada) was constructed using the ZAP-cDNA synthesis kit, including Gigapack II Gold packaging extract (Stratagene, La Jolla, CA). The library was amplified once to a titer of 6 x 109 pfu/ml before being transferred to Nybond-N+ discs at a density of 2 x 104 plaques/filter according to the manufacturers protocol. The filters were probed with the 323 bp DNA probe prepared by PCR as described above. The probe labeling, hybridization, and signal detection were performed using ECL direct nucleic acid labeling and detection systems based on enhanced chemiluminescence (38). A total of 2.5 x 105 clones were screened, out of which six positives were picked and subjected to secondary screening. Three positive clones were obtained from the secondary screening and subjected to in vivo excision according to the instruction of the ZAP-cDNA synthesis kit. The three clones with cDNA inserts of desired size (approximately 750 bp) were sequenced on an PE Applied Biosystems automated sequencer (373A) according to the manufacturers protocol. Sequencing was carried out on both strands using T7 and T3 sequencing primers that flank the insert cDNA.
For cloning of goldfish PSS-II cDNA, RT and rapid amplification of cDNA ends (RACE, 39) were applied. To isolate the 3' end of cDNA for PSS-II, two degenerate primers, DP1 (5'GCIGGITG(CT)AAGAACTTCTA3'] and DP2 (5'AAGAACTTCTA(CT)TGGAAGGG3'], were designed on the basis of the [Tyr7, Gly10]SRIF-14 amino acid sequence of anglerfish and rainbow trout PSS-II (18, 23). RT and RACE were carried out as described previously (40, 41). Briefly, total RNA was reverse transcribed to cDNA with dT-adapter primer [dT-AP, 5'GGCCACGCGTCGACTAGTAC(T)173'] using SuperScript II reverse transcriptase. Two rounds of PCR amplifications were then performed to amplify the 3' end of cDNA with adapter primer (AP, 5'GGCCACGCGTCGACTAGTAC3') and DP1, and AP and internal DP2, respectively. After determining the nucleotide sequence of the cDNA 3' end, new cDNA was synthesized by RT of total RNA with gene specific primer 1 (GSP1, 5'TTAACTTACATTGAGTCAGTTGA3'). After 3'-end tailing of the cDNA with poly(A) using TdT (Life Technologies), the second strand cDNA was synthesized using dT-AP. Two rounds of PCR amplifications were then carried out to amplify the 5' end of cDNA with AP and GSP1, and AP and internal gene specific primer 2 (GSP2, 5'CAAGCGAGGGCCTCAGCAGG3'), respectively. PCR products were fractionated and the desired bands were purified and subcloned using pGEM-T vector system. DNA sequence analyses were carried out as described above.
To confirm the PSS-II cDNA sequence obtained from RT and RACE, PCR of goldfish genomic DNA was carried out to obtain a partial gene sequence that contained the full coding region for PSS-II. PCR amplification was performed using 100 ng of genomic DNA as template and primers SS2-F1 (5'CGAATCACAGCTACAAAGAGTC3') and SS2-R1 (5'CAAGCGAGGGCCTCAGCAGG3') designed from the 5' and 3' ends of the isolated PSS-II cDNA sequence. PCR products were purified and subcloned into the pGEM-T vector. DNA sequence analyses were carried out as described above using T7 and M13 reverse sequencing primers and gene specific primers.
For cloning of the third SRIF cDNA, the goldfish brain cDNA library was screened using partial goldfish PSS-II cDNA as probe. A 426-bp DNA probe was prepared by PCR with primer set, SS2-F1, and SS2-R1 specific for the cloned cDNA sequence for PSS-II, and PSS-II cDNA as template. The probe was then used to screen the cDNA library as described above. The probe labeling, hybridization, and signal detection were performed using ECL direct nucleic acid labeling and detection systems. A total of 2 x 105 clones were screened, out of which three positives were picked and subjected to the secondary screening. Two positive clones were obtained from the secondary screening and subjected to in vivo excision and sequence analysis as described above.
Brain distribution of three goldfish somotostatin mRNAs
Tissues of five discrete goldfish brain areas, olfactory bulbs
and tracts, telencephalon (including optic nerve and preoptic region),
hypothalamus, optic tectum-thalamus, and posterior brain (including
cerebellum, medulla and spinal cord), and pituitary were freshly
excised and homogenized for extraction of total RNA using Trizol
Reagent as described above. About 10 µg of total RNA from individual
tissues were fractionated by electrophoresis in a denaturing agarose
gel (1.5%) with formaldehyde and blotted onto Nybond nylon membrane by
capillary transfer. The cDNAs for goldfish PSS-I, PSS-II, and PSS-III
were labeled with [
-32P]dCTP using T7QuickPrime Kit.
Hybridization was performed using methods described by Church and
Gilbert (42). In brief, the membranes were prehybridized in
hybridization solution (0.5 M NaHPO4, 7% SDS,
1 mM EDTA, and 1% BSA) for at least 1 h. The
hybridization solution was then changed, and the labeled probe was
added. After hybridization overnight at 65 C, the membranes were washed
three times with washing solution (0.04 M
NaHPO4, 1 mM EDTA, and 1% SDS) and exposed to
a phosphoimaging screen for 72 h. To serve as an internal control,
the membrane was stripped and reprobed with a
[
-32P]dCTP-labeled partial cDNA for goldfish
-tubulin (kind gift from Dr. H. R. Habibi, University of
Calgary, Calgary, Alberta, Canada).
The brain distribution of the three goldfish somatostatin mRNAs was further confirmed by RT-PCR followed by Southern blot analysis. First strand cDNA was prepared from total RNA using the SuperScript Preamplification System and used as templates for PCR using specific primers for the three goldfish SRIF mRNAs. The primer sets are: SS1-F2 (5'GCGTATCCAGTGCGCACTGGC3') and SS1-R2 (5'GTGAAAGTTTTCCAGAAGAA3') for PSS-I mRNA, SS2-F1 (5'CGAATCACAGCTACAAAGAGTC3') and SS2-R1 (5'CAAGCGAGGGCCTGAGCAGG3') for PSS-II, and SS3-F1 (5'GGAGCTACAAGACTTCAAC3') and SS3-R1 (5'CTGTGTCAGAGTAAGTCCACG3') for PSS-III. PCR condition was denaturation 1 min at 94 C, annealing 1 min at 51-55 C and extension 1 min at 73 C for a total of 30 cycles, and a final extension of 10 min at 73 C. For internal control, RT-PCR was performed at the same time using a primer set (Actin-F: CTACTGGTATTGTGATGGACTCCG; Actin-R: TCCAGACAGAGTATTTGCGCTCAG) for goldfish ß-actin. Twenty microliters of each PCR reaction were fractionated on 1.5% agarose gel and transferred onto a Nybond nylon membrane by capillary transfer. The membranes were then hybridized with cDNA probes for one of the three goldfish SRIF mRNAs, using ECL direct nucleic acid labeling and detection systems.
Seasonal variation of three goldfish somatostatin mRNAs
Tissue samples of forebrain regions of 20 goldfish were
collected on April 3, July 31, and December 21 of the same year,
respectively, and stored at -80 C until total RNA was extracted. The
mRNA levels for each PSS form in the total RNA samples were analyzed
using Northern blot as described in the previous section. The
hybridization signals were scanned using phosphorimaging
(Molecular Dynamics, Inc., Sunnyvale, CA) and quantitated
by ImageQuant software (Molecular Dynamics, Inc.). The
mRNA levels for each PSS form were expressed as a ratio of PSS mRNA to
-tubulin mRNA. These ratios were then normalized as a percentage of
mRNA levels from male fish collected in April.
Column perifusion of goldfish pituitary fragments
To examine the actions of the deduced SRIF-14 variant,
[Pro2]SRIF, on pituitary GH secretion, an in
vitro column perifusion system for goldfish pituitary fragments
was used (43). In brief, goldfish (sexually recrudescent) pituitary
fragments (0.2 mm3) from 30 pituitaries were divided over 8
columns. The pituitary fragments were perifused overnight (1518 h)
with M199 (Life Technologies) containing 56 U/ml Nystatin
(Sigma Chemical Co.), at a flow rate of 5 ml/h. Two hours
before the experiment, the perifusion medium was switched to HBSS
containing 25 mM HEPES and 0.1% BSA (Sigma Chemical Co.), and the flow rate increased to 15 ml/h. After this period
of continuous perifusion, GH release from the pituitary fragments
remained relatively stable in the absence of stimulation. Test
substances were then applied from a drug reservior to the perifusion
column through a three-way stopcock. Perifusate samples were collected
in 5-min fractions and stored frozen at -25 C. GH contents in these
samples were assayed using a RIA previously validated for goldfish GH
(43).
For the dose-response study, goldfish pituitary fragments were administered with 2 min pulses of increasing doses of [Pro2]SRIF-14 or SRIF-14 from 0.01 nM to 100 nM at intervals of 30 min. To examine the actions of [Pro2]SRIF-14 on stimulated GH release from pituitary fragments, the pituitary fragments were first exposed to a 2-min pulse of 1 µM SKF 38393 or a 5-min pulse of 100 nM sGnRH. Sixty min after the pulse of sGnRH or SKF 38393, the fragments were exposed to 100 nM [Pro2]SRIF-14 or medium (control) for 60 min. During the exposure to SRIF or medium, the fragments were also exposed to the second pulse of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min). A third pulse of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min) was administered to the fragments 60 min after exposure to SRIF or medium. The interval between each of the three pulses of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min) was 90 min.
Data transformation and statistics
GH data from each column were expressed as a percentage of the
mean GH contents of the first six fractions (30 min) collected at the
beginning of perifusion before any drug treatment commenced (referred
to as % pretreatment) (43, 44). This data transformation allows
pooling of GH data from separate columns of the same experiment. GH
responses were quantified by calculating the accumulated net change in
GH release during the 30-min period (6 fractions) after a pulse of drug
treatment (i.e. a net change in the area under the curve).
Dose-response curves for [Pro2]SRIF-14 and SRIF-14 were
analyzed with the ALLFIT computer program to obtain the respective
ED50 values (45). Data for GH release quantitated by RIA
and SRIF mRNA levels quantitated by Northern blot analysis were
subjected to statistical analyses using ANOVA followed by Fishers
least significant difference (LSD) test. Differences were considered
significant at P < 0.05.
| Results |
|---|
|
|
|---|
|
Screening of the goldfish brain cDNA library using partial PSS-II cDNA
as probe identified two positive clones. After secondary screening, two
positive clones were characterized by nucleotide sequence analysis. The
identity of the sequence indicates a novel cDNA, as the deduced peptide
sequence contains a SRIF-14 variant with a proline substitution at
position 2 of SRIF-14. The 694 bp of goldfish PSS-III cDNA (GenBank
accession number U72656) is shown in Fig. 1C
, along with the deduced
amino acid sequence of the precursor (PSS-III). The cDNA is comprised
of a 104 bp 5'-untranslated region, 336 bp of open reading frame, and a
254 bp 3'-untranslated region, which contains a modified
polyadenylation signal (ATTAAA) and a poly (A) tail. The deduced
111-amino acid precursor consists of a putative signal peptide sequence
of 19 amino acids from position +1 to 19. The precursor contains an
Arg-Lys dibasic site at position +96 and +97, potentially processing
into [Pro2]SRIF-14. In addition, the precursor contains
two Arg monobasic sites at +87 and +82, potentially generating a
24-amino acid peptide and a 29-amino acid peptide, respectively.
The nucleotide sequence similarity of the precursor coding regions of
the three goldfish SRIF cDNAs are 53%, 22%, and 15% between PSS-I
and PSS-II cDNA, PSS-I and PSS-III cDNA, and PSS-II, and PSS-III cDNA,
respectively. The amino acid sequence similarity between three goldfish
PSSs are 38%, 32%, and 18% between PSS-I and PSS-II, PSS-I and
PSS-III, and PSS-II and PSS-III, respectively. Table 1
summarizes the percentage amino acid
sequence similarity of the known PSS between goldfish and other
veterbrate species. The multiple sequence alignment was performed using
Clustal W program at the online service website of European
Bioinformatics Institute.
|
-32P]-labeled probe for PSS-I mRNA were found in the
pituitary and in all brain areas except the olfactory bulbs.
Hybridization signals to the probe for PSS-II mRNA were only found in
the hypothalamus and optic tectum-thalamus. Hybridization signals to
the probe for PSS-III mRNA were detected in the olfactory bulbs,
telencephalon, hypothalamus and optic tectum-thalamus. The
-tubulin
transcript as an internal control was observed in all of the tissues
examined (Fig. 2A
|
Seasonal variation of three goldfish SRIF mRNAs
To examine the seasonal variation of the three SRIF mRNAs,
total RNA prepared from forebrain tissue of male or female goldfish
collected in April (sexually mature), July (sexually regressed) or
December (sexually recrudescent) was used to quantitate mRNA levels for
each SRIF mRNA using Northern blot analysis.
Seasonal changes in PSS-I mRNA levels were observed for female but not
male fish (Fig. 3A
). Females in December
and April exhibited significantly higher levels of PSS-I mRNA than that
in July, but there were no significant differences in PSS-I mRNA levels
between female fish collected in April and in December. Male fish
showed no significant differences in PSS-I mRNA levels between April,
July, and December. No sexual differences in mRNA levels for PSS-I were
seen in July or December (Fig. 3A
). In April, however, female fish had
significantly higher levels of PSS-I mRNA levels than males.
|
Seasonal alterations in PSS-III mRNA levels were observed in both
females and males (Fig. 3C
). Both female and male fish in July had the
highest levels of PSS-III mRNA. In addition, female fish had
significantly higher levels of PSS-III mRNA in April compared with that
in December. In contrast, male fish in December had significantly
higher PSS-III expression compared with that in April, but there was no
difference in PSS-III mRNA levels between males in July and in December
(Fig. 3C
). Significant sexual differences in mRNA levels for PSS-III
were observed in both April and December (Fig. 3C
). In December, males
expressed significantly higher PSS-III than females. In contrast, in
April females expressed higher PSS-III than males.
Actions of [Pro2]SRIF-14 on goldfish pituitary GH secretion
Direct actions of [Pro2]SRIF-14 on GH release were
examined in goldfish pituitary fragments under column perifusion. Both
SRIF-14 and [Pro2]SRIF-14 (0.01100 nM)
inhibited basal GH secretion from goldfish pituitary fragments in a
dose-dependent manner, with similar potency between the GH release
response to SRIF-14 and to [Pro2]SRIF-14 (Fig. 4
). The ED50 values of
[Pro2]SRIF-14 and SRIF-14 were 2.33 ± 2.17
nM and 3.56 ± 2.43 nM, respectively. GH
secretion after each pulse rapidly returned to baseline levels, with
increasing duration of the inhibition with increasing concentrations of
SRIF peptides.
|
|
| Discussion |
|---|
|
|
|---|
Posttranslational processing of PSS-I has been well studied in mammals and some fish species (6). In mammals, processing of PSS-I by converting enzymes is tissue specific. In brain, pancreas, and stomach, PSS-I is primarily hydrolyzed to yield SRIF-14 by cleavage at Arg-Lys dibasic sites, whereas in the intestine, PSS-I is mostly processed to SRIF-28 by cleavage at an upstream Arg monobasic site (48, 49). In nonmammalian vertebrates, SRIF-14 is the only PSS-I product identified in extracts of the pancreas of all species of birds, reptiles, and amphibias studied to date (6) and in islet tissue from some fish species (24, 25, 26, 50, 51). Therefore, according to the processing of PSS-I in other species, goldfish PSS-I is likely processed at the Arg-Lys dibasic site to generate SRIF-14, identical to the mammalian SRIF-14 (1). However, it is also possible that goldfish PSS-I can be processed at monobasic Arg site to yield SRIF-26, which has only three residue substitutions compared with bowfin SRIF-26 (52). The SRIF-26 is the most abundant SRIF component in extracts of the islet organ in bowfin, and SRIF-14 is present as a minor component in this species (52). Similarly, catfish PSS-I contains a monobasic Arg site, which could generate a SRIF-26 with an identical sequence to the proposed goldfish SRIF-26 (19).
Processing of PSS-II into SRIF-25 or SRIF-28 has been demonstrated indirectly by isolates of islet or intestine extracts from several fish species (24, 25, 26, 27). In anglerfish, both PSS-I and PSS-II contain dibasic and monobasic cleavage sites that could be cleaved respectively to generate SRIF-14 and SRIF-28 (17, 18). However, it has been shown that anglerfish SRIF-14 and SRIF-28 are two separate and independent products of anglerfish PSS-I and II, respectively, although both precursors are also cleaved at corresponding mono- and dibasic sites to some minor extent (50, 53, 54, 55), and both PSSs are expressed in different cells of the Brockmann body (56, 57). On this basis, it is suggested that goldfish PSS-II is likely processed at the monobasic Arg site to yield SRIF-28, which contains [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus. The goldfish SRIF-28 deduced from the cloned cDNA has 7 amino acids different from anglerfish SRIF-28 (18). Recently, a SRIF-28 peptide was isolated from goldfish intestine (27), with 5 amino acids different from the goldfish SRIF-28 deduced from cDNA in this study. These results suggest that there are at least two forms of SRIF-28 in goldfish, which may be differentially expressed in specific tissues.
Goldfish PSS-III deduced from the third cDNA sequence contains dibasic Arg-Lys site to generate [Pro2]SRIF-14 at its C-terminus. [Pro2]SRIF-14 has been identified in Russian sturgeon, a modern representative of the primitive bony fish (10). Sturgeons are one of the extant representatives of chondrosteans that gave rise to holosteans and teleosts. In addition, sturgeons exhibit dramatic similarities with amphibians; in particular they possess a functional hypothalamic-hypophysial blood portal system similar to the tetrapods, a system that is vestigial or absent in teleosts (58). A SRIF-14 variant [Pro2, Met13]SRIF-14 was identified and subsequently its cDNA was cloned from an amphibian species (9, 16). Recently, cDNA encoding a SRIF-related peptide, CST, has been characterized in several mammalian species (28, 29, 30). Preprocortistatin contains 112 amino acids with the sequence of a lysine-extended SRIF-14-related peptide at its C-terminus. CST-14 binds to mammalian SRIF receptors (sst) and inhibits stimulated-cAMP production likely through sst (28, 30). In addition, [Pro2]SRIF-14, [Pro2, Met13]SRIF-14 and rat CST-14 all contain Gly-Pro substitution at position 2 (position 1 for CST), although the functional implication of this substitution is unclear. Given the presence of [Pro2]SRIF-14 in both sturgeon and goldfish and the close phylogenetic relationship between goldfish [Pro2]SRIF-14 precursor (PSS-III) and [Pro2, Met13]SRIF-14 and CST precursors, the [Pro2]SRIF-14 gene may be the origin for the [Pro2, Met13]SRIF-14 and CST genes and represent an evolutionary branch of the SRIF family.
In the present study, [Pro2]SRIF-14 peptide inhibited basal GH release from goldfish pituitary fragments in a dose-dependent manner, with similar potency to SRIF-14. In addition, [Pro2]SRIF-14 inhibited sGnRH- or DA D1 receptor agonist-stimulated GH release from goldfish pituitary fragments; sGnRH and dopamine are two major stimulators of pituitary GH secretion in goldfish (43, 44). These results suggest that [Pro2]SRIF-14 is a biologically active form of SRIF in goldfish. In frogs, [Pro2, Met13]SRIF-14 is more potent than SRIF-14 in competing with the radioligand in receptor binding studies, and both [Pro2, Met13]SRIF-14 and SRIF-14 inhibit GH secretion from the frog pituitary (59).
In goldfish, immunoreactive SRIF (SRIF-ir) has been demonstrated in the brain using antiserum recognizing equally well mammalian SRIF-14 and SRIF-28 (34, 35). SRIF-ir neurons were widely distributed in the telencephalon, diencephalon, including the preoptic region, ventrobasal hypothalamus, epithalamus, midbrain, reticular formation and spinal cord (35). In the present study, distribution of the three SRIF mRNAs were consistently observed in the telencephalon, hypothalamus, and optic tectum-thalamus. However, the distribution of the three SRIF mRNAs were differential in the other brain regions. PSS-I mRNA was also detected in the posterior brain area by both RT-PCR and Northern blot analysis, consistent with the previous observation of SRIF peptide localization using immunocytochemistry. PSS-II mRNA was restricted in the forebrain and midbrain areas. PSS-III mRNA was also detected in posterior brain by RT-PCR but not by Northern blot analysis, suggesting lower expression levels of PSS-III mRNA in this brain area. In addition, PSS-III mRNA was detected in the olfactory bulbs by both RT-PCR and Northern blot analysis, whereas mRNAs for PSS-I and PSS-II were not detected in this brain area. Interestingly, goldfish PSS-I mRNA, which encodes SRIF-14, was also detected in the pituitary using Northern blot analysis. The presence of SRIF mRNA in the pituitary suggests a paracrine function of SRIF-14.
In a previous study, seasonal variations in circulating levels of GH in the goldfish have been observed with highest mean daily serum GH levels in June and the lowest levels in November (60). The seasonal variation in body growth rates correlates in part with the seasonal cycle in serum GH levels (60). The brain and pituitary content of immunoreactive SRIF-14 measured by RIA using antiserum against SRIF-14 was shown to vary on a seasonal basis inverse to the seasonal variation in the levels of serum GH in goldfish (36), with highest levels of immunoreactive SRIF-14 in telencephalon, hypothalamus, and thalamus-midbrain at November and the lowest levels of immunoreactive SRIF in the same brain regions at June and July. These results suggest that the seasonal variations in GH reflect changes in the intensity of the SRIF inhibitory tone. In the present study, seasonal variations of the levels of three SRIF mRNAs were observed, with differential patterns and sexual differences. Goldfish PSS-II and PSS-III mRNAs levels are highest for both males and females in late July in sexually regressed fish, and lower in April in sexually mature fish. Therefore, the seasonal variations in PSS-II and PSS-III mRNA levels are not closely correlated with the seasonal variations in GH levels and immunoreactive SRIF-14 levels from the previous studies (36, 60). However, the seasonal variations in PSS-I mRNA in female fish were closely correlated with the seasonal variations in GH levels and immunoreactive SRIF levels from the previous studies (36, 60), with higher PSS-I mRNA levels in sexually mature fish in April and in sexually recrudescent fish in December and lower levels in sexually regressed fish in July. These results suggest that PSS-I mRNA, which encodes SRIF-14, is potentially involved in the control of seasonal variations in serum GH levels. On the other hand, the present results do not demonstrate a significant seasonal variation in PSS-I mRNA in the forebrain of male fish, suggesting that SRIF-14 is not involved directly in controlling the seasonal GH cycle in male fish. These differences between males and females in brain PSS-I mRNA expression patterns implicate sex steroids in the modulation of PSS-I mRNA expression in goldfish. Indeed, our recent studies (unpublished observations) have shown that brain PSS-I mRNA levels are affected by estradiol but not by testosterone.
In summary, three SRIF cDNAs were characterized from goldfish brain. The cDNAs encode three distinct PSSs, which potentially yield SRIF-14, SRIF-28 with [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus, and [Pro2]SRIF-14, respectively. The brain distribution of the three SRIF mRNAs were differential but overlapping in the telencephalon, hypothalamus and optic tectum-thalamus regions. Seasonal variations in the levels of the three mRNAs were observed, with differential patterns between the three mRNAs and differences between sexes. The putative SRIF-14 variant, [Pro2]SRIF-14, inhibited basal goldfish pituitary GH secretion, with similar potency to SRIF-14; [Pro2]SRIF-14 also inhibited stimulated GH release, supporting that [Pro2]SRIF-14 is a biologically active form of SRIF in goldfish.
| Acknowledgments |
|---|
-tubulin clone. We thank Carol
Nahorniak, Gary Ritzel, Eugene Chomey, and Pierre Peyon for their
assistance. | Footnotes |
|---|
Received October 28, 1998.
| References |
|---|
|
|
|---|
-preprotachykinin
mRNA encodes the neruopeptides substance P, carassin, and neurokinin A.
Peptides 18:817824[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||