help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Donohoue, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Donohoue, P. A.
Endocrinology Vol. 140, No. 4 1511-1519
Copyright © 1999 by The Endocrine Society

ARTICLES

Fasting and Leptin Modulate Adipose and Muscle Uncoupling Protein: Divergent Effects Between Messenger Ribonucleic Acid and Protein Expression1

W. I. Sivitz, B. D. Fink and P. A. Donohoue

Departments of Internal Medicine and Pediatrics, Divisions of Adult and Pediatric Endocrinology, University of Iowa and the Iowa City Veterans Affairs Medical Center, Iowa City, Iowa 52246

Address all correspondence and requests for reprints to: Dr. William Sivitz, Department of Internal Medicine, The University of Iowa Hospitals and Clinics, 3E-17 VA, Iowa City, Iowa 52246. E-mail: william-sivitz{at}uiowa.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin is believed to act through hypothalamic centers to decrease appetite and increase energy utilization, in part through enhanced thermogenesis. In this study, we examined the effects of fasting for 2 days and exogenous sc leptin, 200 µg every 8 h for 2 days, on the regulation of uncoupling protein (UCP) subtypes in brown adipose tissue (BAT) and gastrocnemius muscle. Northern blot analysis (UCP-1) and ribonuclease protection (UCP-2 and 3) were used for quantitative messenger RNA (mRNA) analysis, and specific antibodies were used to measure UCP-1 and UCP-3 total protein expression.

Leptin, compared with vehicle, did not alter BAT UCP-1 or UCP-3 mRNA or protein expression when administered to normal ad libitum fed rats. Fasting significantly decreased BAT UCP-1 and UCP-3 mRNA expression, to 31% and 30% of ad libitum fed controls, respectively, effects which were prevented by administration of leptin to fasted rats. Fasting also significantly decreased BAT UCP-1 protein expression, to 67% of control; however, that effect was not prevented by leptin treatment. Fasting also decreased BAT UCP-3 protein, to 85% of control, an effect that was not statistically significant. Fasting, with or without leptin administration, did not affect BAT UCP-2 mRNA; however, leptin administration to ad libitum fed rats significantly increased BAT UCP-2 mRNA, to 138% of control. Fasting significantly enhanced gastrocnemius muscle UCP-3 mRNA (411% of control) and protein expression (168% of control), whereas leptin administration to fasted rats did not alter either of these effects.

In summary, UCP subtype mRNA and protein are regulated in tissue- and subtype-specific fashion by leptin and food restriction. Under certain conditions, the effects of these perturbations on UCP mRNA and protein are discordant.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
LEPTIN, a 16-kDa adipose cell specific secreted protein, acts through hypothalamic nerve centers to mediate neuroendocrine responses to energy supply or deprivation. Exogenous leptin, administered to rodents, results in reduced adipose mass, only in part explained on the basis of decreased food intake, implying an effect of the peptide to increase energy utilization (1). One way this might occur is through enhanced thermogenesis mediated by tissue uncoupling proteins (UCPs).

Three UCP subtypes have now been identified. UCP-1 is a 32-kDa protein encoded by a nuclear (rather than mitochondrial gene), is localized to the inner mitochondrial membrane, and is abundantly expressed in rodent brown adipose tissue (BAT) (2, 3). Consistent with physiologic energy demands, UCP-1 is expressed at higher levels during cold exposure and decreased by fasting (2, 4). UCP-1 messenger RNA (mRNA) expression is also enhanced by adrenergic stimulation, independent of cold exposure (2) and by specific activation of the ß3 adrenergic receptor (5). Leptin treatment enhances (6) or does not alter (7) BAT UCP-1 mRNA, compared with untreated ad libitum fed controls. Further, exogenous leptin prevents the decrease in UCP-1 message that occurs as a result of food restriction in the form of pair-feeding to leptin-treated rats (6, 7).

Recently, two additional UCP subtypes have been identified, UCP-2 (8, 9) and UCP-3 (10, 11, 12), each with considerable homology to the BAT UCP (now termed UCP-1). UCP-2 is expressed in a variety of tissues [including adipose tissue, muscle, heart, and liver and pancreatic islets (8, 9, 13, 14)] and is responsive to nutritional regulation (8). Levels of rat pancreatic islet UCP-2 mRNA are enhanced by recombinant adenoviral-induced leptin expression (13). UCP-3 is 73% homologous to UCP-2 in humans and is predominantly expressed in human and rodent skeletal muscle and in rodent BAT (10, 11, 12). ß3 adrenergic agonist and leptin treatment increased rodent white adipose tissue UCP-3 mRNA, and thyroid hormone increased UCP-3 message in skeletal muscle (11). Food deprivation decreased UCP-3 mRNA in brown fat (11). Interestingly, 50% food deprivation (15) or food restriction, in the form of pair-feeding to leptin-treated rats (7), decreases [but fasting increases (11, 15)] UCP-3 message in skeletal muscle.

Although the above studies are beginning to elucidate the regulation of UCP expression by leptin and nutrient deprivation, results to date have focused on the expression of leptin mRNA. It is not currently known whether these changes in UCP message levels reflect actual UCP protein expression. In the current study, we examined the regulation of UCP subtype expression in BAT and gastrocnemius muscle of leptin- or vehicle-treated normal rats, either fed ad libitum or fasted during the period of leptin administration. In addition to assessing mRNA, we also measured UCP subtype protein expression using subtype specific antibodies.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents and supplies
Rats were purchased from Harlan Sprague Dawley, Inc., Indianapolis, IN. Recombinant mouse leptin in PBS was kindly provided by Amgen, Inc., Thousand Oaks, CA. PCR primers were obtained through the DNA Core of our Diabetes and Endocrinology Research Center. Antisense probe template DNA encoding nucleotides 2682–2779 of rat ß-actin (pTRI-Actin-Rat) was purchased from Ambion, Inc., Austin, TX. Affinity-purified polyclonal rabbit antibodies: UCP12-A, directed against a 19-amino acid cytoplasmic, C-terminal sequence of mouse and rat UCP-1; UCP21-A, against a 14-amino acid sequence mapping between the 5th and 6th transmembrane domains of mouse and rat UCP-2; and UCP32-A, against a 14-amino acid sequence mapping near the C-terminus of human UCP-3, which is 93% homologous (13/14 residues) to rat UCP-3, were purchased from Alpha Diagnostics International (San Antonio, TX). The specific peptides to which these antibodies were raised were purchased from the same manufacturer. Rabbit antibody against manganese superoxide dismutase (MnSOD) was a kind gift from Dr. Larry Oberley at our institution. Other reagents, kits, and supplies were as obtained as specified or were purchased from standard sources.

Animal experiments
These studies were performed using male Sprague Dawley rats (350–400 µg, 12–14 weeks old). All studies were approved by our institutional Animal Care Committee. Rats were fed and maintained according to standard NIH guidelines. Room temperature was maintained at 25 C. Two groups of experiments were performed.

Group I experiments examined 27 normal rats subdivided into 3 subgroups of 9 each: 1) 2-day ad libitum fed, vehicle-treated rats; 2) 2-day fasted, vehicle-treated rats; and 3) 2-day fasted, leptin-treated rats. Fasting was initiated at 1600 h. All animals had free access to water. Leptin (200 µg) or an equivalent volume of vehicle (PBS, pH 6.8) was initially administered by sc injection at 1600 h and then repeated every 8 h for 6 doses. Subsequently, rats were killed in the afternoon from 1300 h to 1500 h (final leptin or vehicle injection at 0800 h that morning). Rats were anesthetized with methoxyfluorane by inhalation. Blood was sampled by open-chest cardiac puncture, collected in heparinized tubes, and spun to obtain approximately 2 cc of plasma for analysis of plasma insulin and glucose. The right and left BAT fat pads and gastrocnemius muscles were dissected free, frozen in liquid nitrogen, and stored at -70 C until used for RNA or protein extraction. Characteristics of these animals are listed in Table 1Go.


View this table:
[in this window]
[in a new window]
  		Table 1. Characteristics of vehicle- and leptin-treated, fasted rats, compared with vehicle-treated, ad-libitum fed animals (group I experiments)

 
In group II experiments, 28 normal rats were subdivided into 2 subgroups of 14 each: 1) 2-day ad libitum fed, leptin-treated rats; or 2) 2-day ad libitum fed, vehicle-treated rats. These animals were treated with leptin or vehicle and were killed as in group I, and tissues and plasma were obtained and analyzed as in the group I experiments. RNA expression was examined in 11 of the 14 rats in each subgroup. Protein expression was examined in 8 of the 14 rats in each subgroup (RNA and protein studies were both performed in 5 of the 14 rats of each subgroup). Characteristics of these animals are listed in Table 2Go.


View this table:
[in this window]
[in a new window]
  		Table 2. Characteristics of leptin-treated, compared with vehicle-treated, ad-libitum fed rats (group II experiments)

 
RNA quantification by Northern blot analysis
Total RNA was prepared using acid guanidine thiocyanate-phenol-chloroform extraction, as described by Chomczynski and Sacchi (16). Five micrograms per lane were electrophoresed on a 1% agarose-formaldehyde denaturing gel (17) and were transferred by capillary blotting to positively-charged nylon membranes.

The sense and antisense primers, CAGGCTTCCAGTACTATTAGGT and TGCCAGTATGTGGTGGTTCACAAG (positions 142–163 and 604–627, respectively, GenBank Accession M11814) were used to generate a 486-bp UCP-1 complementary DNA (cDNA) probe by standard PCR methodology (18). The cDNA fragments were labeled with 32P, using a nick translation kit (Boehringer Mannheim, Indianapolis, IN), and unincorporated nucleotide was removed using Microcon-100 filter units (Amicon, Inc, Beverly, MA). Hybridization of cDNA was performed, as described, by the manufacturer of GeneScreen nylon membranes (NEN, Boston, MA). A 32P-labeled rat ß-actin riboprobe was synthesized from pTRI-ß-Actin-Rat (Ambion, Inc.) using a MAXIscript in vitro transcription kit (Ambion, Inc.), and the probe was hybridized as recommended by the manufacturer.

The blots were washed twice (for 20 min each) in 2x saline-sodium citrate and 0.1% SDS at room temperature and twice (for 20 min each) in 0.1x saline-sodium citrate and 0.1% SDS at 60 C followed by autoradiography at -60 C. After hybridization to the UCP-1 cDNA probe, blots were erased by two exposures of 15 min each to 0.1% SDS at 95 C for subsequent hybridization to the actin riboprobe. mRNA levels were quantified by densitometry using a Scan Jet 4c scanner (Hewlett-Packard Co., Palo Alto, CA) equipped with a transilluminator and image analysis software (SigmaGel, Jandel Scientific, San Rafael, CA). Each sample represented RNA from epididymal or BAT of a single rat.

RNA quantification by ribonuclease (RNase) protection assay (RPA)
RNase protection was carried out using the RPA II kit (Ambion, Inc.). Protected fragments were separated on denaturing 5% acrylamide gels, which were dried and exposed to film in cassettes with intensifying screens at -60 C. Bands corresponding to protected fragments were quantified by densitometry, as described for Northern analysis. Specific riboprobes for RPA were generated as follows.

UCP-2 mRNA
Sense and antisense primers, CAGTTCTACACCAAGGGCTCAGAG and TCTGTCATGAGGTTGGCTTTCAG, were synthesized corresponding to positions 313–336 and 613–635, respectively (nucleotide numbering in this text is expressed relative to the ATG start site of translation), of the mouse UCP2 cDNA (GenBank Accession no. U94593) and were used to amplify a cDNA fragment of the rat gene by RT-PCR using rat epididymal fat total RNA as template. This generated a 323-bp product, as predicted from the known mouse UCP-2 sequence. The PCR product was directly ligated into plasmid pCR3-Uni (Invitrogen, Carlsbad, CA). The product was sequenced, using a Sequenase 2 kit (United States Biochemical Corp., Cleveland, OH), and was found completely homologous to the subsequently reported rat gene (GenBank Accession no. AF039033). As expected, based upon its sequence, linearization with the restriction enzyme BstYI, followed by transcription from the SP6 promoter, produced a 203-nucleotide runoff transcript, which protected a 123-nucleotide fragment of the mature rat UCP-2 mRNA.

UCP-3 mRNA
The sense PCR primer TACAGAGGGACTATGGATG, corresponding to positions 463–481 of the rat UCP-3 sequence (GenBank Accession U92069), and antisense primer CTCTAGCATTTAGGTGACACTATAGAACAGCTTCTCCTTGATGATG, whose 3' terminal 19 nucleotides (corresponding to positions 591–609 of rat UCP-3) and adjacent 20 nucleotides to the SP6 promoter were used to generate a 174-bp PCR product by RT-PCR using rat BAT RNA as template. This product was sequenced by the DNA core of our Diabetes and Endocrine Research Center, and the amplified region was found 100% homologous to the reported rat UCP-3 sequence. After purification, using a Microcon-100 filter unit, the PCR product was used directly as template for run-off transcription, generating a 150-nucleotide fragment predicted to protect 147 nucleotides of the mature rat UCP-3 mRNA.

Actin mRNA
pTRI-Actin-Rat, purchased in linearized form, was used to generate 218 nucleotide run-off RNA transcripts from the SP6 promoter predicted to protect 125 nucleotides of mature actin mRNA.

Immunoblot analysis of rat UCP subtypes
Interscapular BAT and gastrocnemius muscle from group I and II rats, as well as epididymal fat of a vehicle-treated control rat, were homogenized, using a polytron probe (Tekmar, Cincinnati, OH), for 5 sec (fat) or 20 sec (muscle) in ice-cold radioimmunoprecipitation assay lysis buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS] containing 1 mM phenylmethlysulfonylflouride, 0.01 mM leupeptin, and 5 µg/ml aprotinin. Muscle tissue was then sonicated for 7 sec. Homogenates were agitated at 4 C for 30 min, centrifuged, and spun at 3000 x g for 5 min; and the supernatant was centrifuged again at 50,000 x g for 30 min. Protein content of the detergent-solubilized extract (supernatant) was determined by the Bradford method using a kit purchased from Bio-Rad Laboratories, Inc. (Hercules, CA). Protein was separated on 12.5% polyacrylamide reducing gels, at 250 V for 90 min, and was electroblotted to Hybond-ECL nitrocellulose membranes (Amersham, Arlington Heights, IL). Blots were blocked with 5% BSA in PBS with 0.01% Tween-20 (PBS-Tween) for 10 min and incubated with affinity-purified antibody to UCP-1 (0.5 µg/ml), UCP-2 (2 µg/ml), or UCP-3 (2 µg/ml) for 60 min at room temperature. Blots were then washed in PBS-Tween for 10 min and incubated with goat antirabbit horseradish peroxidase-conjugated secondary antibody, 1:5000, for 60 min at room temperature; washed in PBS-Tween; and developed by chemiluminescent detection using a standard kit (ECL-kit, Amersham). UCP subtype expression was quantified by densitometry using a Hewlett-Packard Co. Scan Jet 4c scanner equipped with a transilluminator and image analysis software (SigmaGel, Jandel Scientific). Based on immunoblots performed on differing amounts of loaded protein, the densitometric measurements were in a range wherein signal intensity was proportional to UCP content. Results were normalized to the mean of two control samples included on all blots. Even loading was confirmed by amido black staining of the blots.

To ascertain the specificity of the first antibody reactions, incubations were carried out in the presence or absence of specific peptide to which these antibodies were raised (10 µg/ml) and in the presence of unrelated peptides (10 µg/ml) of similar length. To further ascertain antibody specificity, we examined the tissue distribution of UCP-1 and UCP-3 protein to determine whether this conformed with expectations based on the reported mRNA distributions (2, 10, 11, 12). We also examined immunoreactivity in mitochondrial fractions, compared with whole tissue extracts of BAT, gastrocnemius muscle, liver, and brain of a 14-week-old normal male Sprague Dawley rat. Mitochondrial fractions were prepared as described by Cannon and Lindberg (19). Tissues were placed (5% wt/vol) in ice-cold 0.25 M sucrose buffered with 5 mM N-Tris[hydroxymethyl]methyl-2-aminoethanesulfonic acid (pH 7.2) and homogenized with 6–8 strokes using a Teflon glass homogenizer. The homogenate was filtered through 2 layers of gauze and centrifuged at 8500 x g for 10 min. The pellet was resuspended in the sucrose buffer, diluted to the original volume, and centrifuged at 700 x g for 10 min. The supernatant was decanted and centrifuged at 8500 x g for 10 min, and the pellet was washed with 100 mM KCl containing 20 mM K-N-Tris[hydroxymethyl]methyl-2-aminoethanesulfonic acid (pH 7.2) and resuspended in the same buffer. This suspension (designated mitochondrial fraction) and a portion of the original filtered tissue homogenate (designated whole tissue fraction) were combined with an equal volume of radioimmunoprecipitation assay lysis buffer, mixed by 10 strokes in a Dounce homogenizer, spun at 14,000 x g, and the pellet was discarded. Protein was determined by the Bradford method, as described above, and the solubilized extracts were subjected to immunoblot analysis for UCP-1 and UCP-3, as described above. Immunoblotting was also performed using rabbit anti-MnSOD as first antibody to document enrichment of this known mitochondrial protein (20) in our mitochondrial fractions, compared with whole tissue extracts. The specificity of the rabbit anti-MnSOD antibody has been previously documented (21). Although raised against human MnSOD, the antibody is reactive with MnSOD in rat tissues, as well (22).

Plasma assays
Rat insulin was determined by RIA using a kit also purchased from Linco, Inc. (St. Louis, MO). Interassay CV, in our hands, is 2% at 0.5 ng/ml; and the assay range is 0.1–10 ng/ml. Plasma glucose was measured using a YSI analyzer (Yellow Springs Instruments, Yellow Springs, OH).

Statistical analysis
Data were analyzed by one-way ANOVA (group I experiments) using the Newman-Keuls method for pairwise comparisons or by the 2-tailed, unpaired t test (group II).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
As anticipated, 48-h leptin-treated ad libitum fed rats lost weight and had lower plasma insulin and glucose concentrations, compared with vehicle-treated (Table 2Go). As we previously observed (23), 48-h leptin-treated and vehicle-treated fasted rats lost similar amounts of weight and considerably more than vehicle-treated ad libitum fed controls (Table 1Go). Also, as we previously reported (23), leptin-treated, fasted rats had a lower plasma insulin and glucose than vehicle-treated fasted rats (Table 1Go).

Figure 1Go illustrates representative examples of our RPAs for UCP-2 and UCP-3. As seen, per total RNA loaded, UCP-3 is expressed at higher levels in BAT, compared with gastrocnemius muscle (Fig. 1AGo). We also examined UCP-2 and UCP-3 in total RNA isolated from epididymal fat and BAT. RNA samples were protected by both probes within the same reaction mix. Although not quantified in molar terms, it is clear that UCP-2 is expressed at higher levels in epididymal fat than BAT, whereas the reverse is true for UCP-3.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 1. UCP-3 and UCP-2 mRNA expression by RNase protection. A, Protected fragments of UCP-3 mRNA in 2.5, 5.0, and 10.0 µg total RNA, isolated from gastrocnemius muscle and 10 µg total RNA from BAT of a normal ad libitum fed rat; B, protected fragments of UCP-3 and UCP-2 in total RNA prepared from epididymal adipose tissue (EPI) or BAT of a normal ad libitum fed rat. Combined riboprobes, specific for UCP-2 and UCP-3, were added to a reaction mix containing 5 µg total RNA.

 
Fasting markedly diminished the expression of both UCP-1 mRNA (measured by Northern blot analysis) and UCP-3 mRNA (measured by RNase protection in BAT) (Figs. 2Go; and see Fig. 5Go). This effect, for both UCP subtypes, was prevented by leptin administration to the fasted animals. As opposed to UCP-1 and UCP-3, fasting had no effect on BAT UCP-2 mRNA levels. Leptin treatment of normal ad libitum fed rats, compared with vehicle treatment, did not alter the expression of either BAT UCP-1 or BAT UCP-3 message (see Fig. 6Go). However, leptin treatment of ad libitum fed rats increased BAT UCP-2 mRNA expression (see Fig. 6Go).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Relative quantification of UCP-1 and UCP-3 mRNA in total RNA extracts from BAT of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. A, UCP-1, relative to ß-actin mRNA, by Northern blot analysis (10 µg total RNA per lane); B, UCP-3, relative to ß-actin mRNA, by RNase protection (5 µg total RNA per lane).

 


View larger version (32K):
[in this window]
[in a new window]
  		Figure 5. Quantification of the relative amounts of UCP subtype mRNA (normalized to ß-actin) and protein in extracts from BAT of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. ***, P < 0.001; **, P < 0.01; *, P < 0.05 (n = nine rats per group for each of the three conditions).

 


View larger version (24K):
[in this window]
[in a new window]
  		Figure 6. Quantification of the relative amounts of UCP subtype mRNA (normalized to ß-actin) and protein in extracts from BAT of rats fed ad libitum and treated with vehicle for 48 h or fed ad libitum and treated with leptin. ns, Nonsignificant; **, P < 0.01 (n = 11 rats per group for mRNA quantification; n = 8 rats per group for protein quantification).

 
We also measured UCP-1 and UCP-3 protein expression in total tissue extracts from BAT of these rats (Figs. 3Go, 4Go, 5Go, and 6Go). Although not rigidly quantified, UCP-1 protein in BAT seemed extremely abundant, because serial blots (including differing amounts of solubilized protein) showed that adequate signal intensity, with near-complete elimination of background noise, could be obtained by adding only 0.1 µg protein per lane. As demonstrated, using competition by the specific peptides to which the antibodies were raised, antibody to UCP-1 and UCP-3 identified specific bands, which migrated as expected, based on molecular weight (Figs. 3Go and 4Go). The specificity of these antibodies was further confirmed by the finding that UCP-1 immunoreactivity was found in BAT but not in gastrocnemius muscle, liver, or brain (Fig. 3Go); whereas UCP-3 immunoreactivity was evident in BAT and gastrocnemius muscle but not in the other tissues examined (Fig. 4Go). These tissue distributions conform to expectations based on the known distributions of UCP-1 and UCP-3 mRNA (2, 10, 11, 12). Finally, UCP-1 and UCP-3 immunoreactivity were both enriched in mitochondrial fractions from these tissues, as opposed to whole tissue extracts (Figs. 3Go and 4Go). In contrast to UCP-1 and UCP-3, we could not detect specific UCP-2 immunoreactivity in extracts of BAT or gastrocnemius muscle using our UCP-2 antibody.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 3. Immunoblot analysis of UCP-1 protein in detergent extracts of BAT and evidence for antibody specificity. A, Extracts from BAT of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. Only 0.1 µg total protein per lane was sufficient for clear immunodetection, suggesting that UCP-1 was quite abundant in this tissue. B, UCP-1 and Mn superoxide dismutase (Mn SOD) immunoreactivity in extracts of whole tissue (T) and mitochondrial fractions (M) from BAT, liver (Liv), gastrocnemius muscle (Gas), and brain (Br). A total of 2.5 µg protein from whole tissue and mitochondrial fractions were loaded in each lane, with the exception of the BAT tissue and BAT mitochondrial fractions probed for UCP-1, wherein only 0.1 µg protein was loaded. C, BAT whole tissue extract (0.1 µg protein per lane) from a normal ad libitum fed rat. No added peptide, competing UCP-1 peptide (to which the antibody was raised), or a nonspecific peptide (in this case corresponding to the C-terminus of the GLUT-3 glucose transporter) were included during first antibody incubation.

 


View larger version (44K):
[in this window]
[in a new window]
  		Figure 4. Immunoblot analysis of UCP-3 protein in detergent extracts of BAT and evidence for antibody specificity. A, Extracts from BAT of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. Ten micrograms of total protein were loaded per lane. B, Mn SOD (same blot shown in Fig. 3Go) and UCP-3 immunoreactivity in extracts of T and M from BAT, Liv, Gas, and Br. A total of 2.5 µg protein were loaded per lane. C, BAT whole tissue extract (10 µg protein per lane) from a normal ad libitum fed rat. No added peptide, competing UCP-3 peptide (to which the antibody was raised), or a nonspecific peptide (the peptide to which UCP-1 antibody was raised) were included during first antibody incubation.

 
Fasting decreased the expression of BAT UCP-1 protein (Figs. 3Go and 5Go), although the magnitude of this effect was less than that observed for UCP-1 message. In sharp contrast to the observed changes in BAT UCP-1 mRNA, leptin administration to fasted rats did not prevent the decrease in UCP-1 protein. A similar trend was observed for UCP-3 protein (Figs. 4Go and 5Go); however, these results did not achieve statistical significance. Consistent with the effects on BAT mRNA, we observed no change in UCP-1 or UCP-3 protein in BAT of leptin-treated ad libitum fed rats, compared with vehicle-treated controls (Fig. 6Go).

We also measured UCP-3 mRNA and protein expression in gastrocnemius muscle ( Figs. 7–9GoGoGo). UCP-3 antibody labeled multiple bands separated by electrophoresis of protein extracted from this tissue (Fig. 8Go). Although addition of the UCP-3 peptide enhanced signals from several of these bands and increased the background, only a doublet, migrating as expected, could be specifically inhibited. Fasting increased the expression of both gastrocnemius UCP-3 mRNA and protein ( Figs. 7–9GoGoGo). However, unlike our observations in BAT, leptin administration to the fasted rats did not alter this effect. Leptin administration to ad libitum fed rats increased gastrocnemius UCP-3 mRNA expression, compared with vehicle-treated ad libitum fed controls (Fig. 9Go). A similar trend was also observed for UCP-3 protein; however, this did not achieve statistical significance (Fig. 9Go). As expected, based on the known specificity of UCP-1 for BAT (2), we could not detect UCP-1 mRNA or protein in gastrocnemius muscle. UCP-2 mRNA, although detectable by RPA in gastrocnemius muscle, was not quantified. Unlike BAT, where UCP-2 mRNA signals were weak but suitable for quantification (Fig. 1Go), we could not accurately measure the band density of gastrocnemius UCP-2 mRNA.



View larger version (48K):
[in this window]
[in a new window]
  		Figure 7. Relative expression of UCP-3 and ß-actin mRNA by RNase protection, in total RNA extracted from gastrocnemius muscle of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. Five micrograms of total RNA were incubated, in the presence of riboprobes for both UCP-3 and ß-actin within the same reaction mix. A lighter exposure of the same gel (right) was needed to compare the ß-actin expression.

 


View larger version (41K):
[in this window]
[in a new window]
  		Figure 8. Immunoblot analysis of UCP-3 protein in detergent extracts of gastrocnemius muscle. Ten micrograms of total protein were loaded per lane. A, Gas extract from a normal ad libitum fed rat. No added peptide, competing UCP-3 peptide (to which the antibody was raised), or a nonspecific peptide (to which UCP-1 antibody was raised) were included during first antibody incubation. The nonspecific adherence of the UCP-3 peptide to abundant protein bands is exemplified by the visibility of the molecular weight markers (otherwise not seen). Nonetheless, the peptide specifically inhibited signaling from the doublet at the expected relative migration for UCP-3. B, Extracts from BAT of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin.

 


View larger version (33K):
[in this window]
[in a new window]
  		Figure 9. Quantification of the relative amounts of UCP-3 mRNA (normalized to ß-actin) and protein in extracts from gastrocnemius muscle. A and B, UCP-3 mRNA and protein of rats fed ad libitum and treated with vehicle, fasted for 48 h, and treated with vehicle, or fasted for 48 h and treated with leptin. *, P < 0.05; **, P < 0.01, compared with vehicle-treated ad libitum fed rats (n = 9 rats per group for each of the three conditions). C and D, UCP-3 mRNA and protein of rats fed ad libitum and treated with vehicle or fed ad libitum and treated with leptin. * P < 0.05, compared with vehicle-treated ad libitum fed rats (n = 11 rats per group for mRNA quantification; n = 8 rats per group for protein quantification).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Champigny et al. (4) found that BAT UCP-1 mRNA expression was markedly reduced in 2-day fasted rats. Plasma leptin is markedly decreased in 24–72 h fasted (compared with ad libitum fed) adult male Sprague Dawley rats (24, 25), an effect fully evident by 24 h (24). The current data show that the fasting-induced decrease in UCP-1 mRNA can be completely prevented by administration of exogenous leptin. We also demonstrate a fasting-induced decrease in BAT UCP-3 mRNA, an effect which likewise was prevented by leptin administration.

Recent reports show that food restriction, in the form of pair-feeding to leptin-treated normal rats, reduces BAT UCP-1 (6, 7) and UCP-3 (7) mRNA expression, relative to ad libitum fed, nonleptin-treated controls. Leptin treatment, in these studies, prevented the decrease in UCP-1 mRNA (7) or resulted in an increase in UCP-1 (6) and UCP-3 (7) over and above control ad libitum fed rats. Hence, our results are consistent in showing a reduction in UCP subtype expression with fasting and prevention of these effects by leptin. The exact effects of leptin in food-restricted or fasted rats, i.e. whether to prevent a decrease or induce an actual increase in UCP expression, probably differ as to the strain of animal studied or dose, duration, and means of leptin treatment, i.e. by repeated sc injection in our studies or by intracerebroventricular (7) or continuous sc infusion (6) in the other above-mentioned reports.

Cusin et al. also examined UCP-3 message in skeletal muscle (7). These investigators reported that intracerebroventricular leptin increased UCP-3 mRNA, relative to untreated pair-fed controls. However, UCP-3 mRNA was reduced in these partially food-restricted (pair-fed) rats, relative to ad libitum controls, so the effect of leptin was to maintain UCP-3 mRNA expression, in spite of food restriction. These results, on first thought, differ from our findings for gastrocnemius muscle of fasted rats, wherein fasting increased UCP-3 mRNA. However, this is consistent with previously reported studies showing that food restriction decreases (7, 15) but fasting increases (11, 15) UCP-3 message in skeletal muscle. In fact, the regulation of UCPs could be quite volatile, in the face of nutritional perturbation, as further evidenced by observations that fasting for 2 days reduced UCP-1 mRNA (whereas prolonged fasting actually increased UCP-1 message) (4). Of course, a number of factors (including strain of rat, method of leptin treatment, or specific muscle type) might be responsible for differences between studies.

Reported studies of in vivo leptin treatment and/or nutritional deprivation, on UCP subtype expression, to date have examined expression only at the mRNA level. We report here that fasting reduced BAT UCP-1 protein in total tissue extracts, albeit to a lesser extent than is the case for its mRNA. However, in contrast to the effects of leptin administration on UCP-1 mRNA, leptin administration to fasted rats had no effect at all in preventing the decrease in UCP-1 protein. We observed a similar trend, with respect to the effects of fasting and leptin on BAT UCP-3 protein; however, these effects fell short of statistical significance. Similar to its effect on gastrocnemius muscle UCP-3 mRNA, fasting substantially increased gastrocnemius UCP-3 protein content.

The discordance between the effects of leptin on BAT UCP-1 protein and mRNA suggest that posttranscriptional mechanisms are operative in regulating UCP-1 expression. Translational control of UCP-1 expression has been previously suggested in studies of aging rats. Yamashita et al. (26) observed increased UCP-1 mRNA levels in BAT of old (compared with young) rats, in spite of observations that mitochondrial thermogenic activity decreased with aging and that mitochondrial UCP content did not change. Translational control of other genes may also be important in regulating BAT thermogenesis. Lipoprotein lipase provides energy in the form of fatty acids for BAT nonshivering thermogenesis. Klingenspor et al. (27) found evidence for both pre- and posttranslational control of BAT lipoprotein lipase activity, dependent on the duration of cold exposure.

Our data suggest that BAT UCP-1 and UCP-3 are regulated, in coordinate fashion, by fasting and leptin (Fig. 5Go). For both subtypes, fasting decreased (and leptin prevented the decrease in) mRNA. Also, for both subtypes, leptin administration to ad libitum fed rats did not alter their mRNA or protein expression (Fig. 6Go). If food restriction decreases (but leptin increases) BAT UCP-1 and UCP-3 mRNA, then the lack of an effect of leptin administration to ad libitum fed rats may be attributable to the offsetting effects of leptin-induced decreased food intake and the of effect of leptin per se. In contrast to BAT UCP-1 and UCP-3, BAT UCP-2 mRNA may be regulated differently. BAT UCP-2 message was not altered by fasting, with or without leptin, but increased in leptin-treated ad libitum fed rats. However, the abundance of UCP-2 may be lower in BAT than UCP-1 and UCP-3 because we were not able to detect UCP-2 protein by immunoblotting and because UCP-2 mRNA signals by RPA were not as strong as for UCP-3. In this regard, UCP-1 protein seemed extremely abundant, based on the ease of detection in spite of marked dilution of the tissue extract. However, we must be cautious about such comparisons, because these methods do not quantify UCP subtypes in molar terms.

Limitations inherent to this study, as well as the other above mentioned in vivo studies of leptin administration, cause difficulty in separating direct effects of leptin on UCP expression from secondary metabolic effects. In particular, insulinemia is decreased when leptin is administered to either fasted or ad libitum fed rats (23, 28). However, it would seem that the increase in BAT UCP-1 and UCP-3 mRNA in leptin-treated fasted rats, compared with control, was not likely related to the relative decrease in insulin (Table 1Go). Fasting alone, compared with ad libitum feeding, markedly reduced UCP-1 and UCP-3 expression; so it seems unlikely that further reduction in insulin would reverse this decrease. Further, Geleon et al. (29) observed that insulin increased UCP-1 expression when administered to rodents.

Another limitation to the current study is that leptin was administered by intermittent injection, likely resulting in fluctuations in plasma leptin according to time after last injection. Whether the results would have been different had leptin been delivered in continuous fashion is unknown. However, the rats in this study did receive substantial leptin exposure, based upon the expected decrease in plasma insulin with concurrent reduced or unchanged glycemia (23, 28) and body weight responses (Tables 1Go and 2Go). It should also be noted that actual responses to administered leptin may have multiple determinants, including efficiency and extent of transport into the central nervous system, neuronal exposure, and possibly binding to plasma proteins. These factors are, as yet, poorly understood and therefore difficult to control in the experimental setting.

Although the effect of leptin in preventing the fasting-induced decrease in BAT UCP-1 and UCP-3 mRNA did not extend to UCP protein expression, the data are consistent with the general concept that leptin modulates the neuroendocrine response to fasting. In this regard, Ahima et al. (30) found that leptin substantially blunted fasting-induced alterations in the gonadal, adrenal, and thyroid axes of male mice and prevented the starvation-induced delay in ovulation in female mice. However, it is of interest that leptin also enhances some normal responses to fasting, including the above mentioned decrease in plasma insulin and a decrease in plasma IGF-1, which we have previously reported (23).

In summary, we have shown that UCP subtype mRNA and protein are regulated by leptin and food restriction. These changes are tissue- and UCP subtype-specific. Under certain conditions, the effects of leptin on UCP-1 and UCP-3 protein and mRNA may be discordant. The results of this study suggest that UCP expression may be regulated in multiple ways, involving both the level of mRNA abundance and posttranscriptional mechanisms.


   Footnotes
 
1 This work was supported by Veterans Affairs Medical Research Funds and Grants DK-25295 and HD-29569 from the National Institutes of Health. Back

Received August 17, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Levin N, Nelson C, Gurney A, VBanelen R, DeSauvage F 1996 Decreased food intake does not completely account for adiposity reduction after ob protein infusion. Proc Natl Acad Sci USA 93:1726–1730[Abstract/Free Full Text]
  2. Klaus S, Casteilla L, Bouillaud F, Ricquier D 1991 The uncoupling protein UCP: a membraneous mitochondrial ion carrier exclusively expressed in brown adipose tissue. Int J Biochem 23:791–801[CrossRef][Medline]
  3. Bouillaud F, Ricquier D, Thibault J, Weissenbach J 1985 Molecular approach to thermogenesis in brown adipose tissue: cDNA cloning of the mitochondrial uncoupling protein. Proc Natl Acad Sci USA 82:445–448[Abstract/Free Full Text]
  4. Champigny O, Ricquier D 1990 Effects of fasting and refeeding on the level of uncoupling protein mRNA in rat brown adipose tissue: evidence for diet-induced and cold-induced responses. J Nutr 120:1730–1736
  5. Li H, Matheny M, Scarpace PJ 1997 ß3-adrenergic-mediated suppression of leptin gene expression in rats. Am J Physiol 35:E1031–E1036
  6. Scarpace PJ, Matheny M, Pollock BH, Tumer N 1997 Leptin increases uncoupling protein expression and energy expenditure. Am J Physiol 36:E226–E230
  7. Cusin I, Zakrzewska KE, Boss O, Muzzin P, Giacobino JP, Ricquier D, Jeanrenaud B, Rohner-Jeanrenaud F 1998 Chronic central leptin infusion enhances insulin-stimulated glucose metabolism and favors the expression of uncoupling proteins. Diabetes 47:1014–1019[Abstract]
  8. Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272[CrossRef][Medline]
  9. Gimeno R, Dembski M, Weng X, Deng N, Shyjan A, Gimeno C, Iris F, Ellis S, Woolf E, Tartaglia L 1997 Cloning and characterization of an uncoupling protein homolog - a potential molecular mediator of human thermogenesis. Diabetes 46:900–906[Abstract]
  10. Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB 1997 UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochem Biophys Res Commun 235:79–82[CrossRef][Medline]
  11. Gong DW, He YF, Karas M, Reitman M 1997 Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, ß3-adrenergic agonists, and leptin. J Biol Chem 272:24129–24132[Abstract/Free Full Text]
  12. Boss O, Samec S, Paolonigiacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P, Giacobino JP 1997 Uncoupling protein-3—a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Lett 408:39–42[CrossRef][Medline]
  13. Zhou YT, Shimabukuro M, Koyama K, Lee Y, Wang MY, Trieu F, Newgard CB, Unger RH 1997 Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. Proc Natl Acad Sci USA 94:6386–6390[Abstract/Free Full Text]
  14. Larrouy D, Laharrague P, Carrera G, Viguerie-Bascands N, Levi-Meyrueis C, Fleury C, Pecqueur C, Nibbelink M, Andre M, Casteilla L, Ricquier D 1997 Kupffer cells are a dominant site of uncoupling protein 2 expression in rat liver. Biochem Biophys Res Commun 235:760–764[CrossRef][Medline]
  15. Boss O, Samec S, Kuhne F, Bijlenga P, Assimacopoulos-Jeannet F, Seydoux J, Giacobino JP, Muzzin P 1998 Uncoupling protein-3 expression in rodent skeletal muscle is modulated by food intake but not by changes in environmental temperature. J Biol Chem 273:5–8[Abstract/Free Full Text]
  16. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  17. Lerach H, Diamond D, Wozney J, Boedtker H 1997 RNA molecular weight determinations by gel electrophoresis under denaturing conditions, a critical reexamination. Biochemistry 16:4743–4751
  18. Sambrook J, Fritsh E, Maniatis T 1989 Molecular Cloning. Cold Springs Harbor Laboratory Press, Cold Spring Harbor NY, pp 14.1–14.35
  19. Cannon C, Lindberg O 1979 Mitochondria from brown adipose tissue: isolation and properties. In: Colowick SP, Kaplan NO (eds) Methods in Enzymology. Academic Press, Inc., New York, vol LV:65–78
  20. Weisiger RA, Fridovich I 1973 Mitochondrial superoxide dismutase. Site of synthesis and intramitochondrial localization. J Biol Chem 248:4793–4796[Abstract/Free Full Text]
  21. Oberley TD, Oberley LW, Slattery AF, Lauchner LJ, Elwell JH 1990 Immunohistochemical localization of antioxidant enzymes in adult Syrian hamster tissues and during kidney development. Am J Pathol 137:199–214[Abstract]
  22. Czaja MJ, Schilsky ML, Xu Y, Schmiedeberg P, Compton A, Ridnour L, Oberley LW 1994 Induction of MnSOD gene expression in a hepatic model of TNF-alpha toxicity does not result in increased protein. Am J Physiol 266:G737–G744
  23. Sivitz WI, Walsh SA, Morgan DA, Thomas MJ, Haynes WG 1997 Effects of leptin on insulin sensitivity in normal rats. Endocrinology 138:3395–3401[Abstract/Free Full Text]
  24. Vuagnat BAM, Pierroz DD, Lalaoui M, Englaro P, Pralong FP, Blum WF, Aubert ML 1998 Evidence for a leptin-neuropeptide y axis for the regulation of growth hormone secretion in the rat. Neuroendocrinology 67:291–300[CrossRef][Medline]
  25. Patel BK, Koenig JI, Kaplan LM, Hooi SC 1998 Increase in plasma leptin and Lep mRNA concentrations by food intake is dependent on insulin. Metabolism 47:603–607[CrossRef][Medline]
  26. Yamashita H, Yamamoto M, Ookawara T, Sato Y, Ueno N, Ohno H 1994 Discordance between thermogenic activity and expression of uncoupling protein in brown adipose tissue of old rats. J Gerontol 49:B54–B59
  27. Klingenspor M, Ebbinghaus C, Hulshorst G, Stohr S, Spiegelhalter F, Haas K, Heldmaier G 1996 Multiple regulatory steps are involved in the control of lipoprotein lipase activity in brown adipose tissue. J Lipid Res 37:1685–1695[Abstract]
  28. Chen G, Koyama K, Yuan X, Lee Y, Zhou Y, Odoherty R, Newgard C, Unger R 1996 Disappearance of body fat in normal rats by adenovirus-mediated leptin gene therapy. Proc Natl Acad Sci USA 93:14795–14799[Abstract/Free Full Text]
  29. Geleon A, Trayhurn P 1990 Regulation of the level of uncoupling protein in brown adipose tissue by insulin. Am J Physiol 258:R418–R424
  30. Ahima RS, Prabakaran D, Flier JS 1998 Postnatal leptin surge and regulation of circadian rhythm of leptin by feeding - implications for energy homeostasis and neuroendocrine function. J Clin Invest 101:1020–1027[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Donohoue, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Donohoue, P. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals