| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Transcriptional Activity and Is a Key Regulator of the Cellular Response to Estrogens and Antiestrogens1
Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710
Address all correspondence and requests for reprints to: Dr. Donald P. McDonnell, Department of Pharmacology and Cancer Biology, Duke University Medical Center, P.O. Box 3813, Durham, North Carolina 27710. E-mail: mcdon016{at}acpub.duke.edu
| Abstract |
|---|
|
|
|---|
(ER
) and the recently identified
ERß share a high degree of amino acid homology; however, there are
significant differences in regions of these receptors that would be
expected to influence transcriptional activity. Consequently, we
compared the mechanism(s) by which these receptors regulate target gene
transcription, and evaluated the cellular consequences of coexpression
of both ER subtypes. Previously, it has been determined that ER
contains two distinct activation domains, ER
-AF-1 and ER
-AF-2,
whose transcriptional activity is influenced by cell and promoter
context. We determined that ERß, like ER
, contains a functional
AF-2, however, the ERß-AF-2 domain functions independently within the
receptor. Of additional significance was the finding that ERß does
not contain a strong AF-1 within its amino-terminus but, rather,
contains a repressor domain that when removed, increases the overall
transcriptional activity of the receptor. The importance of these
findings was revealed when it was determined that ERß functions as a
transdominant inhibitor of ER
transcriptional activity at
subsaturating hormone levels and that ERß decreases overall cellular
sensitivity to estradiol. Additionally, the partial agonist activity of
tamoxifen manifest through ER
in some contexts was completely
abolished upon coexpression of ERß. In probing the mechanisms
underlying ERß-mediated repression of ER
transcriptional activity
we have determined that 1) ER
and ERß can form heterodimers within
target cells; and 2) ERß interacts with target gene promoters in a
ligand-independent manner. Cumulatively, these data indicate that one
role of ERß is to modulate ER
transcriptional activity, and thus
the relative expression level of the two isoforms will be a key
determinant of cellular responses to agonists and antagonists. | Introduction |
|---|
|
|
|---|
Until recently it was considered that a single ER was responsible for
all of the biological actions of estrogens and antiestrogens. However,
the recent identification of ERß (6, 7) has indicated that the
cellular responses to ER ligands are far more complex. The two estrogen
receptors, ER
and ERß, have similar overall structures, displaying
a high degree of amino acid conservation in the central DNA-binding
domain (DBD) and moderate conservation in the ligand-binding domain
(LBD; C-terminus), but considerable divergence in the amino-terminus.
Not surprising, therefore, ER
and ERß interact with the same DNA
response elements (8) and exhibit similar, but not identical, ligand
binding characteristics. Although a specific physiological role for
ERß remains to be defined, its identification has provided a
potential explanation for the biological actions of estrogen(s) in
cells where no immunoreactive ER
could be detected. Interestingly,
preliminary localization studies have revealed that there are many
tissues in which both ER subtypes are coexpressed (6, 7, 9). Thus, the
impact of ERß on estrogen biology is likely to occur as a consequence
of 1) direct actions of ERß, where it is responsible for regulating
target gene transcription; and 2) indirect activities, where ERß
modulates ER
action in tissues where they are coexpressed.
Although the precise mechanism by which ER regulates transcription
remains to be determined, considerable progress has been made in
defining the domains within ER
required for its activity.
Specifically, it has been demonstrated that the transcriptional
activity of ER
is mediated by two activation functions (AFs) located
in the amino-terminal (AF-1) and carboxyl-terminal (AF-2). Although
both of these AFs function in a synergistic manner in most
circumstances, they can also function independently in a cell- and
promoter-specific manner, an activity that may explain the
tissue-selective agonist activity of some ER ligands (10, 11). In this
regard, it has been observed that 17ß-estradiol can function as an
agonist in all environments regardless of whether AF-1 or AF-2 is the
dominant activator. Not surprisingly, therefore, the pure antiestrogen
ICI 182,780, which inhibits the activity of both AF-1 and AF-2,
completely blocks the ability of ER
to activate transcription
through classical ERE-mediated pathways. Unlike the pure antiestrogens,
however, the relative agonist/antagonist activities of most other
antiestrogens are determined by the cell and promoter context. For
instance, compounds such as tamoxifen inhibit AF-2 activity, and
consequently function as antagonists in all environments where AF-2 is
required. In contexts where AF-1 is the dominant activator, on the
other hand, tamoxifen manifests partial agonist activity. These
observations led to the hypothesis that the tissue-selective biological
activity exhibited by selective ER modulators (SERMs) such as
tamoxifen, reflects their ability to differentially regulate AF-1 or
AF-2. However, the identification of ER ligands such as raloxifene and
GW5638, which function as estrogens in the bone and the cardiovascular
system but do not appear to function as either AF-1 or AF-2 agonists,
indicates that the existing models of ER pharmacology are incomplete
(12, 13). Clearly, they must now be expanded to include a consideration
of the impact of ERß. It is likely that the existence of ER
and
ERß will be as important to ER pharmacology as the two progesterone
receptor subtypes, PR-A and PR-B, are to the pharmacology of progestins
and antiprogestins. We base this hypothesis on our earlier studies of
PR action, where it was shown that PR-A and PR-B were not functionally
identical. Specifically, we observed that both receptor forms could
manifest autonomous activity in some cell contexts, whereas in others
the A isoform was a weak transcriptional activator and, in fact,
functioned as a transdominant inhibitor of human PR-B activity (14).
The possibility that there were similarities between these two systems
prompted us to explore the impact of ERß on the pharmacology of
ER
. Although ER
/ERß are not derived from the same gene as are
the two forms of PR, we believed that it would be useful to consider
ER
/ERß as having a similar relationship as PR-A/B. The aim of this
study, therefore, was to compare the transcriptional activities of
ER
and ERß and to evaluate the contribution of ERß to the
overall pharmacology of estrogens and antiestrogens.
| Materials and Methods |
|---|
|
|
|---|
Plasmids
The mammalian expression plasmid for ER
(pRST7ER) has been
described previously (11). Plasmids expressing ER
mutants (ER-AF1,
ER-AF2, ER-Null) were also described previously (11). The ERß
expression plasmid, pRST7ERß, was constructed as follows. A PCR 3.1
vector (Invitrogen, Carlsbad, CA) containing the human
ERß coding sequence (amino acids 1477; gift from Dr. Mark Nuttall,
SmithKline Beecham) was digested with HindIII
and XbaI, and ERß was ligated into pRST7ER, previously
digested with HindIII and XbaI to remove the
ER
complementary DNA (cDNA). An epitope-modified series of ER
and
ERß expression vectors was also created. Specifically, an
amino-terminus FLAG tag was added to the ER
and ERß expression
vectors by PCR. The sequences of the oligonucleotides for PCR were
5'-GTGGACGTCGACATGGACTACAAAGACGACGACGACAAAATGACCATGACC-CTCCAC
(forward) and 3'-GTGGAGGGATCCTCAGACTGTGGCAG-GGAAACC (reverse) for
ER
and
5'-GTGGACGTCGACATGGACTACAAAGACGACGACGACAAAATGAATTACAGCATTCCC
(forward) and 3'-GTGAGGTCTAGATCACTGAGACTGTGGGTT (reverse) for
ERß.
The mammalian expression plasmid for the ERß mutant ERß-AF1 was constructed by site-directed mutagenesis. The pRST7ERß plasmid was used as the template, and the three point mutations were created using PCR-based oligonucleotide-directed mutagenesis, according to the manufacturers protocol (Stratagene, La Jolla, CA). The sequences of the oligonucleotides used for PCR were 5'-GTGGTCCCAGTGTATGCCCTGCTGCTGGCG ATGCTGGCTGCCCACGTGCTTCGCGGG (forward) and 5'-CCCGCGAAGCACGTGGGCAGCCAGCATCGCCAGCAGCAGGGCATACAC TGGGACCAC (reverse).
The plasmid ERß-AF2 was constructed as follows: an empty pRST7 vector
was first created by digesting pRST7ER with HindIII and
SmaI to remove the ER
cDNA, blunt ends within the vector
were created with Klenow, and the vector was recircularized by
ligation. The pRST7 vector was digested with XbaI, and a PCR
fragment was generated from pRST7ERß (containing amino acids 90477
of the coding sequence for ERß) and ligated into the pRST7 vector.
The sequences of the oligonucleotides used for PCR were
5'-GTGAGGTCTAGAATGAAGAGGGATGCTCACTTC (forward) and
3'-GTGAGGTCTAGATCACTGAGACTGTGGGTT (reverse).
To compare the stability of the ERß mutants in transfected cells, we created a duplicate set of vectors in which an amino-terminus FLAG tag was added to the expression vectors for the ERß mutants by PCR. The sequences of the oligonucleotides used for PCR for the ERß-AF1 mutant were the same as those used to construct the FLAG-tagged wild-type ERß. The oligonucleotides used to create the FLAG-tagged ERß-AF2 mutant were 5'-GTGGACTCTAGAATGGACTACAAAGACGACGACGACAAATGCGCTGTCTG CAGCGATTAC (forward) and 3'-GTGAGGTCTAGATCACTGAGACTGTGGGTT (reverse).
The GAL4-DBD-ER N-terminus fusion constructs were cloned into the
pBK-cytomegalovirus (CMV) mammalian expression vector. Construction of
the pBKC-DBD plasmid has been described previously (15).
pBKC-DBD-ER
-(1182) was constructed as follows. The pBKC-DBD
plasmid was digested with EcoRI and ClaI, and a
PCR fragment (containing the coding sequence for the first 182 amino
acids of ER
) was generated from pRST7ER and ligated into these
sites. The sequences of the oligonucleotides for PCR were
5'-GTGCAGGAATTCATGACCATGACCCTCCAC (forward) and
5'-GTGCAGATCGATAGTCTCCTTGGCAGATTC (reverse). pBKC-DBD-ERß-(195) was
constructed as follows. The pBKC-DBD plasmid was digested with
EcoRI and ClaI, and a PCR fragment (containing
the coding sequence for the first 95 amino acids of ERß) was
generated from pRST7ERß and ligated into these sites. The sequences
of the oligonucleotides for PCR were 5'-GTGCAGGAATTCATGAATTACAGCATTCCC
(forward) and 5'-GTGCAGATCGATGAAGTGAGCATCCCTCTT (reverse).
pBKC-DBD-ER
-LBD(3x) was constructed as follows: the pBKC-DBD plasmid
was digested with EcoRI and ClaI, and a PCR
fragment (containing the coding sequence for amino acids 282595 of
ER
) was generated from pRST7-ER-AF-1 and ligated into these sites.
The sequences of the oligonucleotides for PCR were
5'-GTGCAGGAATTCATGTCTGCTGGAGACATGAGA (forward) and
3'-GTGCAGATCGATGACTGTGGCAGGGAAACC (reverse).
All of the PCR-based constructs were sequenced to verify the accuracy of the amplified sequences.
Cell culture and transient transfection assays
HepG2, HeLa, and 293 cells were maintained in MEM (Life Technologies, Inc.) supplemented with 10% FCS (Life Technologies, Inc.). MCF-7 and SKBR3 cells were maintained in
DMEM (Life Technologies, Inc.) supplemented with 10% FCS
(Life Technologies, Inc.). Cells were plated in 24-well
plates (coated with gelatin for transfections of HepG2 cells) 24 h
before transfection. DNA was introduced into the cells using lipofectin
(Life Technologies, Inc.). Triplicate transfections were
performed using 3 µg total DNA. In standard transfections, 1500 ng
reporter (C3-Luc, 3x-ERE-TATA-Luc, or 5x-GAL4-TATA-Luc), 500 ng
receptor (pRST7ER, pRST7ERß, ER mutants, or GAL4 fusions), 100 ng of
the pBKC-ßgal normalization vector (16), and 900 ng of the control
vector pBSII-KS (Stratagene) were used. The reporter
C3-Luc contains the estrogen-responsive complement 3 gene promoter, and
the 3x-ERE-TATA-Luc reporter contains three copies of the vitellogenin
ERE. The reporter 5x-GAL4-TATA-Luc (a gift from Dr. Xiao-Fan Wang, Duke
University Medical Center) contains five palindromic copies of the GAL4
transcription factor response element cloned into pGL2-TATA-Inr
(Stratagene). Cells were incubated with the DNA/lipofectin
mix for 3 h, then washed with PBS and incubated with the
appropriate hormone in phenol red-free medium containing 10%
charcoal-stripped FCS (HyClone Laboratories, Inc., Logan,
UT) for 48 h. Luciferase and ß-galactosidase assays were
performed as described previously (17). All experiments were repeated a
minimum of three times.
Western immunoblot analysis
293 cells (human embryonic kidney cells) were transfected with
the expression plasmids for ER
, ERß, or the ERß mutants. Whole
cell extracts were prepared as described previously (18). Fifty
micrograms of whole cell extracts for each sample were run on a 10%
SDS-PAGE gel and transferred to nitrocellulose. Immunoblotting was
performed using a mouse monoclonal anti-FLAG antibody. Immunocomplexes
were detected by ECL.
| Results |
|---|
|
|
|---|
- and ß-forms of the human ER are functionally
distinct
and
ERß. These cell lines were chosen for our studies because they
require exogenous ER
or ERß to activate ERE-mediated
transcription, enabling an assessment of the transcriptional responses
of each receptor in isolation. Specifically, the ER expression vectors
(pRST7ER and pRST7ERß) were transiently transfected into either HepG2
or HeLa cells together with the estrogen-responsive reporter
3x-ERE-TATA-Luc or C3-Luc. The input concentration for each expression
vector used in these studies was equivalent and was that which gave a
maximal response under the conditions of the assay. In addition, using
a duplicate set of vectors in which we added an amino-terminus FLAG
epitope, we could show by Western immunoblot analysis that the ER
and ERß cDNAs directed similar levels of ER expression (data not
shown). Although we demonstrated that the presence of the FLAG tag did
not affect the estradiol-mediated transcriptional activity of either
receptor (data not shown), we elected to use the native receptors for
our studies because we were unsure how the FLAG tag would affect more
subtle functions of ER
and ERß. Using this system we examined the
transcriptional responses of ER
and ERß over a range of
concentrations of the different ER ligands (Fig. 1A
is a more efficacious
activator in this model system. Interestingly, all of the SERMS and
pure antagonists tested displayed no agonist or inverse agonist
activities on ERß on either of the promoters studied (Fig. 1A
in HepG2 cells on the C3-Luc
reporter. In this environment, GW7604 did not exhibit agonist activity
on ER
, whereas ICI 182,780, raloxifene, and idoxifene functioned as
inverse agonists.
|
and ERß to pharmacological agents are different, a finding that
may be important in understanding the cell-selective actions of these
compounds.
We observed that 17ß-estradiol was a stronger activator of ER
than
ERß in HepG2 cells on the C3-Luc reporter (Fig. 1A
). To investigate
whether this observation holds in other cell and promoter contexts, we
examined the effect of the agonist 17ß-estradiol on ER
and ERß
transcriptional activities in HepG2 and HeLa cells on the
3x-ERE-TATA-Luc and C3-Luc reporters (Fig. 1
, BD). In the absence of
hormone, ER
showed a significantly higher level of basal
transcriptional activity than ERß in both HepG2 (Fig. 1B
) and HeLa
cells (Fig. 1
, C and D). This effect was observed on both the simple
and complex promoters. In comparing the overall efficacies of ER
and
ERß, the basal activity of the former must be considered, as we have
shown previously that this activity is receptor-dependent and can be
completely suppressed using pure antiestrogens (16). It has been
reported previously that ER
and ERß have equivalent affinities for
estradiol (8); however, in our assays the EC50 for
estradiol was approximately 1.5 orders of magnitude less for ER
than
for ERß in both HepG2 (Fig. 1B
) and HeLa (data not shown) cells.
Furthermore, the efficacies displayed by ER
were consistently higher
than those displayed by ERß under the conditions we used (Fig. 1
, B
and C). Reproducibly, we found that ERß demonstrates about 2060%
of the total activity of ER
. Similar results were observed in
transient transfection assays performed in ROS (rat osteosarcoma) and
SKBR3 (mammary carcinoma) cell lines (data not shown). Based on these
studies, we conclude that 17ß-estradiol is a more potent and
efficacious activator of ER
, and that it is likely that both
receptors contribute in a unique manner to the cellular response to
estrogens. Overall, our results define a major mechanistic distinction
between the two ERs; ERß is strictly dependent on pure agonists for
the activation of transcription from its target promoters, whereas
ER
can be activated by both agonists, partial agonists (SERMS), and
ligand-independent mechanisms.
The activation domains within ER
and ERß are not functionally
equivalent
We and others have shown that both activation domains, AF-1 and
AF-2, are required for maximal agonist-dependent and ligand-independent
activation of transcription by ER
(11). Additionally, in contexts
where ER
-AF-1 alone can function as an autonomous activator we were
able to demonstrate that 4-hydroxytamoxifen manifests partial agonist
activity. Using similar assays, reconstituted in several cell and
promoter backgrounds, we were unable to detect significant
ERß-mediated 4-hydroxytamoxifen agonist activity, suggesting that
this receptor isoform may not possess a functional AF-1 or,
alternatively, that it may have a different type of activation domain
within this region.
To define the mechanism(s) underlying the differential activation
profiles of ER
and ERß, we wanted to determine the relative
contributions of the N-terminus (AF-1) and C-terminus (AF-2) activation
domains to the transcriptional activity of the whole receptors.
Previously, our laboratory has created mutations in ER
that abolish
the activity of AF-1 or AF-2 (11). We have now constructed the
corresponding mutations in ERß (Fig. 2A
), and this has enabled us to assess
the relative contributions of each AF to the transcriptional activities
of ER
and ERß. To compare the activities of our mutants, HepG2
cells and HeLa cells were transiently transfected with wild-type ER
or ERß or the mutant receptor to be tested together with the C3-Luc
reporter. Because of the difficulty in obtaining antibodies that can be
used to measure the relative expression of ER
and ERß, we elected
to perform all of our studies at input plasmid concentrations that
yield the maximal activity in a given assay. Consequently, our studies
do not allow us to compare ER
and ERß on a molecule:molecule
basis, but, rather, permit us to compare these receptors at a
functional level. We have successfully used this approach in the past
to compare the transcriptional activities of a series of ER
mutants
(11). The results of this analysis are shown in Fig. 2
. As expected,
ER
displays a dose-dependent increase in activity in the presence of
17ß-estradiol in both HepG2 and HeLa cells (Fig. 2B
). In addition, as
shown before (37), mutants containing AF-1 or AF-2 alone are also
capable of activating transcription, although their activities are
influenced by both the cell and promoter context in which they were
assayed. In HepG2 cells, for instance, ER
-AF-1 is significantly more
active than ER
-AF-2; thus, in this environment AF-1 appears to be
the dominant activator. In HeLa cells, however, both ER
-AF-1 and
ER
-AF-2 display identical activation profiles, and their combined
activity is significantly less than that of the intact receptor
throughout the entire range of hormone concentrations. Interestingly,
in both cell contexts, ER
-AF-1 and ER
-AF-2 exhibit significantly
lower ligand-independent activity compared with the intact ER
. These
studies confirm our previous findings that both AF-1 and AF-2
contribute to the overall transcriptional activity of ER
, and that
the relative activity of each activation domain is dependent on the
cell context.
|
, the wild-type ERß is a
ligand-dependent transcriptional activator in both cell lines. However,
although ER
-AF-1 can function autonomously in some cell
types, ERß-AF-1 is transcriptionally inactive in both HepG2 and HeLa
cells. Overall, the most surprising finding was that removal of the
amino-terminus (ERß-AF-2) enhances ERß transcriptional activity
rather than decreases it as was seen with ER
. Of additional
importance was the finding that ERß-AF-2 is extremely active in
environments where ER
-AF-2 is essentially transcriptionally
inactive. Therefore, we conclude that the C-terminus (AF-2) mediates
the transcriptional activity of ERß in response to 17ß-estradiol,
and that this domain functions independently of the amino-terminus.
Furthermore, sequences within the N-terminus have a negative impact on
the overall transcriptional activity of ERß, and their removal
creates a mutant whose function is similar, but not identical, to that
of ER
. It is possible that ERß does, in fact, contain a functional
AF-1 domain and that it may be functional in contexts not represented
by our assays. These studies clearly indicate that the activation
domains of ER
and ERß are not identical and that these two
receptors are different transcription factors that likely have distinct
roles in estrogen biology.
The amino-terminus of ER
, but not that of ERß, functions as an
autonomous activating sequence
To determine whether the amino-terminus of ERß does, in fact,
possess an autonomous activation function, we evaluated the
transcriptional activity of the ER
and ERß N-termini when removed
from the context of their intact receptors. Specifically, the N-termini
of ER
and ERß were each fused to the GAL4 transcription factor DBD
(Fig. 3A
), and the activity of each
construct was compared in transient transfection studies in HepG2,
HeLa, MCF-7 (human mammary carcinoma), and SKBR3 (human mammary
adenocarcinoma) cells on a GAL4-responsive reporter (Fig. 3
, BE). The
input concentration of each vector used in these studies was that which
gave a maximal response under the conditions of the assay. In HepG2
cells, the GAL4-DBD-ER
construct possessed more than 18 times the
activity of the GAL4 DBD alone, whereas only a 2.4-fold enhancement by
the ERß construct was observed. In HeLa cells, ER
displayed a
5.5-fold increase in transcriptional activity over the control, whereas
only a 1.4-fold increase was observed for ERß. Similarly, in MCF-7
and SKBR3 cells, ER
displayed 42- and 53-fold increases in
activities, whereas only 3.3- and 6-fold increases were seen for ERß.
These studies illustrate that while the N-terminus of ER
has a
strong activation domain that functions in a cell-specific manner, the
homologous region in ERß is much less active. Therefore, it is likely
that the repressor function is the primary determinant of the activity
of the N-terminus of ERß in the whole receptor, and that the distinct
transcriptional profiles of the two ERs are mediated in part by
differences in their amino-termini.
|
transcriptional activity at subsaturating
concentrations of 17ß-estradiol
and ERß are not functionally
equivalent and that in many contexts ER
is significantly more
transcriptionally active than ERß. Therefore, we considered the
possibility that, similar to the effects mediated by PR-A on PR-B
activity, ERß may act as a transdominant repressor or a modulator of
ER
activity in contexts where ERß is less active. To test this
hypothesis, we examined the effect of ERß expression on the
transcriptional activity of ER
when both receptors were expressed in
target cells. Specifically, the ER
expression vector was transiently
transfected into HepG2 cells, either alone or in the presence of
increasing amounts of the ERß expression vector together with the
3x-ERE-TATA-Luc reporter. The cells were induced with either 100
nM 17ß-estradiol, a saturating concentration at which
both receptors demonstrate maximal transcriptional activity, or 100
pM 17ß-estradiol, a subsaturating concentration at which
only ER
is active. As expected, ER
was a better activator of
transcription than ERß when the assay was performed in the presence
of 100 nM 17ß-estradiol. Interestingly, although ER
manifests significant ligand-dependent activity, the introduction of
increasing amounts of ERß into the system had no effect on ER
transcriptional activity under the conditions of the assay. However, in
the presence of 100 pM 17ß-estradiol, the activity of
ER
was suppressed by the addition of increasing amounts of the ERß
expression vector. At equivalent input vector concentrations, the
estradiol-stimulated activity of the coexpressed receptors was
repressed to 25% of the activity of ER
alone. These data strongly
support the hypothesis that the pharmacology of estrogen(s) will differ
in target cells depending on the relative expression levels of ER
and ERß.
We next compared the activities of ER
, ERß, or both receptors
together over a full range of estradiol concentrations (Fig. 4B
). Based on the observation that ERß
functions as a repressor of ER
transcriptional activity at low
concentrations of hormone, we predicted that the impact of ERß on
ER
would differ at specific hormone concentrations and that the
cellular responsiveness to estradiol would be affected by ERß
expression. Interestingly, we observed that the potency of estradiol in
our ER
-dependent transcription systems was right shifted by 1 log
when ERß was coexpressed in the system, whereas the efficacy was
unaffected. Similar results were also observed when this experiment was
repeated in different cellular contexts (data not shown). From these
studies, we conclude that 1) ERß is a transdominant repressor of
ER
transcriptional activity at subsaturating concentrations of
estradiol; and 2) ERß expression decreases the sensitivity of
ER
-expressing cells to estradiol.
|

and ERß suggested that
the agonist/antagonist activities of mixed agonists such as tamoxifen
may be influenced by the relative expression of the two receptors. To
determine the impact of coexpression of the two receptor subtypes on
tamoxifen pharmacology, the ER
and ERß expression vectors were
transiently transfected into HepG2 cells, either alone or together, and
the cellular response to increasing concentrations of
4-hydroxytamoxifen was measured on the C3-Luc reporter (Fig. 5
alone was expressed in the cell and
showed no agonist activity when ERß alone was expressed. In the
presence of ERß, however, the ability of tamoxifen to activate
ER
-mediated transcription was completely suppressed. We noticed that
the basal transcription in the presence of both receptors was
intermediate between ER
and ERß alone in this assay. Although we
have not pursued this interesting finding further, we do know that all
of the basal activity observed in the presence of ER
is
ER-dependent. Thus, ERß may effectively inhibit tamoxifen-dependent
ER
-mediated transcription, but not that activity mediated through
the same receptor in the absence of ligand. Overall, these results
suggest that the tissue-selective agonist activity of antiestrogens may
be determined by the relative expression of ER
and ERß in a
tissue.
|
and ERß form heterodimers in vivo
transcriptional activity. It has recently been reported
that coexpression of ER
and ERß results in the preferential
formation of receptor heterodimers (instead of homodimers) that are
capable of activating transcription from estrogen-responsive enhancers
(20, 21). Our observation that classical ER
- and ERß-mediated
responses are modified when the two receptors are coexpressed suggests
that these alternative responses could be mediated through receptor
heterodimers that may possess unique transcriptional activities. To
address this issue we examined the interaction between the two
receptors in a mammalian two-hybrid assay. HepG2 cells were transfected
with the pBKC-DBD-ER
-LBD(3x) vector and pVP16-ERß vectors together
with a GAL4-responsive reporter and treated with vehicle or 100
nM 17ß-estradiol (Fig. 6
-LBD(3x) vector
contains three point mutations in the AF-2 domain that abolish
transcriptional activity but have no effect on ER dimerization (11). We
observed that ER
and ERß show a strong hormone-dependent
interaction. Furthermore, our results show that ER
and ERß
heterodimerize in vivo and support the recent findings that
heterodimers are formed when the two subtypes are coexpressed. Although
previous studies have shown that ER
and ERß heterodimerize in the
absence of hormone (20, 21), these studies were carried out in
vitro and may not accurately represent what occurs in the cell
where ER
and ERß do not exist in isolation but, rather, interact
with a variety of proteins. Overall, the results imply that the impact
of each receptor on the others pharmacology may be mediated at least
in part through the formation of heterodimers with properties that may
be different from those of the homodimers.
|
-mediated
transcription at subsaturating levels of hormone. One possible
explanation for this activity is that ERß may bind its cognate
response element in a constitutive manner and thus compete with ER
for access to the DNA target. To test this hypothesis, ER
and ERß
were fused to the VP16 activation domain in order to bypass the need
for ligand to activate the AFs within the two receptors. Thus, when
tethered to DNA, the chimeras will activate transcription regardless of
the nature of the bound ligand. HepG2 cells were transiently
transfected with increasing concentrations of the pVP16-ER
or
pVP16-ERß expression plasmids together with the 3x-ERE-TATA-Luc
reporter in the presence of vehicle or 100 nM
17ß-estradiol. As shown in Fig. 7A
did have the capacity to interact with
DNA in the absence of hormone. However, when VP16-ER
was limiting,
hormone had a pronounced effect on DNA binding. To eliminate the
possibility that the elevated transcriptional responses of VP16-ER
in the presence of agonist were due to synergy between the ER
activation functions and the VP16 activation domain in the presence of
estradiol, we repeated the experiments using VP16-ER
(3x), which
contains three point mutations in the ER
AF-2 domain that disrupt
the ligand-dependent coactivator binding pocket and nullify the
transcriptional activity of the receptor. Under these conditions we
observed that hormone was required for DNA binding, even at high
receptor concentrations (Fig. 7B
, we observed that the ability of VP16-ERß to interact
with DNA was entirely ligand independent, regardless of the level of
expression (Fig. 7C
and ERß and suggest that ERß regulates
ER
-mediated transcriptional activity at the level of DNA-binding
site competition.
|
| Discussion |
|---|
|
|
|---|
and ß) that arise by an
alternate splicing event that results in a truncation of the C-terminus
in the GRß form (22). Analysis of the transcriptional properties of
these two receptors indicated that they both recognize the same
intracellular targets, but GRß is unable to bind agonists (22).
Therefore, although GR
can enhance the transcription of
glucocorticoid-responsive enhancers, GRß is not transcriptionally
active and can act as a dominant negative inhibitor of GR
activity.
The contrasting activities of the GRs suggest that the relative tissue
distributions of the two receptors are a major determinant of the
biological effects of glucocorticoid compounds. The existence of two
forms of the human PR, each with different biological activity, extends
the concept that receptor isoforms are an important part of steroid
hormone receptor pharmacology. The two PRs are identical in sequence,
with the exception that hPR-B has an additional 164 amino acids within
its N-terminus originating from an alternate translation initiation
event. These isoforms have been shown to bind the same ligands and
regulate transcription of the same genes. However, in most cell types
PR-B is a transcriptional activator, whereas PR-A acts as a
transdominant repressor of PR-B. Interestingly, in the presence of an
activating ligand, human PR-A can inhibit the transcriptional
activities of ER, GR, androgen receptor, and mineralocorticoid receptor
(15).
Our studies suggest that the human ER
and ERß provide yet another
example of two nuclear receptor subtypes that demonstrate distinct
transcriptional activities. As is seen with human PRs, the differential
activities of the two ERs arise from functional variations in the
receptor N-termini. ER
contains a constitutive AF-1 in the
N-terminus that functions in a cell- and promoter-specific manner to
enhance the overall transcriptional response of the receptor. However,
the corresponding region of ERß lacks significant transcriptional
activity and contains a repressor domain that decreases the overall
transcriptional activity of the receptor. This inhibitory region
functions only in the context of the intact receptor, as has been shown
for the inhibitory N-terminus of PR-A (15) and for the repressor
domains of the transcription factor c-Fos (23). Our studies do not
eliminate the possibility that ERß does, in fact, have an AF-1, but
suggest that its function is masked by the presence of an
amino-terminal repressor domain. This hypothesis is supported by the
fact that the N-terminus of ERß showed low levels of autonomous
transcriptional activity when fused to the heterologous GAL4-DBD.
Furthermore, recent studies have shown that ERß transcriptional
activity can be stimulated by the mitogen-activated protein kinase
pathway (23A ), and that this activity appears to require an
intact ERß amino-terminus. Mutational analysis will be required to
determine whether ERß contains separate activation and repression
domains within its amino-terminus.
An additionally important distinction between ER
and ERß resulted
from our finding that ER
-AF-1 and AF-2 act synergistically under
most circumstances, whereas the AF-2 of ERß functions as an
independent activation domain. It is likely, therefore, that ER
and
ERß will display differences in their preferences for coactivators
and corepressors in target cells. In recent years, several
transcriptional coactivator proteins have been identified that interact
with the hormone-binding domain of nuclear receptors and are thought to
mediate the activity of AF-2. Specifically, the coactivators steroid
receptor coactivator-1 (SRC-D), amplified in breast cancer (AIB1),
transcriptional intermediary factor-2 (TIF-2), and glucocorticoid
receptor interacting protein (GRIP-1) (murine
homolog of TIF-2) and the cointegrator CBP/p300 have been shown
to potentiate the activity of ER
and other nuclear receptors
(24, 25, 26, 27). The C-termini of both ER
and ERß have been shown to bind
the coactivators SRC-1 and GRIP-1 in an agonist-dependent manner (28, 29) (our unpublished results). Therefore, it is possible that although
the cofactors that mediate transcriptional activity of the two ERs are
the same, these proteins may interact with distinct regions of each
receptor or differentially recruit other cellular factors when bound to
one receptor vs. the other. Although sequence comparisons
suggest that the N-terminus may be the primary discriminator by which
coactivators can interact with the receptors, the fact that AF-2 of
ER
and ERß are also functionally different suggests that the
process is much more complex. It is not clear at this time whether AF-1
and/or AF-2 interact with distinct coactivators or if these domains
have independent contact sites on the same coactivator. Regardless, it
is clear that in the context of ER
, AF-1 is required for maximal
agonist-induced transcriptional activity, as mutations in this domain
have been shown to abolish tamoxifen partial agonist activity and
dampen the response to estrogen (30). The absence of an efficient AF-1
in ERß clearly influences the manner in which coactivators interface
with this receptor and ultimately its ligand responsiveness. Our data
are also compatible with the concept that the N-terminus of ERß binds
a protein that has an autonomous inhibitory activity or one that
inhibits transcriptional activity by blocking the binding of
coactivators to AF-1 and AF-2. If this is the case, then it is
possible that in tissues in which the putative repressor protein is
absent, antiestrogens could manifest partial agonist activity, and
agonists would be more potent receptor activators.
Roles of ER
and ERß in determining cellular sensitivity
to estrogen
One of the most important findings of this study is that the
relative levels of ER
and ERß are an important determinant of
cellular sensitivity to estrogens. Although ER
is the stronger
transcriptional activator of the two ER isoforms, at physiological
concentrations of estradiol, coexpression of ERß results in
suppression of both the efficacy and the potency of hormone-stimulated
responses. This suggests that it will be important to determine the
extent to which the two receptors colocalize in order to more
accurately predict the biological responses to ER agonists in specific
target tissues. The ability of ERß to function as a transcriptional
inhibitor or activator, depending on the agonist concentration,
suggests that completely different patterns of gene expression may be
observed at different hormone levels. In addition, the ability of ERß
to switch from a transcriptional repressor to an activator as estradiol
levels rise may provide cells expressing both isoforms with a mechanism
to control cellular sensitivity to hormones. Such a process could
explain why during the early part of the menstrual cycle, low plasma
concentrations of estradiol exhibit an inhibitory effect on
gonadotropin secretion, whereas when levels of hormone are elevated
during the late follicular phase, the pituitary release of LH and GnRH
secretion from the hypothalamus is enhanced. In light of the recent
localization of ERß to rat hypothalamic neurons projecting to the
pituitary (31, 32), it is possible that the balance between ER
and
ERß activities in these tissues may mediate the differential
sensitivities to estrogens throughout the menstrual cycle. The role of
ERß in the regulation of cellular responsiveness to agonists may
merit consideration in dosing regimens of estrogen-like pharmaceutical
compounds, as it is likely that fluctuations in the bioavailability of
receptor activating ligands may have a greater impact in tissues where
ER
and ERß colocalize. This may be particularly important in
ER-positive breast tumors, where it has been shown that ERß, in
addition to ER
, may be expressed (33).
Our studies also suggest that the relative levels of ER
and ERß
are an important determinant of the pharmacology of antiestrogens. The
observation that tamoxifen is a more potent competitive antagonist of
ERß (8) and does not display agonist activity on the receptor raises
the possibility that there will be a better response to tamoxifen in
ERß-positive tumors. In view of our finding that ERß suppresses the
partial agonist activity of tamoxifen on ER
, it will be interesting
to determine whether tumors expressing both subtypes show a better
response to tamoxifen as well. It will also be important to determine
whether ERß is down-regulated in tamoxifen-resistant tumors as an
adaptive mechanism for growth.
A working model to explain the cross-talk between ER
and
ERß
We have developed a working model to explain how ERß can
regulate ER
transcriptional activity in cells where the receptors
are coexpressed. This model is based on two fundamental observations:
1) ERß binds to target gene promoters in a ligand-independent manner;
and 2) ERß can form heterodimers with ER
within cells. Thus, in
the presence of low subsaturating concentrations of hormone, inactive
ERß binds to its target response element and competitively blocks
ER
binding. As hormone levels rise, the amount of activated ER
and ERß also rises, sufficient activated receptor is formed to
compete with the unliganded, inactive ERß, and transcription can
proceed. A purely competitive interaction would predict that as ERß
levels rise, agonist efficacy would decrease to a level approaching
that observed when ERß alone is expressed in cells. However, the
observation that under conditions of hormone excess, overexpression of
ERß does not decrease the efficacy of estradiol suggests that the
interaction of ER
and ERß is more complex. We believe that under
hormone-saturating conditions, ER
and ERß can form heterodimers
and that the transcriptional activity of the heterodimer is
indistinguishable from that of the ER
homodimer. Although difficult
to address experimentally, it is possible that of the three potential
ER complexes, the ERß homodimer has the highest affinity for
corepressors and/or the lowest affinity for coactivators, and
consequently, it is the least transcriptionally active. However, in the
context of a heterodimer, the presence of ER
assists ERß in
recruiting cofactors such as SRC-1 and GRIP-1. Thus, the resultant
complex of ER
/ERß and their associated coactivators is
indistinguishable from that formed by an ER
homodimer. If this
latter model is found to be true, then we would predict that the major
role of ERß is to modulate ER
transcriptional activity at low
hormone levels.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Supported by a Predoctoral Fellowship from the U.S. Army Medical
Research Acquisition Activity. ![]()
Received April 5, 1999.
| References |
|---|
|
|
|---|
and ß. Endocrinology 138:863870
(ER
) and estrogen receptor-ß (ERß) messenger
ribonucleic acid in the wild-type and ER-
knockout mouse.
Endocrinology 138:46134621
and ß form heterodimers on DNA. J Biol
Chem 272:1985819862
. Mol Endocrinol 11:14861496This article has been cited by other articles:
![]() |
K. L. Gonzales, M. J. Tetel, and C. K. Wagner Estrogen Receptor (ER) {beta} Modulates ER{alpha} Responses to Estrogens in the Developing Rat Ventromedial Nucleus of the Hypothalamus Endocrinology, September 1, 2008; 149(9): 4615 - 4621. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Di, L. Yu, A.B. Moore, L. Castro, X. Zheng, T. Hermon, and D. Dixon A low concentration of genistein induces estrogen receptor-alpha and insulin-like growth factor-I receptor interactions and proliferatio |