help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Endocrinology Vol. 140, No. 1 292-300
Copyright © 1999 by The Endocrine Society

ARTICLES

Induction of Uncoupling Protein Expression in Brown and White Adipose Tissue by Leptin1

Scott P. Commins, Patricia M. Watson, Mark A. Padgett, Andrew Dudley, George Argyropoulos and Thomas W. Gettys

Departments of Medicine (P.M.W., M.A.P., A.D., G.A., T.W.G.) and Biochemistry and Molecular Biology (S.P.C., T.W.G.), Division of Gastroenterology and Hepatology, Medical University of South Carolina, Charleston, South Carolina 29425

Address all correspondence and requests for reprints to: Dr. Thomas W. Gettys, 916G Clinical Science Building, Medical University of South Carolina, 171 Ashley Avenue, Charleston, South Carolina 29425. E-mail: gettystw{at}musc.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Deposition of excess body fat occurs when energy intake chronically exceeds energy expenditure. In ob/ob mice, the absence of leptin affects both components of the energy balance equation, and the mice become morbidly obese after weaning. Treatment of ob/ob mice with exogenous leptin reduces body weight by decreasing food intake and stimulating energy utilization, but even when saline- and leptin-injected ob/ob mice are pair-fed, mice receiving leptin lose significantly more weight. Therefore, the purpose of the present study was to test the hypotheses that uncoupling protein-1 (UCP1) expression is reduced in adipose tissue from ob/ob mice and is restored by treatment with exogenous leptin. Lean and ob/ob mice (5–6 weeks old) were housed at 23 C and treated with leptin (20 µg/g BW·day) for 3 days before they were killed. Compared with levels in lean littermates, UCP1 messenger RNA (mRNA) and protein levels were lower in brown adipose tissue (BAT) and retroperitoneal white adipose tissue (WAT) from ob/ob mice. Treatment of ob/ob mice with leptin reduced body weight and produced a 4- to 5-fold increase in UCP1 mRNA levels in both interscapular BAT and retroperitoneal WAT. The increases in UCP1 mRNA were accompanied by comparable increases in UCP1 protein in mitochondrial preparations from each tissue. Given that the sole known function of UCP1 is to uncouple oxidative phosphorylation, the present results are consistent with the conclusion that leptin stimulates energy utilization in ob/ob mice by increasing thermogenic activity and capacity (UCP1). In addition, the present results suggest that decreased UCP1 expression in BAT and WAT of ob/ob mice is in part responsible for their increased metabolic efficiency and propensity to become obese.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IN MICE, inheritance of the ob gene from both parents produces offspring (ob/ob) that develop hyperphagia and become morbidly obese after weaning. Hypertrophy of white adipose tissue (WAT) occurs well before the onset of hyperphagia (1, 2) and occurs in ob/ob mice even when they are pair-fed with lean littermates (3). Thus, their obesity is not merely the product of elevated energy intake, but includes a substantial component of energy conservation. The translated product of the ob gene, called leptin (4), is not expressed in ob/ob mice, and its absence is responsible for the characteristic obese/diabetic syndrome that develops in these mice. Treatment of ob/ob mice with exogenous leptin corrects their obesity, and part of the weight loss can be accounted for by reductions in food intake (5, 6, 7). However, when differences in food intake between saline- and leptin-injected ob/ob mice are controlled, leptin-injected mice still lose more weight (6). These results illustrate that an important component of leptin’s effect is increased energy expenditure (6), but the mechanism for this effect has not been clearly defined.

Recent evidence that leptin increases core temperature (7), stimulates sympathetic nerve activity (8), and increases norepinephrine turnover in brown adipose tissue (BAT) (9) is consistent with the idea that leptin increases thermogenic activity in adipose tissue. The ability of BAT to conduct thermogenesis is conferred by the presence of uncoupling protein-1 (UCP1) on the inner mitochondrial membrane, where it serves to short circuit the proton gradient that normally drives ATP synthesis (10, 11, 12). The release of norepinephrine from sympathetic nerves acutely activates UCP1 through a ß3-adrenergic receptor (ß3-AR)- and cAMP-dependent mechanism and simultaneously increases the thermogenic capacity of BAT through transcriptional activation of the UCP1 gene (13, 14). The consensus has been that UCP1 is expressed solely in BAT until several recent reports demonstrated inducible ectopic expression of UCP1 in WAT (15, 16). In addition, two novel uncoupling proteins (UCP2 and UCP3) were recently cloned in the mouse (17, 18, 19, 20). Both UCP2 and UCP3 are highly homologous to UCP1 and are thought to be involved in thermogenesis. Coupled with the observation that exogenous leptin selectively reduces WAT (5, 6, 7), the recent finding that central (intracerbroventricular) or peripheral administration of leptin selectively increases fat oxidation (21, 22) raises the interesting possibility that leptin reduces WAT mass by increasing UCP1 expression and/or function. Using 5- to 6-week-old lean and ob/ob mice, it is shown that leptin treatment produced robust increases and corrected the deficit in both UCP1 messenger RNA (mRNA) and protein expression in isolated BAT and retroperitoneal WAT from ob/ob mice. It is further shown that UCP2 mRNA levels did not differ between lean and ob/ob mice, and leptin had little or no effect on UCP2 mRNA in the WAT depot sites surveyed.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
N-Tris(hydroxlymethyl)methyl-2-aminoethanesulfonic acid buffer, mercaptoethanol, EDTA, sodium cholate, Triton X-100, BSA, guanidinium thiocyanate, sucrose, and other common chemicals were obtained from Sigma Chemical Co. (St. Louis, MO). T1 ribonuclease and Trizol LS Reagent were obtained from Life Technologies (Gaithersburg, MD). T7 RNA polymerase, SP6 RNA polymerase, Taq polymerase, Moloney murine leukemia virus reverse transcriptase, and the pGEM-3Z cloning vector were obtained from Promega Corp. (Madison, WI). The T7-Megashortscript kit was purchased from Ambion, Inc. (Austin, TX). Oligonucleotide primers were prepared by the DNA Core Facility at the Medical University of South Carolina (Charleston, SC). Na[125I] and [{alpha}-32P]CTP were purchased from DuPont-New England Nuclear Radiochemicals (Boston, MA). Immobilon-P polyvinylidene difluoride membranes were obtained from Millipore Corp. (Bedford, MA). Recombinant methionyl mouse leptin was provided by Amgen, Inc. (Thousand Oaks, CA).

Experimental animal protocol
Male lean (+/?) and obese (ob/ob) C57BL/6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME) at 5–6 weeks of age and randomly assigned to one of two treatment groups. The mice were housed in solid bottom cages with bedding (three mice per cage) and equilibrated at 23 C on a 12-h light, 12-h dark cycle for 5 days before beginning the experiment. On the morning of the sixth day and for 2 mornings thereafter, the mice in each group received ip injections of either saline or recombinant mouse leptin (20 µg/g BW·day) 1 h after the beginning of the light cycle. Three hours after their final injection on day 8, the mice were killed, and tissues were harvested. Interscapular BAT as well as epididymal and retroperitoneal WAT were removed from each animal and carefully dissected free of vessels and connective tissue. The ipsilateral fat pad from each site was used to prepare total RNA, whereas the contralateral fat pad from each site was used for isolation of mitochondria. Mice were weighed at the start of the study and each day thereafter for the duration of the experiment, and received Purina mouse chow (Ralston Purina Co., St. Louis, MO) and water ad libitum.

Preparation of total RNA from adipose tissue depots
After dissection, the interscapular, epididymal, and retroperitoneal fat pads were homogenized with Trizol LS reagent using an Ultraturax (Tekmar, Cincinnati, OH) according to the manufacturer’s specifications. Total RNA was isolated and purified as previously described (23).

Ribonuclease protection assay of UCP1 and UCP2
RNA probes complementary to mRNA were produced by RT-PCR, using total RNA from interscapular BAT for UCP1 (5' to 3'; forward, caatctgggcttaacgggt; reverse, tgaaactccggctgagaag) and epididymal WAT for UCP2 (5' to 3'; forward, cagttctacaccaagggct; reverse, aggtcaccagctcagcacagt). The PCR product amplified with the UCP2 primers was shortened to 143 bp using a SmaI digest that cut the fragment at a site corresponding to bp 741. The respective fragments were purified and cloned into the pGEM-3Z riboprobe vector containing transcriptional start sites 5' and 3' to the multiple cloning site (Promega Corp.). The identities of the cloned fragments were confirmed by sequencing, and the probes corresponded to nucleotides 7–300 for UCP1 and nucleotides 741–884 for UCP2. The respective probes were labeled by T7 RNA polymerase in the presence of [32P]CTP and used in our modification (23) of the ribonuclease protection assay described by Granneman et al. (24). The protected fragments were quantitated by comparison to known amounts of sense strand RNA produced by SP6 transcription of the linearized plasmids. The sense strand standards and protected fragments were visualized by autoradiography after fractionation on 6% polyacrylamide-8 M urea gels. A riboprobe complementary to the 18S ribosomal RNA (rRNA; nucleotides 715–794) was included in the hybridization to correct for differences in the amount of total RNA loaded on the gel.

Mitochondrial preparation
After dissection, the contralateral fat pad from each depot site was minced in ice-cold sucrose buffer (0.25 M sucrose and 5.0 mM N-Tris(hydroxlymethyl)methyl-2-aminoethanesulfonic acid buffer, pH 7.2), diluted to 5% (wt/vol) in the sucrose buffer, and homogenized with a glass Dounce homogenizer (Kontes Co., Vineland, NJ). The homogenate was centrifuged at 22,500 x g for 20 min, and the pellet was resuspended in cold sucrose buffer. After a low speed spin at 850 x g for 10 min, the supernatant containing the mitochondria was decanted to a fresh tube and spun for 20 min at 48,000 x g. The pelleted mitochondria were resuspended in 2 ml solubilization buffer containing 20 mM Tris (pH 8.0), 1 mM EDTA, 100 mM NaCl, and 0.9% sodium cholate; incubated on ice for 30 min; and respun at 48,000 x g for 30 min. The pellet was resuspended in solubilization buffer containing 1% Triton X-100 and incubated on ice for 30 min. The suspension was respun at 48,000 x g, and the supernatant was retained for protein assay and Western blotting of UCP1.

Western blotting of UCP1
The protein concentration in the mitochondrial extracts was determined using the Bio-Rad Laboratories, Inc., detergent-compatible protein assay (Hercules, CA), and the UCP1 concentration in the extracts was determined by Western blotting using an affinity-purified antibody raised against the peptide sequence corresponding to amino acids 145–159 in mouse UCP1 (25). The mitochondrial extracts from BAT (2.5 µg/lane) and WAT (20 µg/lane) were resolved by SDS-PAGE (12.5% acrylamide and 0.51% N,N'-diallyltartardiamide), transferred to polyvinylidene difluoride membranes, and probed with UCP1 IgG. Detected protein was visualized using 125I-labeled goat antirabbit IgG and was quantitated by scanning laser densitometry (Molecular Dynamics, Inc., Sunnyvale, CA).

Methods of analysis
The estimated concentrations of UCP1 and UCP2 mRNA were obtained by reverse calibration from standard curves as described inMaterials and Methods, and group means were compared between treatments by one-way ANOVA. The level of protection against type I errors was set at 5%, and the P values for specific treatment comparisons of interest are presented in Results.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effects of leptin on body and tissue weights
The body weights of the two treatment groups within each phenotype were similar at the beginning of the study, but the ob/ob mice were nearly 2-fold heavier than their lean littermates (Table 1Go). Leptin had no effect on the body weight of lean mice and failed to effect significant decreases in the size of either WAT depot (Table 1Go). However, leptin caused a small, but significant, decrease (P < 0.01) in the weight of the interscapular brown fat pads of lean mice (Table 1Go). In contrast to the lean mice, leptin effected a significant decrease in body weight (P < 0.05) and the weight of epididymal WAT (P < 0.05) of ob/ob mice (Table 1Go). Retroperitoneal WAT was unaffected by leptin treatment, but the large SEs attached to mean estimates of fat pad weights from this depot site made detection of such differences difficult. Leptin was also without affect on the weight of BAT in ob/ob mice (Table 1Go). Overall, leptin produced the expected effects on body weight and carcass fat, and it seems most likely that the relatively modest effects were a reflection of the short duration of treatment.


View this table:
[in this window]
[in a new window]
  		Table 1. Changes in body and fat pad weights in lean and ob/ob mice treated with leptin

 
Effect of leptin treatment on BAT UCP1
Preparation of riboprobes for use in the ribonuclease protection assay (RPA) involves transcription of linearized plasmids in the presence of [32P]CTP to produce labeled RNA that is complementary to the mRNA to be detected. We used a cloning vector containing transcriptional start sites on either side of the multiple cloning site so that the same vector could be used to generate both labeled antisense riboprobes and sense strand standards. Initial experiments were undertaken to establish the amounts of sense strand RNA necessary to construct standard curves that could be used to estimate the concentration of UCP1 mRNA in unknown samples. These experiments established that a range of 0–800 pg of UCP1 sense strand enabled construction of standard curves that spanned the range of UCP1 mRNA observed in 1 µg interscapular BAT and 10 µg retroperitoneal WAT total RNA (Fig. 1AGo). In addition, the conduct of RPAs with total RNA from BAT and WAT using our UCP1 probe yielded a single protected fragment of the predicted size.



View larger version (49K):
[in this window]
[in a new window]
  		Figure 1. RPA of UCP1 mRNA and 18S rRNA in 1 µg total RNA from 7-week-old lean mice injected with vehicle or leptin (20 µg/g BW·day) for 3 days as described in Materials and Methods. The relative abundance of UCP1 mRNA was quantitated by comparing the densitometric intensities of protected fragments from each treatment group to known amounts of sense strand transcripts that were hybridized simultaneously, as shown in A. The UCP1 probe produces a 289-bp protected fragment corresponding to nucleotides 7–300 of the mouse UCP1 mRNA, and a probe for 18S rRNA is included to adjust for differences in RNA loaded between the lanes (B). Individual RNA samples from each animal were analyzed to calculate group means [lean, 1.9 ± 0.8 fmol UCP1 mRNA/µg RNA (n = 10); lean plus leptin, 3.5 ± 1.1 fmol UCP1 mRNA/µg RNA (n = 5)]. The autoradiogram was produced by pooling equal amounts of RNA from each animal in each treatment group.

 
We next examined the effect of 3 days of leptin treatment on UCP1 mRNA in adipose tissue from lean mice that had been equilibrated at 23 C. Interscapular BAT of vehicle-injected mice contained substantial amounts of UCP1 mRNA (1.9 ± 0.8 fmol mRNA/µg RNA), and leptin produced a modest, but significant (P < 0.05), increase in UCP1 mRNA to 3.5 ± 1.1 fmol mRNA/µg RNA (Fig. 1BGo). By way of contrast, exposure of lean mice (+/?) to 4 C for the same period of time produced a 4- to 5-fold increase in UCP1 mRNA in BAT (data not shown). In additional experiments, we found that shorter periods of leptin treatment (1–2 days) produced increases in BAT UCP1 mRNA levels similar to those observed in the present experiments (data not shown). Based on our unpublished data and the present studies, we conclude that leptin produces a rapid induction of UCP1 mRNA in BAT.

Effect of leptin on UCP1 in BAT of ob/ob mice
UCP1 mRNA levels were next compared in lean, ob/ob, and leptin-treated ob/ob mice. The rationale for these experiments comes from the observation that metabolic efficiency is higher and core temperature is lower in ob/ob mice compared with those in lean littermates, and the expectation that differences in BAT UCP1 expression are the basis of this difference. These experiments were also motivated by the observation that exogenous leptin corrects these defects. As predicted (Fig. 2AGo), BAT UCP1 mRNA levels were significantly lower (P < 0.01) in ob/ob mice (0.3 ± 0.06 fmol mRNA/µg RNA) than those in their lean littermates (1.7 ± 0.6 fmol mRNA/µg RNA). Compared with that in vehicle-treated controls, treatment of ob/ob mice with leptin for 3 days produced a significant increase (P < 0.01) in BAT UCP1 mRNA (1.4 ± 0.4 fmol mRNA/µg RNA) to levels comparable to those in lean mice (Fig. 2AGo). Conducting similar experiments at higher ambient temperatures (27–35 C) had little effect on UCP1 mRNA levels in control ob/ob mice, but significantly blunted the response of ob/ob mice to leptin (data not shown). In addition, the higher temperatures lowered UCP1 mRNA expression in lean mice to levels similar to those in ob/ob mice (not shown). Overall, these data demonstrate that phenotypic differences between lean and ob/ob mice are in part dependent on ambient temperature. Moreover, ambient temperature influenced the ability of ob/ob mice to respond to exogenous leptin.



View larger version (57K):
[in this window]
[in a new window]
  		Figure 2. A, RPA of UCP1 mRNA in BAT RNA extracted from lean and ob/ob mice injected with vehicle and ob/ob mice injected with leptin (20 µg/g BW·day) for 3 days as described in Materials and Methods. The UCP1 probe produces a 289-bp protected fragment corresponding to nucleotides 7–300 of the mouse UCP1 mRNA, and a probe for 18S rRNA was included to adjust for differences in RNA loaded between the lanes. UCP1 mRNA was quantitated by comparing the densitometric intensity of the protected fragment to the intensities of sense strand transcripts that were hybridized simultaneously. Individual RNA samples (1 µg) from each animal were analyzed to calculate group means [lean, 1.7 ± 0.6 fmol UCP1 mRNA/µg RNA (n = 4); ob/ob, 0.3 ± 0.06 fmol UCP1 mRNA/µg RNA (n = 4); ob/ob plus leptin, 1.4 ± 0.4 fmol UCP1 mRNA/µg RNA (n = 4)]. The autoradiogram was produced by pooling equal amounts of RNA from each animal in each treatment group. B, Western blot of UCP1 expression in mitochondrial extracts from the brown fat pads that were contralateral to the fat pads used to measure UCP1 mRNA in A. Mitochondrial extracts were prepared from each fat pad from lean and ob/ob mice injected with vehicle and ob/ob mice injected with leptin (20 µg/g BW·day) for 4 days as described in Materials and Methods. For each treatment group, duplicate aliquots of mitochondrial protein (2.5 µg solubilized protein) were subjected to Western blotting using an affinity-purified UCP1 antibody raised against a peptide corresponding to amino acids 145–159 of mouse UCP1. The detected proteins were visualized with 125I-labeled goat antirabbit IgG, and the autoradiograms were scanned by laser densitometry. The autoradiogram is representative of three experiments.

 
Additional experiments were undertaken to determine whether expression of UCP1 protein in BAT paralleled the observed differences in UCP1 mRNA associated with phenotype and leptin treatment. To conduct these experiments, we prepared a peptide-directed antibody against amino acids 145–159 of UCP1 so that we might measure UCP1 expression in the absence of concerns that UCP2 and UCP3 would also be detected. This sequence is highly divergent between the UCP isoforms, sharing only 3–4 amino acids of 15 at similar positions within the peptide. In addition, the IgG was affinity purified, and its specificity was established in preliminary experiments using blocking peptide and UCP1, UCP2, and UCP3 fusion proteins.

Mitochondrial extracts from the brown fat pads that were contralateral to the fat pads used to measure UCP1 mRNA levels were used to measure UCP1 protein expression by Western blot. Figure 2BGo illustrates that in control ob/ob mice, BAT UCP1 levels were 20 ± 6% of the levels expressed in lean mice (P < 0.01). This corresponds to a 4- to 5-fold reduction in UCP1 protein and corresponds to the 4.9-fold reduction in mRNA levels that was observed between lean and ob/ob mice (Fig. 2AGo). As predicted, treatment of ob/ob mice with leptin produced a 4-fold increase in BAT UCP1 expression (P < 0.01; Fig. 2BGo), and this increase is comparable to the leptin-mediated increase in message levels between these groups (Fig. 2AGo). Considered together, these data demonstrate that UCP1 mRNA and protein levels are lower in BAT of ob/ob mice compared with those in their lean littermates, and that leptin treatment of ob/ob mice restores UCP1 mRNA and protein expression in these animals.

Effect of leptin on UCP1 in retroperitoneal WAT of ob/ob mice
The rationale for this set of experiments comes from observations that UCP1 expression can be induced in WAT depots under conditions that increase or mimic increased sympathetic nervous system activity. Given that leptin treatment of ob/ob mice produces a specific decrease in WAT mass and a selective increase in fat oxidation, we tested the hypothesis that leptin increases UCP1 mRNA and protein expression in WAT depots as a mechanism to increase local fatty acid oxidation at these sites. Because of the increased propensity to deposit triglyceride in these sites, a second aim was to determine whether UCP1 mRNA was lower in ob/ob compared with lean mice. We chose to examine the retroperitoneal WAT depot, and Fig. 3Go illustrates that lean mice have readily detectable levels of UCP1 mRNA (0.390 ± 0.010 fmol mRNA/µg RNA) that are approximately 3- to 4-fold higher than levels measured in ob/ob mice (0.103 ± 0.011 fmol mRNA/µg RNA). However, treatment of ob/ob mice for 3 days with leptin produced a 5- to 6-fold increase in UCP1 mRNA to 0.560 ± 0.011 fmol mRNA/µg RNA in the retroperitoneal WAT depot (Fig. 3Go). Mitochondrial extracts from the latter two groups were probed with UCP1 antibody, and Fig. 4Go illustrates that leptin produced a 10- to 15-fold increase in UCP1 expression in the ob/ob group. Although the data are not shown, UCP1 levels in mitochondrial extracts from retroperitoneal WAT of lean mice were similar to those observed in the leptin-treated ob/ob group.



View larger version (104K):
[in this window]
[in a new window]
  		Figure 3. RPA of UCP1 mRNA in retroperitoneal WAT RNA extracted from lean and ob/ob mice injected with vehicle and ob/ob mice injected with leptin (20 µg/g BW·day) for 3 days as described in Materials and Methods. The UCP1 probe produces a 289-bp protected fragment corresponding to nucleotides 7–300 of the mouse UCP1 mRNA, and a probe for 18S rRNA was included to adjust for differences in RNA loaded between the lanes. UCP1 mRNA was quantitated by comparing the densitometric intensity of the protected fragment to the intensities of sense strand transcripts that were hybridized simultaneously. Pooled RNA samples (10 µg) from pairs of lean animals and individual samples from each ob/ob animal were analyzed to calculate group means [lean, 0.39 ± 0.10 fmol UCP1 mRNA/µg RNA (n = 5); ob/ob, 0.10 ± 0.01 fmol UCP1 mRNA/µg RNA (n = 4); ob/ob plus leptin, 0.56 ± 0.11 fmol UCP1 mRNA/µg RNA (n = 4)]. The autoradiogram was produced by pooling equal amounts of RNA from each animal in each treatment group.

 


View larger version (58K):
[in this window]
[in a new window]
  		Figure 4. Western blot of UCP1 expression in mitochondrial extracts from the retroperitoneal white fat pads that were contralateral to the fat pads used to measure UCP1 mRNA in Fig. 3Go. Mitochondrial extracts were prepared from each fat pad from ob/ob mice injected with vehicle and ob/ob mice injected with leptin (20 µg/g BW·day) for 3 days as described in Materials and Methods. For each treatment group, duplicate aliquots of mitochondrial protein (20 µg solubilized protein) were subjected to Western blotting using an affinity-purified UCP1 antibody raised against a peptide corresponding to amino acids 145–159 of mouse UCP1. The detected proteins were visualized with 125I-labeled goat antirabbit IgG, and the autoradiograms were scanned by laser densitometry. The autoradiogram is representative of two experiments.

 
We also attempted to compare UCP1 mRNA and protein in epididymal WAT from our treatment groups, but never found detectable levels of either UCP1 message or protein in samples from any of the groups (data not shown). The detection limit for our UCP1 RPA is on the order of 0.05 fmol UCP1 mRNA (see Fig. 1AGo). Thus, although we cannot rule out low level expression of UCP1 mRNA in epididymal WAT, we can conclude that under our experimental conditions, message levels were at least 10- to 20-fold lower than levels observed in RNA from the retroperitoneal depot.

Effect of leptin on UCP2 in retroperitoneal and epididymal WAT of ob/ob mice
The role of leptin in regulating expression of UCP2 has not been clearly defined. Therefore, we used lean and ob/ob mice from the present study to evaluate the effect of leptin’s absence and its replacement on UCP2 mRNA levels in retroperitoneal and epididymal WAT. In retroperitoneal WAT, UCP2 mRNA levels were similar in lean (0.022 ± 0.008 fmol/µg RNA) and ob/ob (0.026 ± 0.004 fmol/µg RNA) mice. As shown in Fig. 5AGo, leptin had no effect on UCP2 mRNA in either group (lean plus leptin, 0.036 ± 0.013 fmol/µg RNA; ob/ob plus leptin, 0.043 ± 0.011 fmol/µg RNA). A similar pattern was observed in epididymal WAT (Fig. 5BGo), where UCP2 mRNA levels were comparable between lean (0.073 ± 0.005 fmol/µg RNA) and ob/ob (0.086 ± 0.005 fmol/µg RNA) mice. However, in contrast to the retroperitoneal depot, leptin produced a small, but significant (P < 0.05), increase in epididymal WAT UCP2 mRNA levels in both lean (0.098 ± 0.005 fmol/µg RNA) and ob/ob (0.121 ± 0.011 fmol/µg RNA) mice. This apparent difference in response between the depot sites probably reflects the greater relative precision of the UCP2 mRNA estimates in the epididymal WAT depot. It should also be noted that UCP2 mRNA levels were uniformly higher in the epididymal compared with the retroperitoneal WAT depot. This contrasts with UCP1 in these two sites, where the rank order of expression was reversed. This relationship also applies to BAT, where the expression of UCP1 is very high, whereas UCP2 mRNA is well below the levels observed in retroperitoneal WAT (data not shown). Collectively, these experiments illustrate that UCP2 and UCP1 are regulated differently among adipose tissue depots, and the presence or absence of leptin has far greater impact on UCP1 expression.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. Ribonuclease protection assay of UCP2 mRNA and 18S rRNA in total RNA isolated from retroperitoneal WAT (A) and epididymal WAT (B) of lean and ob/ob mice injected with either vehicle or leptin (20 µg/day·g BW) as described in Materials and Methods. The UCP2 probe produces a 143-bp protected fragment corresponding to nucleotides 741–884 of the mouse UCP2 mRNA, and an 18S rRNA probe was included to adjust for differences in RNA loading between the lanes. UCP2 mRNA was quantitated by comparing the densitometric intensity of the protected fragment to the intensities of sense strand transcripts that were hybridized simultaneously. RNA samples (10 µg) from each animal were analyzed to calculate group means of UCP2 levels in retroperitoneal WAT [lean, 0.022 ± 0.008 fmol UCP1 mRNA/µg RNA (n = 10); lean plus leptin, 0.036 ± 0.013 fmol UCP1 mRNA/µg RNA (n = 5); ob/ob, 0.026 ± 0.004 fmol UCP1 mRNA/µg RNA (n = 4); ob/ob plus leptin, 0.043 ± 0.011 fmol UCP1 mRNA/µg RNA (n = 4)] and epididymal WAT [lean, 0.073 ± 0.005 fmol UCP1 mRNA/µg RNA (n = 10); lean plus leptin, 0.098 ± 0.005 fmol UCP1 mRNA/µg RNA (n = 5); ob/ob, 0.086 ± 0.005 fmol UCP1 mRNA/µg RNA (n = 4); ob/ob plus leptin, 0.121 ± 0.011 fmol UCP1 mRNA/µg RNA (n = 4)]. The respective autoradiograms for A and B were produced by pooling equal amounts of RNA from each animal in each treatment group.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The recent cloning of the ob gene identified leptin as the "lipostat" that regulates the balance between energy intake and utilization to maintain body weight equilibrium (4). Adipocytes of ob/ob mice do not produce leptin (4), and its absence produces a complex metabolic syndrome characterized by hyperphagia, morbid obesity, and diabetes (14, 26, 27). Hypertrophy of adipose tissue is noted before hyperphagia in ob/ob mice (1, 2), and obesity develops even when ob/ob mice are pair-fed with lean littermates (3). Thus, their thriftiness is a significant component of their propensity to become obese. This conclusion is supported by observations of compromised thermogenic responsiveness and lower core temperature in ob/ob mice (14). The consensus is that low sympathetic nervous system activity in BAT of ob/ob mice reduces the trophic influence of norepinephrine on UCP1 expression and produces a concomitant reduction in thermogenic responsiveness and capacity (14, 26). Published data comparing UCP1 expression between lean and ob/ob mice have yielded mixed results on this point (20, 25, 28, 29), but it should be noted that many factors, including age, ambient temperature, and diet, produce profound effects on UCP1 expression. In our studies using 5- to 6-wk-old mice equilibrated to 23 C, we found that UCP1 mRNA and protein expression were significantly reduced in both BAT and retroperitoneal WAT of ob/ob compared with lean mice. In contrast, we found that rearing lean and ob/ob mice at 30 C minimized the difference in UCP1 expression between the phenotypes (Gettys, T. W., unpublished data). Thus, subtle differences in rearing conditions may explain the heterogeneity of published data on this point. Given that the sole known function of UCP1 is to waste energy, the results of the present study are consistent with the hypothesis that the higher energetic efficiency of ob/ob mice compared with that of lean littermates is due in part to lower expression of UCP1 in both BAT and WAT.

Given its high capacity for facultative energy expenditure, a consensus has developed to support the view that BAT may also function to prevent obesity during periods of high caloric intake (30, 31, 32). Direct evidence that BAT serves this function was provided by Lowell et al. (31, 33), who showed that toxigene-mediated ablation of BAT produced obesity that was exacerbated by a high fat diet. In contrast, Enerback et al. (34) found that transgenic mice lacking UCP1 were cold sensitive but not obese. Similar observations were made by Thomas et al. (35), who found that transgenic mice lacking the enzyme responsible for converting dopamine into norepinephrine (dopamine ß-hydroxylase) were not obese. However, it should be noted that comparisons of wild-type and transgenic mice made at higher ambient temperatures would lower UCP1 expression in wild-type mice and minimize its expected contribution to differences in energetic efficiency between the two phenotypes (34, 35). This point is underscored by recent studies showing that rearing the toxigene UCP1 knockouts of Lowell et al. (31) at thermoneutrality minimized the difference in fat deposition between control and transgenic mice (36). Lastly, both Enerback et al. (34) and Thomas et al. (35) noted increased expression of the UCP1 homolog, UCP2, in adipose tissue from their respective transgenic mice. This observation raises the possibility that thermogenic capacity was enhanced through this or other adaptive mechanisms and masked the significance of the loss of UCP1 expression in these models. This suggestion is supported by observations from the latter study showing paradoxically elevated rates of oxygen consumption in the dopamine ß-hydroxylase knockout mice (35). Additional data relevant to this issue come from studies where UCP1 expression was induced. For instance, targeted disruption of the more poorly activated isoform of protein kinase A (RIIß) in adipose tissue and replacement with the more sensitive protein kinase A isoform produced genetically lean mice (30). Characterization of the mice revealed induction of UCP1, resistance to diet-induced obesity, and reductions in WAT mass. A similar resistance to obesity was noted in transgenic mice with UCP1 expression directed by the aP2 promoter, where enhanced UCP1 expression was documented in both BAT and WAT (37). Collectively, these studies and the present work indicate that variation in UCP1 expression can have a significant impact on energetic efficiency and adipose tissue deposition. Moreover, it seems likely that the compromised expression of UCP1 contributes to the thriftiness of the ob/ob mouse and its propensity to accumulate adipose tissue.

In the present study, injection of ob/ob mice with doses of leptin similar to those previously shown to induce weight loss and adipose tissue depletion (5, 6, 7) produced a 5- to 10-fold increase in UCP1 mRNA and protein in both BAT and retroperitoneal WAT. Similar, albeit smaller, effects of leptin on UCP1 have been reported in BAT of lean rats (38) and ob/ob mice (20) as well as in BAT and WAT of lean C57BL6/J mice (39). In the latter study, UCP1 mRNA levels were 10-fold higher in epididymal WAT compared with retroperitoneal WAT. In addition, the researchers observed a more significant leptin-mediated induction of UCP1 in epididymal compared with retroperitoneal WAT (39). Although we also used a sensitive RPA to quantitate UCP1 mRNA, we have never detected message levels for this protein in epididymal WAT except under extreme conditions (cold exposure or ß3-AR agonists). In contrast, we found significant amounts of UCP1 mRNA and protein in retroperitoneal WAT that were readily increased after 3 days of leptin treatment. In that 5-week-old C57BL6/J mice were used in the same experimental protocol in both studies, the reasons for these differences in UCP1 expression patterns and leptin sensitivity are not clear.

It is generally accepted that expression of UCP1 is restricted to brown adipocytes, but recent evidence has clearly established that cold exposure or ß3-AR agonists induce ectopic expression of UCP1 in WAT depots (15, 16, 40, 41). Examination of WAT from rodents after cold exposure reveals an increased number of adipocytes with morphological characteristics of brown adipocytes (42, 43, 44). Although the origins of these cells have not been established, it is possible that ß-adrenergic stimulation reawakened brown preadipocytes or promoted the transdifferentiation of pluripotent preadipocytes that reside within the WAT depot. Inasmuch as the capacity of a cell to conduct thermogenesis is directly related to the amount of UCP expressed in it, our finding that leptin increased UCP1 mRNA and protein in retroperitoneal WAT is the first to demonstrate that leptin can increase the thermogenic capacity of WAT. It will be important to establish whether the observed changes in UCP1 expression and cell morphology are accompanied by increased thermogenic activity in this tissue.

The ability of UCP1 to uncouple oxidative phosphorylation is conferred by its ability to short circuit the proton gradient established across the inner mitochondrial matrix by the electron transport chain (10, 11, 12). The release of norepinephrine from sympathetic nerves directly activates UCP1 through a ß3-AR- and cAMP-dependent process (13, 27) and simultaneously increases thermogenic capacity in brown adipocytes by transcriptional activation of the UCP1 gene (13, 45, 46). Thus, the recent findings that leptin increases sympathetic nervous system outflow (8) and norepinephrine turnover in BAT and WAT (9) suggest that leptin increases UCP1 expression in these tissues through modulation of sympathetic tone. This conclusion is also supported by the findings of Hwa et al. (21, 22), who showed that peripheral or central administration of leptin produced identical changes in respiratory quotient, indicating a specific decrease in carbohydrate oxidation and a concomitant increase in fat oxidation. The combination of increased fat oxidation, oxygen consumption, and serum FFAs in these studies makes a strong case that leptin increased energy utilization through acute activation of thermogenesis. Results from the present work support the conclusion that leptin also increases thermogenic capacity by increasing UCP1 expression, but it is unclear whether the increased UCP1 in retroperitoneal WAT allows significant fat oxidation to occur within this site. A recent study by Harris et al. (47) showed that leptin produced a rather uniform decrease in the size of WAT depot sites. These findings would argue against the suggestion that UCP1 induction in particular depot sites would make them more sensitive to the fat-depleting effects of leptin. However, it may be possible that changes in the expression of UCP2 or UCP3 could compensate in depot sites where UCP1 expression was not modified. Alternatively, the leptin-mediated increase in fat oxidation observed by Hwa et al. (21, 22) may be occurring primarily in BAT after mobilization and transfer of FFAs from WAT depots. Grujic et al. (48) provided data relevant to this point by showing that transgenic reexpression of ß3-ARs in both BAT and WAT was necessary to restore the increase in oxygen consumption seen in animals treated with a ß3-AR agonist. Interestingly, reexpression of the ß3-AR in only BAT failed to restore this effect on oxygen consumption. Although this model does not address the question of whether significant fat oxidation is occurring within WAT, it does illustrate that WAT is an obligatory participant in the thermogenic process. It will be interesting to examine these issues in transgenic mice, in which ß3-AR expression is rescued solely in WAT.

The cloning of UCP2 (17) and its reported linkage to markers of obesity (17, 20, 49) suggest that this UCP may play a role in determining metabolic efficiency. A number of studies have since addressed the physiological role and regulation of UCP2, but a clear consensus has not emerged from this work. For instance, using a rat leptin complementary DNA-containing adenovirus to make rats hyperleptinemic, Zhou et al. (50) showed that leptin increased UCP2 mRNA in WAT from lean Zucker rats, but not in fatty Zucker rats. Moreover, despite high circulating levels of endogenous leptin, UCP2 mRNA was not elevated in control fatty Zucker rats compared with lean littermates (50). Given our present understanding of the genetic defect in fatty Zucker rats (51), these results argue against a direct effect of leptin on adipose tissue and indicate that the centrally expressed long form of the leptin receptor is necessary for leptin to regulate UCP2 expression. In contrast, Gimeno et al. (18) reported that UCP2 was elevated 5-fold in WAT from both ob/ob and db/db mice compared with that in lean littermates. The results of Gimeno et al. (18) are at odds with those of Zhou et al. (50) in that they argue that the absence of a leptin signal (ob/ob and db/db) leads to up-regulation of UCP2 expression. We examined both retroperitoneal and epididymal WAT and found no evidence that UCP2 mRNA was elevated in ob/ob compared with lean mice at either site. Our results also differed from those of Zhou et al. (50) in that leptin failed to increase UCP2 mRNA in retroperitoneal WAT of either lean or ob/ob mice. The reason for these differences is unclear, although it should be noted that different species (rat vs. mouse) and methods of leptin administration (leptin adenovirus vs. ip injection of recombinant leptin) were used in the two studies. Our finding is strengthened by the observation that leptin produced a robust increase in UCP1 expression at this site and is also consistent with previous work that reported that cold exposure or ß3-AR agonists did not alter UCP2 expression in WAT, but produced a robust increase in UCP1 (17) (Gettys, T. W., unpublished data). Considered together, the results make a strong case that leptin does not regulate UCP1 and UCP2 through a common mechanism and suggest that if leptin does influence UCP2 expression, it does so through an indirect mechanism not involving modulation of sympathetic tone or cAMP.

In conclusion, the present studies demonstrate that UCP1 mRNA and protein levels are lower in both BAT and retroperitoneal WAT from ob/ob mice compared with those in lean littermates. It addition, it is shown that leptin restores the expression of UCP1 (mRNA and protein) in tissues from young ob/ob mice, but produces little or no effect on UCP2 mRNA in WAT. Our findings are consistent with the hypothesis that leptin stimulates energy utilization and fat oxidation by acutely activating thermogenesis and enhancing thermogenic capacity through increased UCP1 expression.


   Acknowledgments
 
The authors acknowledge the excellent technical assistance of Libby Metzler and Ann Babb. We thank Amgen, Inc. for providing the recombinant mouse leptin used in this work.


   Footnotes
 
1 This work was supported by a research grant from the American Diabetes Association, USPHS Grant DK-53981, and a research grant from the USDA (NRICGP/USDA 9800699). Back

Received July 1, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lin P-Y, Romsos DR, Leveille GA 1977 Food intake, body weight gain, and body composition of the young obese (ob/ob) mouse. J Nutr 107:1715–1723
  2. Thurlby PL, Trayhurn P 1978 The development of obesity in preweaning obob mice. Br J Nutr 39:397–402[CrossRef][Medline]
  3. Trayhurn P 1984 The development of obesity in animals: the role of genetic susceptibility. Clin Endocrinol Metab 13:451–474[Medline]
  4. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  5. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1995 Recombinant mouse Ob protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269:546–549[Abstract/Free Full Text]
  6. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  7. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269:540–543[Abstract/Free Full Text]
  8. Haynes WG, Morgan DA, Walsh SA, Mark AL, Sivitz WI 1997 Receptor-mediated regional sympathetic nerve activation by leptin. J Clin Invest 100:270–278[Medline]
  9. Collins S, Kuhn CM, Petro AE, Swick AG, Chrunyk BA, Surwit RS 1996 Role of leptin in fat regulation. Nature 380:677–677[CrossRef][Medline]
  10. Nicholls D, Locke R 1984 Thermogenic mechanisms in brown fat. Physiol Rev 64:1–64[Free Full Text]
  11. Himms-Hagen J 1985 Brown adipose tissue metabolism and thermogenesis. Annu Rev Nutr 5:69–94[CrossRef][Medline]
  12. Klingenberg M 1990 Mechanism and evolution of the uncoupling protein of brown adipose tissue. Trends Biochem Sci 15:108–112[CrossRef][Medline]
  13. Bouillaud F, Ricquier D, Mory G, Thibault J 1984 Increased level of mRNA for the uncoupling protein in brown adipose tissue of rats during thermogenesis induced by cold exposure or norepinephrine infusion. J Biol Chem 259:11583–11586[Abstract/Free Full Text]
  14. Himms-Hagen J 1989 Brown adipose tissue thermogenesis and obesity. Prog Lipid Res 28:67–115[CrossRef][Medline]
  15. Collins S, Daniel KW, Petro AE, Surwit RS 1997 Strain-specific response to ß3-adrenergic receptor agonist treatment of diet-induced obesity in mice. Endocrinology 138:405–413[Abstract/Free Full Text]
  16. Nagase I, Yoshida T, Kumamoto K, Umekawa T, Sakane N, Nikami H, Kawada T, Saito M 1996 Expression of uncoupling protein in skeletal muscle and white fat of obese mice treated with thermogenic ß3-adrenergic agonist. J Clin Invest 97:2898–2904[Medline]
  17. Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272[CrossRef][Medline]
  18. Gimeno RE, Dembski M, Weng X, Deng N, Shyjan AW, Gimeno CJ, Iris F, Ellis SJ, Woolf EA, Tartaglia LA 1997 Cloning and characterization of an uncoupling protein homolog. A potential molecular mediator of human thermogenesis. Diabetes 46:900–906[Abstract]
  19. Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB 1997 UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochem Biophys Res Commun 235:79–82[CrossRef][Medline]
  20. Gong DW, He YF, Karas M, Reitman M 1997 Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, ß3-adrenergic agonists, and leptin. J Biol Chem 272:24129–24132[Abstract/Free Full Text]
  21. Hwa JJ, Ghibaudi L, Compton D, Fawzi AB, Strader CD 1996 Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice. Horm Metab Res 28:659–663[Medline]
  22. Hwa JJ, Fawzi AB, Graziano MP, Ghibaudi L, Williams P, Van Heek M, Davis H, Rudinski M, Sybertz E, Strader CD 1997 Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice. Am J Physiol Regul Integr Comp Physiol 272:R1204–R1209
  23. Gettys TW, Watson PM, Seger L, Padgett M, Taylor IL 1997 Adrenalectomy after weaning restores ß3-adrenergic receptor expression in white adipocytes from C57BL/6J mice. Endocrinology 138:2697–2704[Abstract/Free Full Text]
  24. Granneman JG, Lahners KN 1994 Analysis of human and rodent ß3-adrenergic receptor messenger ribonucleic acids. Endocrinology 135:1025–1031[Abstract]
  25. Jacobsson A, Stadler U, Glotzer MA, Kozak LP 1985 Mitochondrial uncoupling protein from mouse brown fat. Molecular cloning, genetic mapping, and mRNA expression. J Biol Chem 260:16250–16254[Abstract/Free Full Text]
  26. Bray GA, York DA 1979 Genetically transmitted obesity in rodents. Physiol Rev 51:598–646
  27. Himms-Hagen J 1984 Brown adipose tissue thermogenesis, energy balance, and obesity. Can J Biochem Cell Biol 62:610–617[Medline]
  28. Ricquier D, Bouillaud F, Toumelin P, Mory G, Bazin R, Arch J, Penicaud L 1986 Expression of uncoupling protein mRNA in thermogenic or weakly thermogenic brown adipose tissue. J Biol Chem 261:13905–13910[Abstract/Free Full Text]
  29. Ashwell M, Holt S, Jennings G, Stirling DM, Trayhurn P, York DA 1985 Measurement by radioimmunoassay of the mitochondrial uncoupling protein from brown adipose tissue of obese (ob/ob) mice and Zucker (fa/fa) rats at different ages. FEBS Lett 179:233–237[CrossRef][Medline]
  30. Cummings DE, Brandon EP, Planas JV, Motamed K, Idzerda R, McKnight GS 1996 Genetically lean mice result from targeted disruption of the RIIß subunit of protein kinase A. Nature 382:622–626[CrossRef][Medline]
  31. Lowell BB, Susulic VS, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, Kozak LP, Flier JS 1993 Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366:740–742[CrossRef][Medline]
  32. Rothwell NJ, Stock MJ 1984 Effects of denervating brown adipose tissue on the responses to cold, hyperphagia and noradrenaline treatments in the rat. J Physiol 355:457–463[Abstract/Free Full Text]
  33. Hamann A, Flier JS, Lowell BB 1996 Decreased brown fat markedly enhances susceptibility to diet-induced obesity, diabetes, and hyperlipidemia. Endocrinology 137:21–29[Abstract]
  34. Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387:90–94[CrossRef][Medline]
  35. Thomas SA, Palmiter RD 1997 Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387:94–97[CrossRef][Medline]
  36. Melnyk A, Harper ME, Himms-Hagen J 1997 Raising at thermoneutrality prevents obesity and hyperphagia in BAT-ablated transgenic mice. Am J Physiol Regul Integr Comp Physiol 272:R1088–R1093
  37. Kopecky J, Clarke G, Enerback S, Spiegelman B, Kozak LP 1995 Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest 96:2914–2923
  38. Scarpace PJ, Matheny M, Pollock BH, Tümer N 1997 Leptin increases uncoupling protein expression and energy expenditure. Am J Physiol Endocrinol Metab 273:E226–E230
  39. Sarmiento U, Benson B, Kaufman S, Ross L, Qi MY, Scully S, DiPalma C 1997 Morphologic and molecular changes induced by recombinant human leptin in the white and brown adipose tissues of C57BL/6 mice. Lab Invest 77:243–256[Medline]
  40. Himms-Hagen J, Cui J, Danforth E, Taatjes DJ, Lang SS, Waters BL, Claus TH 1994 Effect of CL-316,243, a thermogenic ß3-agonist, on energy balance and brown and white adipose tissues in rats. Am J Physiol 35:R1371–R1382 (Abstract)
  41. Picó C, Bonet ML, Palou A 1998 Stimulation of uncoupling protein synthesis in white adipose tissue of mice treated with the ß3-adrenergic agonist CGP- 12177. Cell Mol Life Sci 54:191–195[CrossRef][Medline]
  42. Cousin B, Cinti S, Morroni M, Raimbault S, Ricquier D, Penicaud L, Casteilla L 1992 Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization. J Cell Sci 103:931–942[Abstract/Free Full Text]
  43. Loncar D, Afzelius BA, Cannon B 1988 Epididymal white adipose tissue after cold stress in rats. II. Mitochondrial changes. J Ultra Mol Structure Res 101:199–209
  44. Ghorbani M, Claus TH, Himms-Hagen J 1997 Hypertrophy of brown adipocytes in brown and white adipose tissues and reversal of diet-induced obesity in rats treated with a ß3-adrenoceptor agonist. Biochem Pharmacol 54:121–131[CrossRef][Medline]
  45. Silva JE, Rabelo R 1997 Regulation of the uncoupling protein gene expression. Eur J Endocrinol 136:251–264[Abstract/Free Full Text]
  46. Cannon B, Nedergaard J 1996 Adrenergic regulation of brown adipocyte differentiation. Biochem Soc Trans 24:407–412[Medline]
  47. Harris RBS, Zhou J, Redmann Jr SM, Smagin GN, Smith SR, Rodgers E, Zachwieja JJ 1998 A leptin dose-response study in obese (ob/ob) and lean (+/?) mice. Endocrinology 139:8–19[Abstract/Free Full Text]
  48. Grujic D, Susulic VS, Harper ME, Himms-Hagen J, Cunningham BA, Corkey BE, Lowell BB 1997 ß3-Adrenergic receptors on white and brown adipocytes mediate ß 3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake: a study using transgenic and gene knockout mice. J Biol Chem 272:17686–17693[Abstract/Free Full Text]
  49. Bouchard C, Pérusse L, Chagnon YC, Warden C, Ricquier D 1997 Linkage between markers in the vicinity of the uncoupling protein 2 gene and resting metabolic rate in humans. Hum Mol Genet 6:1887–1889[Abstract/Free Full Text]
  50. Zhou YT, Shimabukuro M, Koyama K, Lee Y, Wang MY, Trieu F, Newgard CB, Unger RH 1997 Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. Proc Natl Acad Sci USA 94:6386–6390[Abstract/Free Full Text]
  51. Chua Jr SC, Chung WK, Wu-Peng XS, Zhang YY, Liu SM, Tartaglia L, Leibel RL 1996 Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271:994–996[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Commins, S. P.
Right arrow Articles by Gettys, T. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals