This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Douziech, N. Articles by Morisset, J. Search for Related Content PubMed PubMed Citation Articles by Douziech, N. Articles by Morisset, J.

Inhibitory and Stimulatory Effects of Somatostatin on Two Human Pancreatic Cancer Cell Lines: A Primary Role for Tyrosine Phosphatase SHP-1¹

Service de gastroentérologie (N.D., E.C., Z.C., J.M.), Départment Médecine, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4; Health Canada (G.M., R.A.A.), Therapeutic Drugs Programme, Life Sciences Division, Biotechnology Section, PLC2201C, Sir F. G. Banting Research Centre, Tunney’s Pasture, Ottawa, Ontario, Canada, K1A 0L2; Department of Biochem. Immunol. Microbiol.(J.B., R.A.A.), Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5; and Department Physiology (A.L.), Faculty of Veterinary Sciences, University of Extremadura, 10.07 Caceres, Spain

Address all correspondence and requests for reprints to: Dr. Jean Morisset, Service de Gastroentérologie, Département Médecine, Faculté Médecine, Sherbrooke, Québec, Canada, J1H5N4. E-mail: jmori7{at}courrier.usherb.ca

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Somatostatin (SS-14) and its structural analogue SMS 201–995 (SMS) are recognized as physiological inhibitors of multiple organs and tissue functions through specific membrane receptors (sst1–sst5). The effects of SS-14 and SMS in the growth control of the pancreatic cancer cell lines MIA PaCa-2 and PANC-1 were investigated to identify and clarify the intracellular events involved. In PANC-1 cells, SS-14 and SMS caused inhibition of their basal growth, and that stimulated by epidermal growth factor, with a maximal effect at 0.1–1 µM. To understand the inhibitory mechanisms, we investigated the effects of SS-14 and SMS on phosphotyrosine phosphatase (PTPase) activity and, more specifically, that of tyrosine phosphatase SHP-1 (PTP1C). SS-14 and SMS caused significant increases in total cellular PTPase activity, and particularly SHP-1, with maximal activation within 1 min. Inhibition of membrane tyrosine kinase and p42 MAP kinase activities was also observed, in response to SS-14 and SMS. In MIA PaCa-2 cells, SS-14 and SMS were associated with a positive growth response at 1–10 nM, after 4 days of culture in serum-free medium. Total cellular PTPase activity was slightly increased, but SHP-1 activity could not be detected; its absence in this cell line was confirmed by Western blot. Membrane tyrosine kinase activities were significantly increased by SS-14 and SMS at concentrations needed for maximal growth. p44/p42, which are constitutively active in this cell line, and p38 activities were not affected by somatostatin. In conclusion, somatostatin can exert different effects on human pancreatic cancer cell growth, depending upon the presence or absence of SHP-1. This enzyme can play a key role in the control of cell proliferation, and its cellular presence may determine the therapeutic potential of somatostatin in the control of cancer cell growth.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
SOMATOSTATIN IS A 14-amino acid polypeptide, first isolated from the hypothalamus as an inhibitor of GH secretion (1). Later, it was found widely distributed in the central nervous system and in peripheral tissues, including the kidneys, the pancreas, and the gastrointestinal tract (2). The physiological effects of somatostatin are predominantly inhibitory; indeed, it can reduce exocrine secretions of the digestive organs and the endocrine secretions of many hormones, and it also has antiproliferative effects (3, 4, 5, 6). The hormone mediates its actions by interacting with five different types of receptor, which were cloned and characterized (7). These receptors, named sst1 through sst5, belong to the G protein-coupled receptor family and seem to be linked to different signal transduction pathways, including adenylate cyclase, ion conduction channels, and protein dephosphorylation (8).

Although somatostatin receptors are coupled to multiple intracellular signaling pathways, the mechanism by which somatostatin inhibits cell growth is not completely understood. To explain this antiproliferative effect, modulation of a phosphotyrosine phosphatase (PTPase) activity has been postulated as one of the intracellular events responsible for somatostatin’s cell growth inhibition (9, 10, 11). In MIA PaCa-2 cells, a human pancreatic cancer cell line, the somatostatin analogues RC-160 and RC-121 caused rapid stimulation of a membrane PTPase activity and induced dephosphorylation of the epidermal growth factor (EGF) receptor, resulting in inhibition of the EGF proliferative activity (9, 12). A PTPase of 70 kDa, identified as SHP-1, copurified with the membrane somatostatin receptor isolated from pancreatic acinar cells expressing the sst2 receptor (13). Recently, SHP-1 was found constitutively associated with sst2, and binding of somatostatin to its receptor caused the enzyme rapid dissociation from the receptor, with an increase in its activity (14). In CHO cells transfected with the sst5 subtype, the antiproliferative effect of the somatostatin analog RC-160 was not abolished by specific inhibitors of tyrosine and serine/threonine phosphatases, indicating that a phosphatase was not involved in the negative growth signal coupled to this receptor (15). It seems, however, that a cyclic guanosine monophosphate-dependent kinase pathway was involved in this antiproliferative signal, because a specific cyclic guanosine monophosphate inhibitor abolished the growth inhibition mediated by the somatostatin analog (16).

The somatostatin analog BIM 214 also inhibited MAP kinase activation by 20% serum; this enzyme cascade is known to have a pivotal role in the signal transduction pathways leading to cell proliferation (17). It was also reported that the widespread inhibitory actions of somatostatin could be mediated by its ability to inhibit the expression of the immediate early genes c-fos and c-jun (18), as well as AP-1 binding and transcriptional activity (19).

Because pancreatic cancers have very poor prognosis, somatostatin was proposed as a potential inhibitor of pancreatic tumor growth by affecting the tumor itself (20). Upp et al. (21) reported that the somatostatin analog SMS 201–995 (SMS) inhibited growth of two xenografted human pancreatic cancers in nude mice. In vitro, this same analog caused growth inhibition of the pancreatic cancer cells AR4–2J (6) by stimulating a membrane tyrosine phosphatase activity (22). Furthermore, it was previously reported that somatostatin inhibited EGF-stimulated growth of the MIA PaCa-2 cells, a human pancreatic cancer cell line (5); this effect could not be reproduced in this same cell line and in the PANC-1 cells, another human pancreatic cancer cell line (23). Finally, Gillepsie et al. (24) were unable to detect any somatostatin receptors in these same two human pancreatic cancer cell lines. Because of these conflicting results, our study was initiated to reinvestigate the growth regulation of the MIA PaCa-2 and PANC-1 cells by somatostatin and to characterize the intracellular events mediating the action of somatostatin in these two human pancreatic cancer cell lines of ductal origin.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials
Myelin basic protein and p-nitrophenyl phosphate were from Sigma Chemical Co. St. Louis, MO. Penicillin-streptomycin, amphotericin-B, DMEM, and FBS were purchased from Gibco, Burlington, Ontario. ³²P-ATP, ³²P-uridine 5'-triphosphate, and ³²P-deoxycytidine triphosphate were from Amersham (Arlington Heights, IL). Antiphosphotyrosine antibody, tyrosine kinase, and tyrosine phosphatase kits were from Boehringer Mannheim (Montréal, Canada). Ready organic scintillation mixture was from Beckman Coulter, Inc. (Mississauga, Ontario, Canada). Anti-SHP-1 was from Transduction Laboratories, Inc. (Mississauga, Ontario, Canada).

Cell culture
MIA PaCa-2 and PANC-1 pancreatic carcinoma cells were obtained from American Type Culture Collection (Bethesda, MD). Cells were grown in DMEM containing 10% FBS, penicillin-streptomycin, and glutamine. Cells were cultivated at 37 C in humidified air containing 5% CO₂.

Growth assays
All experiments were performed starting with confluent cells that were subsequently plated for growth assay in 35-mm diameter dishes [10 cm² at 1 x 10⁴ cells/ml (2 ml/dish)]. After the attachment phase, cells were transferred to serum-free medium and allowed to become quiescent overnight. The next day, fresh serum-free medium was added, and the cells were then supplemented daily for 2 or 4 days with somatostatin (SS-14) or SMS at concentrations from 10^-12–10^-6 M alone or in combination with 1 nM EGF. Cell growth was measured, after 2 or 4 days, with an electronic Coulter model 2m counter and with an hemacytometer.

Survey of somatostatin receptor subtype expression by RT-PCR
Total cellular RNA was prepared from nondiseased whole human pancreas, cultured skin fibroblasts (strain GM38; NIGMS Human Genetic Mutant Cell Repository, Camden, NJ), and human pancreatic adenocarcinoma cell lines MIA PaCa-2 and PANC-1 (American Type Culture Collection, Rockville, MD) by acidified guanidium isothiocyanate lysis and phenol extraction (25). Poly A+ messenger RNA (mRNA) isolates from nondiseased human liver and pancreas were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). The integrity of RNA preparations was verified by formaldehyde/agarose gel electrophoresis, Northern blot hybridization against several probes (including ß-actin, glyceraldehyde phosphate dehydrogenase, c-myc, and c-fos), and RT-PCR for the region spanning exons 5–8 of the human p53 tumor suppressor gene (data nto shown). Complementary DNA (cDNA) pools were prepared in 20-µl final reaction volumes, from 1 µg total RNA or 0.5 µg polyA+ mRNA, by oligo dT-primed RT (Superscript II) under specified conditions (Gibco Life Technologies, Mississauga, Ontario, Canada). cDNAs (2 ul) were amplified for human sst subtypes 1–5 (in individual reactions) by the PCR in the presence of 1x PCR buffer II [10 mM Tris-HCl (pH 8.3), 50 mM KCl], 1.5 mM MgCl₂, 2.5 U TaqGold DNA polymerase (ABI/Perkin-Elmer Corp., Mississauga, Ontario, Canada), 0.2 mM deoxynucleotide triphosphates, and 0.2 mM each forward and reverse oligonucleotide primers. The nucleotide sequences of the forward (F) and reverse (R) primers for the five human somatostatin receptor subtypes were: hsst 1 (F) 5'GCAACATGCTCATGC 3', hsst1 (R) 5' GCGTTGTCCATCCAG3'; hsst2 (F) 5' ATGGACATGGCGGATGAGCCACTC 3', hsst2 (R) 5' TACTGGTTTGGAGGTCTCCATTGAG 3'; hsst 3 (F) 5' TGGGCACCCTCGTGCCAGCGG 3', sst3 (R) 5' GGGCGGCCGCTCCTGCCCGC 3'; sst4 (F) 5' CTGAACCTCTTCGTGACCAG CCTT 3', sst4 (R) 5' CTGGTTGCAGGGCTTCCTGCT 3'; sst5 (F) 5' GTGCAGGAGGGCGGTACC 3', sst5 (R) 5' TGGACGCGGCTCCGTGGC 3'. These corresponded to the bp positions recently reported by Buscail et al. (26). For sst1, -2, -4, and -5, amplification runs consisted of an initial 12-min activation/denaturation step at 95 C followed by 35 cycles of denaturation (70 sec at 95 C), annealing (70 sec at 60 C), and extension (2 min at 72 C), which were then linked to a final 10-min polishing step at 72 C. Cycling parameters were essentially the same for sst3 except that the annealing temperature was raised to 65 C. Equivalent quantities of nonreverse transcribed total or poly A+ mRNAs were included in parallel PCR runs as in-line controls for genomic DNA carryover. Amplified products (half of PCR reactions) were resolved against 1-kbp molecular size ladder markers (Gibco Life Technologies) on 1% (wt/vol) agarose/Tris-borate-EDTA gels, stained with ethidium bromide, and photographed under UV light.

Preparation of plasma membrane fractions for tyrosine kinase and tyrosine phosphatase activities
Cells were grown in Petri dishes (100 mm) until they reached 75% confluency. They were then serum-starved for 24 h and treated with increasing concentrations of SS-14 or SMS (10^-12–10^-6 M) alone or in combination with 1 nM EGF. After various time periods of stimulation, cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer containing 10 mM HEPES (pH 7.2), 5 mM KCl, 1 mM dithiothreitol (DTT), 1.5 mM MgCl₂, 1 mM EGTA, 1 µM aprotinin, and 2 µM leupeptin with 100 mM orthovanadate for the tyrosine kinase assay. Cells were collected with a rubber policeman, homogenized by repeated strokes, and centrifuged at 1,000 x g for 5 min at 4 C. Supernatants were collected and ultracentrifuged at 50,000 x g for 30 min at 4 C. Membranes were resuspended in the lysing buffer and used for protein, tyrosine kinase, and tyrosine phosphatase assays.

Tyrosine kinase and PTPase activities
Tyrosine kinase and tyrosine phosphatase activities were measured using a nonradioactive kit. Briefly, enzyme activities were measured by incubating a synthetic peptide substrate (corresponding to the aminoacids 6–20 of the cell division kinase p34 cdc2, which is biotin-labeled at the amino-terminus) or a phosphopeptide substrate with ATP/Mg, 5x assay buffer [0.25 M Tris HCl (pH 7.8), with or without 500 µM orthovanadate and 25 mM mercaptoethanol] and 10 µg of cell membrane for 30 min at 37 C. The reaction was stopped and an aliquot of the reaction mixture was transferred to a microplate, where the phosphorylated or dephosphorylated substrate was immobilized by binding to the streptavidin-coated microplate. After subsequent washes, the fraction of phosphorylated or dephosphorylated substrate was determined immunochemically with a highly specific antiphosphotyrosine antibody directly conjugated to peroxidase. The absorbance was measured at 405 nm, with a reference wavelength at 490 nm, using a microplate reader. The results were compared with a standard curve and were expressed as phosphate incorporated (tyrosine kinase) or phosphate released (tyrosine phosphatase) per minute per milligram (tyrosine kinase) or micrograms of proteins (tyrosine phosphatase).

Preparation of cytosolic fractions for MAPK activity
Cells were grown in Petri dishes (100 mm) until they reached 75% confluency. They were then serum-starved for 24 h and pretreated for 30 min with SS-14 or SMS and stimulated for an additional 5 min with 1 nM EGF. Cells were also exposed to increasing concentrations of SS-14 or SMS for 5, 30, and 60 min. After stimulation, cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer containing 10 mM Tris HCl (pH 8.0), 5 mM KCl, 1 mM DTT, 1.5 mM MgCl₂, 1 mM EGTA, 1 µM aprotinin, 2 µM leupeptin, and 100 µM orthovanadate. Cells were collected with a rubber policeman, homogenized by repeated strokes, ultracentrifuged at 100,000 x g for 30 min at 4 C in a Beckman Coulter, Inc. TL 100 centrifuge (rotor, TLS55), and the cytosolic fractions were collected. After the addition of Laemmli buffer, samples were boiled for 5 min before the MAP kinase assays. An aliquot of the supernatant was kept for protein assay, determined according to Bradford (1976).

MAP kinases in gel assay
MAP kinase activities were determined in renatured SDS polyacrylamide gels according to the method of Kameshita and Fujisawa (27). Briefly, cell extracts (20 µg protein) were resolved on a 10% SDS-polyacrylamide gel copolymerized with 0.25 mg/ml myelin basic protein. After electrophoresis, gels were washed with four changes of 50 mM Tris, pH 8.0, containing 20% propanol. The gels were then denatured with two changes, of 60 min each, of 120 ml denaturating buffer containing 6 M guanidine hydrochloride, 50 mM Tris (pH 8.0), and 5 mM mercaptoethanol. The enzymes on gel were then renatured with four changes (2 x 60 min, 1 x overnight, and 1 x 60 min,) of 250 ml renaturating buffer containing 50 mM Tris (pH 8.0), 0,4% Tween 20, and 5 mM mercaptoethanol at 4 C. The renatured gels were then incubated in an assay buffer containing 40 mM HEPES (pH 8.0), 10 mM MgCl₂, 2 mM DTT, and 0.1 mM EGTA at room temperature for 30 min. The MAP kinase activities were determined by incubating the gels into 20 ml of the assay buffer, containing 20 µM ATP and 100 uCi ³²P-ATP, at room temperature for 2 h. The reaction was then stopped by adding 250 ml of a solution containing 5% trichloroacetic acid and 10 mM sodium pyrophosphate, followed by washing with the same solution nine times over a period of 1.5 h to eliminate nonspecific radioactivity in the gels. Gels were exposed to Kodak X-OMAT film (Montréal, Québec, Canada) overnight, at -70 C, before development. Quantification of the MAP kinase activity was carried out with a scanning densitometer (Bio-Rad Imagin Densitometer model GS-670, Mississauga, Ontario, Canada).

Immune complex SHP-1, phosphatase assay, and analysis of steady-state SHP-1 expression by Western blot hybridization
Cells were washed twice with cold PBS and lysed in Triton X-100 lysis buffer (1% Triton, 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 50 mM NaF, 5 mM EDTA, 500 µM orthovanadate, 30 mM sodium pyrophosphate, 0.1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 5 µg/ml aprotinin) for 15 min at 4 C. Insoluble material was removed by centrifugation at 1,000 x g for 5 min at 4 C. Soluble proteins (1 mg) were incubated with 3 µg of anti-SHP-1 at 4 C. After 3 h, protein G-sepharose was added and allowed to form complex for 1 h at 4 C. Immune complexes were washed three times with Triton X-100 lysis buffer. An aliquot of these immunoprecipitates was retained and added to 4x Laemmli buffer for Western blotting. Immune complexes were then washed three times with phosphatase buffer (50 mM HEPES (pH 7.0), 60 mM NaCl, 60 mM KCl, 0.1 mM phenylmethylsulfonyl fluoride, 1 µM leupeptin, and 5 µg/ml aprotinin). Phosphatase activity was assayed by resuspending the final pellet in a total vol of 80 ul of the above phosphatase buffer, adjusted to pH 5.5, containing 1 mg/ml BSA, 5 mM EDTA, and 10 mM DTT. The reaction was initiated by the addition of paranitrophenylphosphate (pNPP) (10 mM, final concentration) as substrate, with 20 µM Microcystin LR to inhibit any serine threonine phosphatase activity (28), for 30 min at 30 C. The reaction was stopped by the addition of 900 µl 1 N NaOH, and the absorbance of the samples was measured at 410 nm. For immunoblotting, immunoprecipitated proteins were resolved through 10% SDS-polyacrylamide gels and transferred to a nitrocellulose membrane. The membranes were blocked with 6% milk overnight and then incubated in TBS-Tween-3% milk in the presence of anti-SHP-1 at a dilution of 1/1000 at room temperature for 3 h or with antiphosphotyrosine (1/200) for 4 h at room temperature. After five washes (30 min) with TBS-Tween, membranes were incubated with antirabbit or antimouse IgG antibodies conjugated with horseradish peroxidase for 1 h. The SHP-1 bands, as well as the phosphotyrosine bands, were identified by super signal reagents, and the emitted light was recorded on film. MIA PaCa-2 and PANC-1, cultured in the log phase of growth (2 x 10⁶ viable cells per 100-mm diameter dish) were rinsed twice with ice-cold PBS, overlaid with 1 ml SDS/PAGE lysis buffer [62.5 mM Tris-HCl (pH 6.8), 2% (wt/vol) SDS, 10% (wt/vol) glycerol, 0.5% (vol/vol) ß-mercaptoethanol, and 1 mM phenylmethlysulfonylfluoride] and incubated on ice for 5 min to permit lysis. Crude extracts were then transferred to sterile polypropylene microcentrifuge tubes, boiled for 5 min, and cleared by centrifugation (16,000 x g for 10 min at room temperature). Ten micrograms of protein were mixed with an equal volume of 2x Leammli buffer, boiled for 3 min, and loaded in the individual lanes of a 5% stacking/12.5% resolving PAGel. The samples were fractionated by electrophoresis and electroblotted to polyvinylidene difluoride membranes (Millipore Corp. Canada, Mississauga, Ontario, Canada) under standard conditions. SHP-1 protein expression was detected by chemiluminescence using a peroxidase-coupled sheep antimouse IgG (Boehringer Canada, Laval, Québec, Canada) directed against a mouse monoclonal antibody raised against the 12-kDa C-terminal region (amino acids 492–597) of human breast SHP-1 (Transduction Laboratories, Inc., Lexington, KY). A total protein lysate from Jurkat cells served as the positive control.

Statistical analysis
Results were analyzed by Student’s t test. Results were considered significantly different from control at P < 0.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Pattern of expression of sst receptor subtypes in MIA PaCa-2 and PANC-1 cells, human pancreas, liver, and skin fibroblasts
Figure 1A shows the results of RT-PCR profiling runs for pancreatic cDNAs generated from total RNA (top electrophoregram) or oligodT column fractionated poly A+ mRNA (bottom electrophoregrams). When the contribution of nonreverse transcribed in-line control amplifications are factored into RT-PCR runs using total RNA as cDNA template, the human pancreas shows expression of all sst receptor subtypes except sst3. These data agree very well with those reported by Buscail et al. (26). The signal-to-noise ratio of the assay was increased somewhat when poly A+ mRNA was used as starting material for first-strand cDNA synthesis, but the contribution of genomic DNA dropped to insignificant levels. Under these conditions, the sst receptor subtype expression profile was not only confirmed, but the increase in sensitivity provided by the enrichment of the RNA fraction revealed discernible (albeit comparably weak) levels of sst3. Taken together, steady-state pancreatic sst receptor expression seems to rank in the following order: (sst1 = sst2 = sst5) > sst4 > sst3.

View larger version (71K): [in this window] [in a new window]   Figure 1. Assessment of somatostatin receptor subtype expression by RT-PCR. A, Somatostatin receptor expression profile for nondiseased human pancreas. Top, Agarose gel electrophoregram of reverse-transcribed (+) and nonreversed transcribed (-) total RNA showing the positions of the predicted sst1 (414 bp), sst2 (1104 bp), sst3 (447 bp), sst4 (278 bp), and sst5 (373 bp) amplification products; bottom, agarose gel electrophoregram of amplicons generated from reverse-transcribed (left) and nonreversed transcribed (right) human pancreatic poly A+ mRNA. B, Somatostatin receptor expression profiles for human liver, nonimmortalized skin fibroblasts (GM38), human pancreas (H. pan), MIA PaCa-2, and PANC-1 cells. Amplicons generated from nonreverse transcribed RNAs from MIA PaCa-2 and PANC-1 cells appear on the bottom electrophoregram. Similar in-line control amplifications were carried out for the human liver and fibroblast RNAs. The results appear in the extreme right lanes of the upper left electrophoregram.

Effects of SS-14 and SMS on basal and EGF-stimulated PANC-1 cell growth
To investigate the regulation of the PANC-1 cell growth by somatostatin, cells were made quiescent by serum deprivation, and their proliferation was evaluated in response to increasing concentrations (10¹²–10^-6 M) of SS-14 or SMS. As shown in Fig. 2A, addition of SS-14 or SMS to the medium for 2 days resulted in comparable decreases in cell proliferation, as indicated by the reduction in cell numbers. The maximal growth inhibition was observed at 0.1 and 1 µM, was in the order of 20%, and was significant. As a complementary evaluation of the inhibitory effects of SS-14 and SMS on PANC-1 cell growth, we next determined whether the two peptides can inhibit proliferation of these PANC-1 cells stimulated by the known mitogenic growth factor EGF (30). PANC-1 cells grown in serum-free medium for 24 h were then exposed, for 48 h, to 1 nM EGF alone or in combination with increasing concentrations of SS-14 or SMS. As shown in Fig. 2B, EGF caused a significant 50% increase in PANC-1 cell proliferation after 2 days, a growth rate which was reduced by increasing concentrations of SS-14 and SMS, with a significant maximal inhibitory effect of 47% at 0.1 and 1 µM. Inhibitory effects of somatostatin of similar magnitude were also observed in these cells stimulated by FGF-2, cerulein, a cholecystokinin analog, and bombesin (data not shown).

View larger version (29K): [in this window] [in a new window]   Figure 2. Effects of SS-14 and SMS on basal and EGF-stimulated PANC-1 cell growth. PANC-1 cells were made quiescent by serum deprivation for 24 h, followed by incubation with or without increasing concentrations of SS-14 (black) or SMS (white) alone (A) or in combination with 1 nM EGF (gray) (B). Controls (c) are represented by the large white bars. Peptides were added daily. After 2 days, cells were trypsinized and counted with an Electronic Coulter Counter or a hemacytometer. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05; **, significantly different from EGF-stimulated cells at P < 0.05.

View larger version (23K): [in this window] [in a new window]   Figure 3. Tyrosine phosphatase activity in the PANC-1 cells. Quiescent cells were incubated with or without increasing concentrations of SS-14 (black) or SMS (white) for 30 min (A) or with 1 µM SS-14 or SMS for various times (B). Controls (c) are represented by the large white bars. Cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer. Cells were collected with a rubber policeman and homogenized by repeated strokes. After centrifugation, membranes were resuspended in the lysing buffer and used for tyrosine phosphatase assays. Tyrosine phosphatase activity is expressed as picomoles of phosphate released per minute per microgram of protein. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05.

View larger version (23K): [in this window] [in a new window]   Figure 4. Time course of SHP-1 activation under basal and EGF-stimulated conditions in the PANC-1 cells. PANC-1 cells were starved 24 h before incubation with or without 1 µM SS-14 (black) or SMS (white) for various times alone (A) or in combination with 1 nM EGF (gray) (B). Controls (c) are represented by the large white bars. In B, all cells were stimulated 5 min with EGF. For the 1-min period, 1 µM SS-14 or SMS was added to the medium 4 min after EGF; for the 5-min period, EGF and SS-14 or SMS were added at the same time; for the 30-min period, SS-14 or SMS were added 25 min before the addition of EGF. Cells were washed and lysed, and SHP-1 was immunoprecipitated as described in Materials and Methods. SHP-1 activity was assayed, with p-nitrophenylphosphate as substrate, with 20 µM microcystin LR to inhibit any serine/threonine phosphatase activity (28 ). Results are expressed as percentage of control values and are the mean ± SE of four separate experiments. Control SHP-1 activity represents 40 ± 2 nmol phosphate released/min·mg protein. *, Significantly different from control at P < 0.05.

View larger version (24K): [in this window] [in a new window]   Figure 5. Tyrosine phosphorylation of SHP-1 in the PANC-1 cells. Quiescent cells were incubated without (line 1) or with 1 µM SS-14 for 1 min (line 2), 5 min (line 3), and 30 min (line 4), washed, and lysed as described in Materials and Methods. Cell lysates were subjected to immunoprecipitation with anti-SHP-1 antibody. Immunoprecipitates were resolved in 10% SDS-PAGE, transferred to a membrane, and immunoblotted with an antiphosphotyrosine (A). The same membrane was then stripped and reprobed with an anti-SHP-1 antibody (B).

View larger version (17K): [in this window] [in a new window]   Figure 6. Tyrosine kinase activity in the PANC-1 cells. Quiescent cells were incubated with or without increasing concentrations of SS-14 (circles) or SMS (squares) alone (A) or in combination with 1 nM EGF (B) for 30 min. Controls (c) represent the basal activity. Cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer. Cells were collected with a rubber policeman and homogenized by repeated strokes. After centrifugation, membranes were resuspended in the lysing buffer and used for tyrosine kinase assays. Tyrosine kinase activity is expressed as picomoles of phosphate incorporated per minute per milligram of protein. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05; **, significantly different from EGF-stimulated cells at P < 0.05.

View larger version (50K): [in this window] [in a new window]   Figure 7. MAP kinase activities in the PANC-1 cells. PANC-1 cells were made quiescent by serum deprivation. Cells were then incubated with or without increasing concentrations (10-8–10-6 M; SS-8, SS-7, SS-6) of SS-14 for 5, 30, and 60 min (panels A and B). Cells were also preincubated for 30 min with increasing concentrations (10-9–10-6 M; SS-9, SS-8, SS-7, SS-6) of SS-14, followed by a 5-min stimulation with 1 nM EGF (E) (Panels C and D). Cells were lysed and subjected to electrophoresis for in-gel assay. Quantification of p44 and p42 activities, in response to the different treatments, appears in (B) and (D). Results are expressed as percentage of control values (white bar) and represent the mean ± SE of three separate experiments. Panels A and C are representative of one in-gel kinase assay. *, Significantly different from control at P < 0.05; **, significantly different from EGF-stimulated MAPK at P < 0.05.

View larger version (27K): [in this window] [in a new window]   Figure 8. SS-14 and SMS stimulated growth of the MIA PaCa-2 cells. MIA PaCa-2 cells were made quiescent by serum deprivation for 24 h, followed by incubation with or without increasing concentrations of SS-14 (black) or SMS (white) for 2 days (A) or 4 days (B). In C, cells were grown for 48 h with 1 nM EGF ± increasing concentrations of SS-14 or SMS. Control (c) values are represented by large white bars. After 2 or 4 days, cells were trypsinized and counted with an Electronic Coulter Counter or a hemacytometer. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05.

View larger version (26K): [in this window] [in a new window]   Figure 9. Membrane tyrosine phosphatase activity in the MIA PaCa-2 cells. Quiescent cells were incubated with or without increasing concentrations of SS-14 (black) or SMS (white) for 30 min (A) or for various time periods (B). Cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer in the absence of orthovanadate. Cells were collected with a rubber policeman and homogenized by repeated strokes. After centrifugation, membranes were resuspended in the lysing buffer and used for tyrosine phosphatase assays. Tyrosine phosphatase activity is expressed as picomoles of phosphate released per minute per microgram of protein. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05.

View larger version (32K): [in this window] [in a new window]   Figure 10. SHP-1 expression in MIA PaCa-2 and PANC-1 cells. Exponentially growing MIA PaCa-2 and PANC-1 cells were rinsed with PBS and lysed. Lysates were boiled and centrifuged at 1000 x g for 5 min. Ten micrograms of proteins from the supernatant were loaded on a 12.5% resolving gel. The samples were electrophoresed and electroblotted to membrane. SHP-1 was detected by chemiluminescence. A total protein lysate of Jurkat cells (standard) was given by the company as a positive control and applied also at 10 µg of proteins.

View larger version (15K): [in this window] [in a new window]   Figure 11. Tyrosine kinase activity in the MIA PaCa-2 cells. Quiescent cells were incubated with increasing concentrations of SS-14 or SMS for 30 min (A) or with 1 nM SS-14 (squares) or SMS (circles) for various time periods (B). C represents control unstimulated cells. Cells were rinsed with PBS before adding an ice-cold hypotonic lysing buffer. Cells were collected with a rubber policeman and homogenized by repeated strokes. After centrifugation, membranes were resuspended in the lysing buffer and used for tyrosine kinase assays. Tyrosine kinase activity is expressed as picomoles of phosphate incorporated per minute per milligram of protein. Values are the mean ± SE of three separate experiments performed in triplicate. *, Significantly different from control at P < 0.05.

View larger version (35K): [in this window] [in a new window]   Figure 12. MAPK activities in the MIA PaCa-2 cells. MIA PaCa-2 cells were made quiescent by serum deprivation. Cells were preincubated with increasing concentrations (10-9–10-6 M; SS-9–SS-6) of SS-14, followed by a 5 min stimulation with 1 nM EGF (E) (Panels A, B, C, and D). Control (c) represents the basal activity. Cells were lysed and subjected to electrophoresis for in-gel assay; quantification of p44, p42, and p38 activities, in response to the different treatments, appears in B and C. Results are expressed as percentage of control values (white bar) and represent the mean ± SE of three separate experiments. Panels A and C are representative of one in-gel kinase assay. *, Significantly different from control at P < 0.05.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Somatostatin is recognized as a growth-inhibitory factor in normal rat pancreas (35), in AR4–2J cells (a rat pancreatic acinar cancer cell line) (6), and in MIA PaCa-2 cells (a human pancreatic cancer cell line of ductal origin) (5, 9). Our data indicate that MIA PaCa-2 cells express sst1, -2 and -4 at elevated levels and sst3 and 5 at weak levels, whereas PANC-1 cells express sst5 predominantly and sst1, -2, and -4 at weak levels. The presence of these receptor subtypes themselves, on both cell lines, cannot explain the opposite effects of SS-14 and SMS on these cells and, therefore, suggests differences in the intracellular coupling systems.

Numerous studies reported that somatostatin can stimulate a PTPase activity (9, 10, 11) and especially that of SHP-1 (10, 14), whose activation may be one of the early steps leading to its antiproliferative action. In PANC-1 cells, we have demonstrated that SS-14 and its structural analog SMS can increase membrane PTPase activity and also that of SHP-1. The finding that somatostatin significantly stimulated SHP-1 activity maximally within 1 min suggests its early implication in the cascade reactions that it initiated. The fact that orthovanadate, a tyrosine phosphatase inhibitor, prevented SS-14 and SMS-induced growth inhibition in these cells strongly argues in favor of PTPase involvement in the somatostatin-induced antiproliferative signal (data not shown). This inhibition of PANC-1 cell growth by somatostatin substantiates previous work on the antiproliferative effect of somatostatin on tumoral pancreatic cells (5, 6). Furthermore, our data, along with those of others (9, 10, 11, 12, 13, 14), strengthens the concept that the antiproliferative action of somatostatin may involve stimulation of a PTPase activity. Our results agree with those of Lopez et al. (14), who demonstrated that SHP-1 (PTP1C) activity was stimulated in CHO cells expressing the sst2 receptor subtype. They also demonstrated that somatostatin can promote dissociation of the sst2/SHP-1 complex and induce tyrosine dephosphorylation of SHP-1, leading to its activation. Although we were able to confirm phosphorylation of SHP-1 in our study, we were unable to demonstrate its dephosphorylation in response to somatostatin, as shown by Lopez et al. (14). This discrepancy may result from higher concentrations of somatostatin receptors in transfected CHO cells than the untreated PANC-1 cells in our study.

We also observed that SHP-1 can be activated equipotently by EGF independently of somatostatin, as recently observed in CHO cells stimulated by insulin (36). This finding may result from the fact that SHP-1 possesses SH2 domains involved in its association with multiple signaling molecules (37). Although somatostatin stimulates SHP-1 activity, we could not observe further activation of the enzyme when somatostatin was combined with EGF; this observation suggests that both peptides may compete for the same intracellular pool of SHP-1. Again, our data differ from those of Bousquet et al. (36), who demonstrated that addition of the somatostatin agonist RC-160 to insulin in CHO cells further increased SHP-1 activation above that of insulin alone by about 50%. In their study, insulin alone increased SHP-1 activity only by 20% at 100 nM, whereas 1 nM EGF resulted in a 50% activation in our study. Furthermore, the CHO cells were transfected with the sst2 receptor. Such differences may also indicate that EGF, coupling to SHP-1 via its receptor, is much more sensitive and efficient than SHP-1 coupled to the insulin receptor upon insulin stimulation. Indeed, 50% activation of SHP-1 by 1 nM EGF is more efficient than 20% activation by 100 nM insulin within 1 min for both stimuli. The recruitment of SHP-1 by the EGF receptor, in response to EGF, may explain why high concentrations of somatostatin are needed to inhibit basal PANC-1 cell growth; in these cells, the EGF receptor is overexpressed, and TGF-, which interacts with the EGF receptor, is also produced and released and acts as an autocrine-positive growth factor (38).

We also examined other intracellular events known to be associated with cell proliferation and, thus, potential targets for somatostatin regulation. In these PANC-1 cells, SS-14 and its analog inhibited basal and EGF-stimulated tyrosine kinase activities; these data support the idea that somatostatin can inhibit cell growth by activating PTPases needed to dephosphorylate and inactivate tyrosine kinases associated with the growth process. Our results also demonstrated that somatostatin can also inhibit another kinase, the p42 MAPK, recognized as an important intracellular transducer whose translocation to the nucleus is associated with the induction of gene expression (34).

In these PANC-1 cells, our data suggest that somatostatin inhibition of basal and stimulated growth could involve SHP-1 activation, which in turn, can dephosphorylate tyrosine kinases. Within this proposed pathway, we were unable, however, to confirm SHP-1 dephosphorylation, postulated to be associated with its activation and its release from the somatostatin receptor (14).

We also investigated growth regulation of another human pancreatic cancer cell line, the MIA PaCa-2 cells. Contrary to growth inhibition observed in the PANC-1 cells, SS-14 and its analog SMS failed to inhibit basal and EGF-stimulated growth of these MIA PaCa-2 cells, as well as intracellular signals known to be involved in the control of growth processes. These data contrast with those of Liebow et al. (5, 9), who demonstrated that SS-14 and its analogues RC-160 and RC-121 inhibited EGF-stimulated growth of these MIA PaCa-2 cells, but agree with those reported by Gillepsie et al. (24), who found that SS-14 and RC-160 did not cause their growth inhibition when stimulated by EGF. They explained this absence of growth inhibition by a total absence of somatostatin receptors (24). Our data stress the contrary, because the MIA PaCa-2 cells express, at different levels, the five somatostatin receptor subtypes. Besides the somatostatin receptor, another important component has been identified as part of the mechanism responsible for the inhibitory action of somatostatin. Initially, many investigators (9, 10, 13) reported activation of PTPase activity associated with somatostatin binding to its receptor. Activation of this PTPase has been coupled to the antiproliferative effect of somatostatin by virtue of its ability to dephosphorylate and inactivate growth factor receptor kinases, with the discovery that SHP-1 copurified with the somatostatin receptor (13). In the MIA PaCa-2 cells, our data clearly indicate that the above described mechanism is not operating at all, probably because these cells do not have any SHP-1. This lack of SHP-1 was indeed confirmed, first, by demonstrating the total absence of any PTPase activity after immunoprecipitation with a specific SHP-1 antibody, and second, by the absence of the SHP-1 protein determined by Western blot; the PANC-1 cells on the contrary exhibited both the activity and the protein, and their growth was inhibited by somatostatin.

Although inhibition of the MIA PaCa-2 cell growth could not be seen in response to somatostatin, the hormone manifested its presence by stimulating their growth. Contrary to conventional belief that somatostatin is, above all, an inhibitory factor, its growth-promoting action has previously been observed in BON cells, human pancreatic carcinoid cells (39) in A431 cells, in human epidermoid carcinoma cells (40, 41), in cultured human meningioma cells (42), in Jurkat leukemia T cells (43), and in human Caco-2 intestinal cells (44). Although the mechanism by which somatostatin induces growth is still unclear, a reduction of cAMP production has been postulated and observed in BON cells (39), in meningioma cells (42), and in Caco-2 cells (44). In the MIA PaCa-2 cells, this reduction of cAMP production by SS-14 and SMS was not observed (data not shown); and therefore, this potential mechanism cannot be applied in these cells.

Besides SHP-1, usually associated with an inhibitory state, SHP-2 (or PTP1D) has recently been associated with growth-related processes. Its activation and association with mitogenesis have been observed in fibroblasts in response to PDGF and insulin (45, 46) and in Rat 1 cells in response to EGF (47). In our study, SS-14 and SMS significantly increased, although moderately, total PTPase activity in the MIA PaCa-2 cells. We also observed that orthovanadate inhibited the stimulatory effect of somatostatin in MIA PaCa-2 cell growth, thus suggesting the implication of some PTPases (data not shown). Furthermore, SHP-2 has been identified by immunoprecipitation in these cells, but we were unable to measure its activity; this is not surprising because, according to Rivard et al. (45), the enzyme has to be overexpressed to measure its activity. Therefore, it remains plausible that SHP-2 participates as an activator of specific intracellular pathways leading to proliferation, although we cannot yet ascertain its real implication. However, our results also showed that somatostatin stimulates the membrane PTPase activity maximally after 60 min, which coincides with the minimal tyrosine kinase activity; therefore, we cannot exclude that the late activation of PTPase activity is responsible for the negative regulation of the tyrosine kinase activity.

Tyrosine kinase activation by gastrointestinal hormones has been observed in rat pancreas (31) and in response to EGF and bombesin in MIA PaCa-2 and PANC-1 cells (33). In this study, there exists a close relationship between SS-14 and SMS growth stimulation of the MIA PaCa-2 cells and their tyrosine kinase activation; indeed, both events are concentration dependent, with a maximal response reached at the same concentration. Furthermore, this relationship is further strengthened by the observation that genistein, a tyrosine kinase inhibitor, comparatively blocked SS-14 and SMS-stimulated growth and tyrosine kinase activation.

MAP kinase activation is known to play an important role in cell proliferation (34). In the MIA PaCa-2 cells, we have previously reported a constitutive activity of the p44/p42 kinase unresponsive to growth factors, hormones, and inhibitors, and an activation of p38 kinase (a stress kinase) by growth factors and gastrointestinal hormones (33). The implication of p38 kinase in cell proliferation has not yet been determined in the MIA PaCa-2 cells, but its activation has been previously associated with T cell proliferation (48), with T cell HIV-1 replication (49), and with intestinal wound repair (50). Its activation has also been reported in rat pancreatic acini in response to CCK (51). Contrary to growth factors and gastrointestinal hormones, somatostatin did not stimulate p38 MAPK, thus suggesting that somatostatin stimulates cell growth independently of the activation of p44, p42, and p38 MAP kinases.

In two human pancreatic cancer cells, we have demonstrated that somatostatin and its analog exerted different growth responses, depending on the cellular context. The pivotal element in growth control of these cells seems to be the presence or the absence of SHP-1. The inhibitory effect of somatostatin in PANC-1 cells seems to be mediated via stimulation of a PTPase activity and especially that of SHP-1 and inhibition of membrane tyrosine kinase and of p42 MAP kinase activities. In MIA PaCa-2, SHP-1 is absent, and no antiproliferative response was observed; however, cell growth was observed in response to somatostatin, along with activation of tyrosine kinase activity. Further studies are needed to identify the exact mechanisms by which cell proliferation proceeds in response to somatostatin. Our data also pointed out that detection of SHP-1 activity or protein may become a good marker for prognosis of pancreatic cancer evolution and sensitivity to somatostatin treatment.

	Footnotes

 
¹ This research was supported by grants from the Natural Science and Engineering Research Council of Canada (GP6369), from the Medical Research Council of Canada (MT 13203), and from le Ministère de l’Éducation du Québec (ER1092).

² Recipient of a Canadian Association of Gastroenterology/Hoechst Marrion Roussel Summer Research Initiative Award.

³ Recipient of a fellowship from Junea De Extremadura.

Received June 16, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R 1973 Hypothalamic polypeptide that inhibits secretion of immuno-reactive pituitary growth hormone. Science 179:77–79[Abstract/Free Full Text]
2. Reichlin S 1983 Somatostatin. N Engl J Med 309:1495–1501[Medline]
3. Boden G, Sivitz MC, Owen OE 1975 Somatostatin suppresses secretin and pancreatic exocrine secretion. Science 190:163–165[Abstract/Free Full Text]
4. Schally AV, Coy DH, Meyers CA 1978 Hypotalamic regulatory hormones. Annu Rev Biochem 47:89–128[CrossRef][Medline]
5. Liebow C, Hierowski M, DuSapin K 1986 Hormonal control of pancreatic cancer growth. Pancreas 1:44–48[Medline]
6. Viguerie N, Tahiri-Jouti N, Ayral AM, Cambillau C, Scemama JL, Bastie MJ, Knuhtsen S, Esteve JP, Pradayrol L, Susini C, Vaysse N 1989 Direct inhibitory effects of a somatostatin analogue, SMS 201–995, on AR4–2J cell proliferation via a pertussis toxin-sensitive guanosine triphosphate-binding protein-independent mechanism. Endocrinology 24:1017–1025
7. Bell GI, Reisine T 1993 Molecular biology of somatostatin receptors. Trends Neurosci 16:34–38[CrossRef][Medline]
8. Lewin MJ 1992 The somatostatin receptor in the GI tract. Annu Rev Physiol 54:455–468[CrossRef][Medline]
9. Liebow C, Reilly C, Serrano M, Schally AV 1989 Somatostatin analogues inhibit growth of pancreatic cancer by stimulating tyrosine phosphatase. Proc Natl Acad Sci USA 86:2003–2007[Abstract/Free Full Text]
10. Pan MG, Florio T, Stork PJS 1992 G protein activation of a hormone-stimulated phosphatase in human tumor cells. Science 256:1215–1217[Abstract/Free Full Text]
11. Colas B, Cambillau C, Buscail L, Zeggari M, Esteve JP, Lautre V, Thomas F, Vaysse N, Susini C 1992 Stimulation of a membrane tyrosine phosphatase activity by somatostatin analogues in rat pancreatic acinar cells. Eur J Biochem 207:1017–1024[Medline]
12. Hierowski MT, Liebow C, Du Sapin K, Schally AV 1985 Stimulation by somatostatin of dephosphorylation of membrane proteins in pancreatic cancer MIA PaCa-2 cell line. FEBS Lett 179:252–256[CrossRef][Medline]
13. Zeggari M, Esteve JP, Rauly I, Cambillau C, Mazarguil H, Dufresne M, Pradayrol L, Chayvialle JA, Vaysse N, Susini C 1994 Co-purification of a protein tyrosine phosphatase with activated somatostatin receptors from rat pancreatic acinar membranes. Biochem J 303:441–448
14. Lopez F, Esteve JP, Buscail L, Delesque N, Saint-Laurent N, Theveniau M, Nahmias C, Vaysse N, Susini C 1997 The tyrosine phosphatase SHP-1 associates with the sst2 somatostatin receptor and is an essential component of sst2-mediated inhibitory growth signalling. J Biol Chem 272:24448–24454[Abstract/Free Full Text]
15. Buscail L, Esteve JP, Saint-Laurent N, Bertrand V, Reisine T, O’Carroll AM, Bell GI, Schally AV, Vaysse N, Susini C 1995 Inhibition of cell proliferation by somatostatin analogue RC-160 is mediated by somatostatin receptor subtypes SSTR2 and SSTR5 through different mechanisms. Proc Natl Acad Sci USA 92:1580–1584[Abstract/Free Full Text]
16. Cordelier P, Esteve JP, Bousquet C, Delesque N, O’Carroll AM, Schally AV, Vaysse N, Susini C, Buscail L 1997 Characterization of the antiproliferative signal mediated by the somatostatin receptor subtype sst5. Proc Natl Acad Sci USA 94:9343–9348[Abstract/Free Full Text]
17. Cattaneo MG, Amoroso D, Sanguini AM, Vicentini LM 1996 A somatostatin analogue inhibits MAP kinase activation and cell proliferation in human neuroblastoma and in human small cell lung carcinuma cell lines. FEBS Lett 397:164–168[CrossRef][Medline]
18. Yoshitomi H, Fujii Y, Miyazakim NN, Inagaki N, Seino S 1997 Involvement of MAP kinase and c-fos signaling in the inhibition of cell growth by somatostatin. Am J Physiol 272:E769–E774
19. Todisco A, Seva C, Takeuchi Y, Dickinson CJ, Yamada T 1995 Somatostatin inhibits AP-1 function via multiple protein phosphatase. Am J Physiol 269:G160–G166
20. Schally AV 1988 Oncological applications of somatostatin analogues. Cancer Res 48:6977–6985[Medline]
21. Upp JR, Olson GJ, Alexander RW, Townsend CM, Thompson JC 1988 Inhibition of growth of two human pancreatic adenocarcinomas in vivo by somatostatin analogue SMS 201–995. Am J Surg 155:29–35[CrossRef][Medline]
22. Tahiri-Jouti N, Cambillau C, Viguerie N, Vidal C, Buscail L, Saint-Laurent N, Vaysse N, Susini C 1992 Characterization of a membrane tyrosine phosphatase in AR4–2J cells: regulation by somatostatin. Am J Physiol 262:G1007–G1014
23. Lierh RH, Melnykovych G, Solomon TE 1990 Growth effects of regulatory peptides on human pancreatic cancer cell lines MIA PaCa-2 and PANC-1. Gastroenterology 98:1666–1674[Medline]
24. Gillespie J, Poston GJ, Schachter M, Guillou PJ 1992 Human pancreatic cancer cell lines do not express receptor for somatostatin. Br J Cancer 66:483–487[Medline]
25. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.[Medline]
26. Buscail L, Saint-Laurent N, Chastre E, Vaillant JC, Gespach C, Capella G, Kalthoff H, Liuis F, Vaysse N, Ssini C 1996 Loss of sst2 somatostatin receptor gene expression in human pancreatic and colorectal cancer. Cancer Res 56:1823–1827[Abstract/Free Full Text]
27. Kameshita I, Fujisawa H 1989 A sensitive method for detection of calmodulin-dependent protein kinase II activity in sodium dodecyl sulfate-polyacrylamide gel. Anal Biochem 183:139–143[CrossRef][Medline]
28. MacKintosh C, Beattie KA, Klumpp S, Cohen P, Codd GA 1990 Cyanobacterial microcystin LR is a potent and specific inhibitor of protein phosphatases 1 and 2A from both mammals and higher plants. FEBS Lett 264:187–192[CrossRef][Medline]
29. Fisher WE, Doran TA, Muscarella IP, Boros LG, Ellison EC, Schrimer WJ 1998 Expression of somatostatin receptor subtype 1–5 genes in human pancreatic cancer. J Natl Cancer Inst 90:322–324[Free Full Text]
30. Korc M, Magun BE 1985 Binding and processing of epidermal growth factor in PANC-1 human pancreatic carcinoma cells. Life Sci 36:1849–1855.[CrossRef][Medline]
31. Rivard N, Rydzewska G, Lods JS, Morisset J 1995 Novel model of integration of signaling pathways in rat pancreatic acinar cells. Am J Physiol 269:G352–G362
32. Duan RD, Williams JA 1994 Cholecystokinin rapidly activates mitogen-activated protein kinase in rat pancreatic acini. Am J Physiol 267:G401–G408
33. Douziech N, Calvo E, Lainé J, Morisset J 1998 Activation of ERK-2 and p38 MAP kinase in growth responsive pancreatic cancer cells: presence of a constitutive ERK-1 activity. Gastroenterology 114:A454 (Abstract)
34. Seger R, Krebs EG 1995 The MAPK signaling cascade. FASEB J 9:726–735[Abstract]
35. Morisset J 1984 Somatostatin: a potential antigrowth factor for the exocrine pancreas. Regul Pept 10:11–22[CrossRef][Medline]
36. Bousquet C, Delesque N, Lopez F, Saint-Laurent N, Estève N, Bedecs K, Buscail L, Vaysse N, Susini C 1998 sst2 Somatostatin receptor mediates negative regulation of insulin receptor signaling through the tyrosine phosphatase SHP-1. J Biol Chem 273:7099–7106[Abstract/Free Full Text]
37. Neel BG, Tonks NK 1997 Protein tyrosine phosphatases in signal transduction. Curr Opin Cell Biol 9:193–204[CrossRef][Medline]
38. Smith JJ, Derynck R, Korc M 1987 Production of transforming growth factor in human pancreatic cancer cells: evidence for superagonist autocrine cycle. Proc Natl Acad Sci USA 84:7567–7570[Abstract/Free Full Text]
39. Ishizuka J, Beauchamp RD, Evers BM, Townsend CM, Thompson JC 1992 Unexpected growth-stimulatory effect of somatostatin analogue on cultured human pancreatic carcinoid cells. Biochem Biophys Res Commun 185:577–581[CrossRef][Medline]
40. Kamiya Y, Ohmura E, Arai M, Fujii T, Hayakawa F, Ito J, Kawaguchi M, Tsushima T, Sakuma N 1993 Effect of somatostatin ans its analogue on proliferation of human epidermoid carcinoma cells in vitro. Biochem Biophys Res Commun 191:302–307[CrossRef][Medline]
41. Kamiya Y, Ito J, Fujii T, Horie K, Kawaguchi M, Hori R, Fujinami S, Fujinami T 1995 In vitro and in vivo effects of somatostatin on the growth of A431 cells. Horm Metab Res 27:179–181[Medline]
42. Koper JW, Markstein R, Kohler DJ, Kwekkeboom CJJ, Lamberts SWJ, Reubi JC 1992 Somatostatin inhibits the activity of adenylate cyclase in cultured human meningioma cells and stimulates their growth. J Clin Endocrinol Metab 74:543–547[Abstract]
43. Cardoso A, Ghamrawy CE, Gautron JP, Horvat B, Gautier N, Enjalbert A, Krantic S 1998 Somatostatin increases mitogen-induced IL-2 secretion and proliferation oh human Jurkat T cells via sst3 receptor isotype. J Cell Biochem 68:62–73[CrossRef][Medline]
44. Sgambati SA, Zarif A, Basson MD 1996 Octreotide differentially modulates human Caco-2 intestinal epithelial cell proliferation and differentiation by decreasing intracellular cAMP. Regul Pept 61:219–227[CrossRef][Medline]
45. Rivard N, McKenzie FR, Brondello JM, Pouyssegur J 1995 The phosphotyrosine phosphatase PTP1D but not PTP1C, is an essential mediator of fibroblast proliferation induced by tyrosine kinase and G-protein coupled receptors. J Biol Chem 270:11017–11024[Abstract/Free Full Text]
46. Milarski RL, Sartiel AR 1994 Expression of catalytically inactive Syp phosphatase in 3T3 cells blocks stimulation of mitogen-activated protein kinase by insulin. J Biol Chem 269:21239–21244[Abstract/Free