This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wong, A. O. L. Articles by Chow, B. K. C. Search for Related Content PubMed PubMed Citation Articles by Wong, A. O. L. Articles by Chow, B. K. C.

Hypophysiotropic Action of Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) in the Goldfish: Immunohistochemical Demonstration of PACAP in the Pituitary, PACAP Stimulation of Growth Hormone Release from Pituitary Cells, and Molecular Cloning of Pituitary Type I PACAP Receptor¹

Department of Zoology, University of Hong Kong, Hong Kong; and the Department of Biological Sciences, University of Alberta (J.P.C.), Edmonton, Alberta T6G 2E9, Canada

Address all correspondence and requests for reprints to: Dr. Anderson O. L. Wong, Department of Zoology, University of Hong Kong, Pokfulam Road, Hong Kong.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Pituitary adenylate cyclase-activating polypeptide (PACAP) is a member of the glucagon/secretin peptide family, and its molecular structure is highly conserved in vertebrates. In this study, the functional role of PACAP in regulating GH release in the goldfish was investigated. Using immunohistochemical staining, nerve fibers with PACAP immunoreactivity were identified in the vicinity of goldfish somatotrophs, suggesting that this neuropeptide may influence GH release in the goldfish. The direct regulatory action of PACAP on GH secretion was demonstrated in vitro in perifused goldfish pituitary cells. PACAPs (0.01 nM to 1 µM) from different species, including ovine PACAP₂₇, ovine PACAP₃₈, frog PACAP₃₈, zebra fish PACAP₂₇, and zebra fish PACAP₃₈, were all effective in stimulating GH release with ED₅₀ values of 8.9 ± 3.5, 3.3 ± 1.6, 14.4 ± 3.5, 15.4 ± 4.1, and 1.4 ± 0.2 nM, respectively. Similar concentrations of vasoactive intestinal polypeptide (VIP), a peptide related to PACAP, was not effective in this respect. In addition, the GH-releasing action of ovine PACAP₃₈ (10 nM) was inhibited by the PACAP antagonist PACAP_6–38 (10 µM), but not by the VIP antagonist [4-Cl-D-Phe⁶,Leu¹⁷]VIP (10 µM). The pharmacology of these GH responses is consistent with the mammalian type I PACAP receptors, suggesting that a similar receptor subtype is present in the goldfish pituitary and mediates the GH-releasing action of PACAP. To establish the structural identity of this goldfish PACAP receptor, a complementary DNA (cDNA) clone sharing a high degree of sequence homology with mammalian type I PACAP receptors was isolated from a goldfish pituitary cDNA library. This cDNA was 5.2 kb in size with a 1.4-kb open reading frame and encoded a 465-amino acid protein with the typical structure of a 7-transmembrane domain-containing, G protein-coupled receptor. Functional expression of this cDNA in COS-7 cells revealed that this fish type I PACAP receptor could be activated by ovine PACAP₂₇ and PACAP₃₈ to increase cAMP synthesis with ED₅₀ values of 2.4 ± 0.8 and 4.2 ± 1.2 nM, respectively. Other structurally related peptides, including VIP (100 nM), GH-releasing hormone (100 nM), glucagon (100 nM), secretin (100 nM), gastric inhibitory polypeptide (100 nM), and PTH (100 nM), were not effective in altering cAMP production. Using Northern blot and RT-PCR, messenger RNA transcripts of this PACAP receptor were identified in the brain, heart, and pituitary of the goldfish. These results, taken together, support the hypothesis that PACAP functions as a novel GH-releasing factor in the goldfish through activation of type I PACAP receptors.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
PITUITARY adenylate cyclase-activating polypeptide (PACAP) is a member of the secretin/glucagon/vasoactive intestinal polypeptide (VIP) family (1). In mammals, two biologically active forms of PACAP have been purified, namely PACAP₃₈ (2) and PACAP₂₇ (3). PACAP₃₈ is a 38-amino acid peptide with its N-terminal 28 amino acids sharing 68% sequence identity with VIP, and PACAP₂₇ is a truncated form of PACAP₃₈ containing only the first 27 amino acids. These 2 peptides are derived from the same precursor prepro-PACAP through posttranslational proteolysis and alternative -amidation (1). In the rat, immunoreactivity for PACAP has been identified in the brain, intestine, adrenal gland, and testes (4), and PACAP₃₈ was the predominant form (5). In general, PACAP is considered a neurotransmitter/neuromodulator in the central nervous system (6), although its roles as a growth factor (7) and vasoregulator (8) have also been suggested.

The molecular structure of PACAP is highly conserved among vertebrates. PACAP complementary DNAs (cDNAs) have been cloned in the rat (9), sheep (10), mouse (11), and human (12), and the deduced amino acid sequences of PACAP₃₈ were identical. PACAP has also been isolated from amphibian (13), chicken (14), and teleost fish tissues (15). PACAP₃₈ from the frog has only one amino acid substitution at position 35, with isoleucine substituted for valine in rat PACAP₃₈ (13). PACAP cDNAs from the salmon (16) and catfish (17) reveal that the fish PACAP₃₈ is highly homologous to the mammalian form and has only three or four amino acid substitutions in the C-terminal. Furthermore, these fish PACAP cDNAs also contain the coding sequence of a GH-releasing hormone (GHRH)-like peptide, and differential expression of PACAP and this GHRH-like peptide as a result of exon skipping has been reported in salmons (18). In general, it is believed that the two separate genes encoding PACAP and GHRH in mammals are the result of gene duplication during evolution from fish to tetrapods (16, 17). Recently, PACAP₂₇ has been identified in the neural gland of tunicates (19), suggesting that PACAP may be a neuropeptide in protochordates.

In mammals, the biological actions of PACAP are mediated through two different receptor subtypes, namely type I and type II PACAP receptors (1). Both of them are G protein-coupled receptors with a classical structure of seven transmembrane domains (TMD). Type I PACAP receptors (or PVR1 receptors) exhibit a high binding affinity for PACAP₃₈ and PACAP₂₇, but not for VIP. Type II PACAP receptors, in contrast, have equal binding affinities for PACAP₃₈, PACAP₂₇, and VIP. Therefore, this group of PACAP receptors is also referred to as VIP receptors in some studies (20, 21). Type II PACAP receptors can be further subdivided into VIP1 (or PVR2 receptors) and VIP2 receptors (or PVR3 receptors), which are encoded by different genes, respectively (for a recent review on PACAP receptors, see Ref. 22).

In recent years, the role of PACAP as a hypophysiotropic factor in mammals has been proposed based on the findings that PACAP nerve fibers are present in the median eminence (23), PACAP immunoreactivity can be detected in the hypophysial portal blood (24), and PACAP stimulates cAMP production in pituitary cell cultures (2, 3) and under certain conditions induces LH, FSH, GH, and ACTH release from rat pituitary cells (25). Regarding the GH-releasing action, PACAP is a weak (25) or modest stimulator (26) of GH release. In general, it is not considered to be a typical GH-releasing factor but, rather, a modulator of pituitary hormone secretion (22). In the rat, PACAP-stimulated GH release from pituitary cells is more readily observed using a perifusion system (2) or a reverse hemolytic plaque assay (27). In perifused GH₃ cells, a rat pituitary cell line, the stimulatory action of PACAP on GH release is mediated through type II PACAP receptors (28). Results from static incubation studies, however, are more variable; no effects (2) as well as a modest stimulation after a long incubation (25) have been reported. In in vivo studies, PACAP increases plasma GH levels in the rat (29), but not in the sheep (30) or human (31), suggesting that the GH-releasing effect of PACAP is species specific. In the ewe, injection of PACAP into the brain induces a paradoxical inhibition of GH release (30). These results indicate that PACAP may also act centrally to regulate GH secretion.

In teleost fishes, the brain-pituitary axis is unique for the lack of a hypophysial portal blood system (32). Unlike that in mammals, the median eminence of teleosts is functionally incorporated into the anterior pituitary, and individual pituitary cells are directly innervated by neuronal fibers from the hypothalamus (33). Neuropeptides (e.g. GnRH, TRH, and neuropeptide Y) as well as neurotransmitters (e.g. dopamine), besides acting within the hypothalamus, exert their regulatory actions on GH release directly at the pituitary cell level (for a recent review, see Ref. 34). In lower vertebrates, especially in fish, the studies of PACAP have focused mainly on the structural evolution of the peptide, and very little is known about its biological functions. Whether PACAP is a hypophysiotropic factor in teleosts is unclear, as neither the delivery of PACAP nor the presence of PACAP receptors has been demonstrated in the pituitary of fish species. In this study, the role of PACAP as a potential hypophysiotropic factor regulating GH release in goldfish via activation of pituitary type I PACAP receptors was examined.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals
Goldfish (Carassius auratus) of the common or comet variety with body weight ranging from 25–35 g were purchased from local pet stores and maintained in 200 liters aquaria at 18 C under a 12-h light, 12-h dark photoperiod for 2 weeks before experiments. The fish were fed to satiation daily with commercial fish feed. As the fish used in this study were in the early stages of gonadal recrudescence, and sexual dimorphism was not apparent, goldfish of mixed sexes were used for the preparation of pituitary cells and extraction of tissue messenger RNA (mRNA).

Reagents and test substances
PACAP_6–38, [4-Cl-D-Phe⁶,Leu¹⁷]VIP, frog PACAP₃₈, ovine PACAP₂₇, and PACAP₃₈ were obtained from Peninsula Laboratories (Belmont, CA). Zebra fish PACAP₂₇ and PACAP₃₈ were gifts from Dr. S. Mojsov (Rockefeller University, New York, NY). PACAP-related peptides, including glucagon, secretin, GHRH, PTH, VIP, and gastric inhibitory polypeptide (GIP), were purchased from Bachem Fine Chemicals (La Jolla, CA). All of these peptides were dissolved in doubled distilled water and stored frozen as 1-mM stocks at -20 C. Subsequent dilution to appropriate concentrations with culture medium was performed 15 min before drug treatment. Ionomycin obtained from Calbiochem (La Jolla, CA) and 1-methyl-3-iso-butylxanthine (IBMX) from Research Biochemical International (Natick, MA) were stored as 10-mM and 1-M stocks in dimethylsulfoxide, respectively. The final level of dimethylsulfoxide in culture medium was always 0.1% or less, and it did not alter basal GH release from goldfish pituitary cells.

Column perifusion of goldfish pituitary cells
Dispersed goldfish pituitary cells were prepared by controlled trypsin/deoxyribonuclease digestion as described previously (35). The viability of pituitary cells was always 94% or more, as indicated by trypan blue exclusion test. After dispersion, pituitary cells were resuspended in plating medium (medium 199 with Earle’s salts at pH 7.2, containing 26 mM NaHCO₃, 25 mM HEPES, 100,000 U penicillin/liter, 100 mg streptomycin/liter, and 1% horse serum) and incubated with preswollen Cytodex beads (Sigma Chemcial Co., St. Louis, MO) at 28 C under 5% CO₂ and saturated humidity. Cell attachment on Cytodex beads was greater than 95% after overnight incubation. Cytodex beads with pituitary cells attached were then transferred into 0.5-ml microcolumns (2 million cells/column; ACUSYST-S System, Endotronics, Minneapolis, MN) for in vitro column perifusion. Pituitary cells were perifused at a flow rate of 15 ml/h with perifusion medium (medium 199 with Hanks’ salts at pH 7.2 containing 26 mM NaHCO₃, 25 mM HEPES, 100,000 U penicillin/liter, 100 mg streptomycin/liter, and 0.1% BSA). After 3 h of continuous perifusion, GH release from pituitary cells remained relatively stable in the absence of stimulation. Test substances were then applied from a drug reservoir to the perifusion column through a three-way stopcock. Perifusate samples were collected in 5-min fractions and stored frozen at -20 C. GH contents in these samples were assayed using a RIA previously validated for goldfish GH (36).

Immunohistochemical staining of goldfish pituitary sections
Goldfish pituitaries were excised and fixed in Bouin’s fixative at 4 C for 48 h. After washing in 70% ethanol to remove picric acid, these fixed pituitaries were dehydrated with a graded series of ethanol and embedded in paraffin. Pituitary sections, 12 µm thick, were prepared and mounted on gelatin-coated slides. Immunohistochemical staining was performed using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA) with minor modifications. Briefly, pituitary sections were deparaffinized, hydrated, and treated with 0.3% H₂O₂ to inactivate endogenous peroxidase activity. After washing in 10 mM PBS (pH 7.5) for 10 min, pituitary sections were incubated in a blocking agent containing BSA (0.5%), gelatin (0.5%), and normal goat serum (2.5%) for 30 min. After a 10-min wash in PBS, these pituitary sections were exposed to antisera specific for ovine PACAP₃₈ (1:2,000; IHC8920, Peninsula Laboratories) and goldfish GH (1:50,000), respectively. Incubation with these antisera was conducted in a humidified chamber for 24 h at 4 C. Pituitary sections were then treated with biotinylated goat antirabbit antibody for 30 min, followed by another 40-min incubation with the freshly prepared avidin-biotin-peroxidase complex reagent. After rinsing briefly in PBS, these pituitary sections were then exposed to diaminobenzidine (1.28 mM) in the presence of nickel ammonium sulfate (0.038 mM) for color development. In this study, the specificity of immunostaining was confirmed by three different approaches. Firstly, pituitary sections were incubated with either PBS or normal rabbit serum without PACAP antiserum. In both cases, no immunostaining was observed in the absence of the primary antibody. Secondly, a serial dilution of PACAP antiserum resulted in a gradual decrease and eventually a complete loss of immunoreactivity. Finally, the specificity of immunostaining was further confirmed by preabsorbing PACAP antiserum (1:2000) with ovine PACAP₃₈ (0.1 mM) for 24 h at 4 C. A total loss of PACAP immunoreactivity was observed after preabsorbing the antiserum with ovine PACAP₃₈.

Cloning of goldfish type I PACAP receptor cDNA
A partial cDNA clone corresponding to the coding sequence from TMD2 to TMD6 of the goldfish PACAP receptor was obtained using a two-step nested PCR approach. Total RNA was isolated from freshly excised goldfish pituitaries, and polyadenylated [poly(A)⁺] mRNA was purified using a polyATract mRNA isolation kit (Promega, Madison, WI). First strand cDNA was prepared and used as the template for PCR amplification. The primers for PCR, including G2, G6, and G7, were designed according to the respective consensus regions of TMD2, TMD6, and TMD7 of mammalian PACAP receptors. The nucleotide sequences of G2, G6, and G7 are TGCAG/TTGG/TACA/C/T/GA/CGA/C/T/GAAG/TTAG/TATYCA, AGC/GGGGATC/GAGC/GA/GG/TA/C/T/GAGA/C/T/GGTGGAG/TTT, and TGC/GACCTCA/C/T/GCCA/ GTTA/C/T/GAC/GA/GAAA/GCAA/GTA, respectively. The first PCR was performed using G2 and G7 as the primers, and a 1-µl sample of the resulting PCR products was reamplified in a second PCR using the nested primers G2 and G6. PCR products of 500–600 bp in size were purified and subcloned into PUC-18 for subsequent DNA sequencing. PCR amplifications were carried out according to the conditions reported previously (37). The partial cDNA clone of this PACAP receptor was used as a probe to screen a goldfish pituitary cDNA library, which was constructed using a ZAP-Express cDNA library system (Stratagene, Cambridge, UK). A full-length cDNA clone of a goldfish type I PACAP receptor was obtained and excised from the original phagemid to the pBK-cytomegalovirus (CMV) vector for DNA sequencing. This goldfish type I PACAP receptor cDNA was sequenced from both strands using a T7 sequencing kit (Pharmacia, Piscataway, NJ) by primer-walking and subcloning of restriction fragments. The DNA sequences obtained were analyzed using the computer program HIBIO MacDNasis 2.0 (Hitachi, Tokyo, Japan).

Functional expression of goldfish type I PACAP receptor
A 5.2-kb BamHI/XhoI fragment of the goldfish PACAP receptor cDNA was subcloned into pBluescript SK⁺ (Stratagene, La Jolla, CA). From this construct, a 5.2-kb NotI/ApaI fragment was excised and directionally inserted into the expression vector pRC-CMV (Invitrogen, San Diego, CA). This newly constructed expression vector, pRC-CMV/gf.PACAP.R, was used to transfect the mammalian cell line COS-7 by lipofection. After 2 weeks of G418 (500 µg/ml) selection, a permanent cell line, COS-gf.PACAP.R, with stable transfection of this goldfish PACAP receptor was obtained. To test for the functionality of the expressed PACAP receptors, the effects of PACAPs and its related peptides, including PTH, GIP, glucagon, secretin, GHRH, and VIP on cAMP synthesis in this transformed cell line were examined. These experiments were performed in the presence of 0.2 mM IBMX, a phosphodiesterase inhibitor, to prevent cAMP degradation. The procedures for functional expression of receptors and cAMP RIA have been reported previously (38).

Tissue distribution of goldfish PACAP receptor mRNA
Various tissues of the goldfish, including the heart, brain, pituitary, liver, gall bladder, gills, intestine, gonads, muscle, spleen, and kidney, were freshly excised and homogenized for the preparation of poly(A)⁺ mRNA. About 3 µg mRNA from individual tissues were size-fractionated by electrophoresis in a denaturing agarose gel (1.2%) with formaldehyde (6.3%), followed by transblotting and UV cross-linking onto a Hybond N⁺ membrane. A full-length cDNA of the goldfish PACAP receptor was labeled with [-³²P]deoxy-ATP (3 µCi/mmol) using a Mega-primed DNA labeling kit (Amersham, Arlington Heights, IL). After overnight hybridization with the labeled probe at 65 C, the membrane was washed three times under high stringency conditions (0.1 x SSC-0.1% SDS) and exposed to BioMax film (Eastman Kodak, Rochester, NY) for 48 h at -80 C. To serve as an internal control, the membrane was stripped and reprobed with a ³²P-labeled partial cDNA (200 bp) for goldfish ß-actin. Tissue distribution of this goldfish PACAP receptor was further confirmed using RT-PCR. First strand cDNAs were prepared from tissue mRNA samples and used as the templates for PCR using specific primers for goldfish ß-actin and PACAP receptors. The nucleotide sequences of the primers for goldfish PACAP receptor, gf.PACAP.R1 and gf.PACAP.R2, are AGTGTCGGCAAGGTCGTGGAGGTC and CGCAGGTAGATGCTGGACTCGTTC, respectively. The PCR conditions for this goldfish PACAP receptor were 1 min at 94 C, 40 sec at 68 C, and 1 min at 72 C for a total of 28 cycles. The sequences of primers specific for goldfish ß-actin and the respective conditions for PCR have been reported previously (37).

Data transformation and statistics
GH data (nanograms per ml) from individual columns were expressed as a percentage of the mean GH contents of the first six fractions collected at the beginning of perifusion before drug treatment (referred to as % basal). This data transformation was performed to allow pooling of GH data from separate columns without distortion of the profile of GH release. In this study, GH responses were quantitated by calculating the net change in GH release after a pulse of drug treatment (i.e. a net change in the area under the curve). cAMP synthesis were measured in terms of picomoles of cAMP produced per ml/well or as the fold increase in cAMP content with respect to the control value. Dose-response curves were analyzed with the Allfit computer program to obtain the respective ED₅₀ values and maximal GH responses. The minimal effective concentration was defined as the lowest concentration of peptide tested that induced a significant increase in GH release with respect to the basal value (i.e. significantly different from zero GH response). Data for GH release and cAMP contents were subjected to statistical analysis using either Student’s t test or ANOVA followed by Fisher’s least significant difference (LSD) test. Differences were considered significant at P < 0.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Effects of ovine PACAP₂₇ and PACAP₃₈ on GH release from goldfish pituitary cells
Direct actions of PACAP on GH release at the pituitary level were examined in goldfish pituitary cells under column perifusion. Ovine PACAP₃₈ (0.01 nM to 1 µM; Fig. 1A) and PACAP₂₇ (0.01 nM to 1 µM; Fig. 1B), but not VIP (0.01 nM to 1 µM; Fig. 1C), stimulated GH release from goldfish pituitary cells in a concentration-dependent manner. The kinetics of these GH responses were rapid, with peak hormone release observed within the first 10 min after drug administration. The ED₅₀ values of ovine PACAP₃₈ and PACAP₂₇ were 3.3 ± 1.6 nM and 8.9 ± 3.5 nM, respectively. The minimal effective concentration of PACAP₃₈ (0.1 nM) to induce GH release was 10-fold lower than that of PACAP₂₇ (1.0 nM). However, the magnitudes of the maximal GH responses to these two peptides were not significantly different from each other (764 ± 154% basal for PACAP₃₈ vs. 1149 ± 257% basal for PACAP₂₇; P > 0.05).

View larger version (50K): [in this window] [in a new window]   Figure 1. Effects of ovine PACAP38 (A), PACAP27 (B), and VIP (C) on basal GH release from perifused goldfish pituitary cells. Increasing concentrations (0.01 nM to 1 µM) of ovine PACAP38, PACAP27, and VIP were given as 5-min pulses, as indicated by the vertical bars. GH data for these peptides, expressed as the mean ± SEM (n = 4–6), were pooled results from at least four independent experiments. In this study, separate columns were used for individual concentrations of peptide tested, and the mean basal GH level was 37.7 ± 3.1 ng GH/ml. Profiles of GH release are presented on the left, and the quantitated GH responses are shown on the right. GH responses were quantitated as the net change in GH release after a pulse of drug treatment (i.e. a net change of area under the curve). A similar magnitude of GH responses is denoted by the same letter (by ANOVA and Fisher’s LSD test, P > 0.05). ED50 values for the GH-releasing effect of ovine PACAP38 and PACAP27 were 3.3 ± 1.6 nM and 8.9 ± 3.5 nM, respectively.

View larger version (37K): [in this window] [in a new window]   Figure 2. Effects of the PACAP antagonist PACAP6–38 (A) and VIP antagonist [4-Cl-D-Phe6,Leu17]-VIP (B) on ovine PACAP38-stimulated GH release from perifused goldfish pituitary cells. A 5-min pulse of ovine PACAP38 (10 nM; vertical bars) was given during the 1.5-h continuous perifusion (horizontal bars) of either the PACAP antagonist PACAP6–38 (10 µM) or the VIP antagonist [4-Cl-D-Phe6,Leu17]VIP (10 µM). GH data, expressed as the mean ± SEM (n = 4), were pooled results from four separate experiments, and the mean basal GH level was 34.7 ± 2.5 ng GH/ml. Profiles of GH release are presented on the left, and the quantitated GH responses are shown on the right. GH responses were quantitated as the net change in GH release after a pulse of drug treatment (i.e. a net change in the area under the curve). A similar magnitude of GH responses is denoted by the same letter (by ANOVA and Fisher’s LSD test, P > 0.05). In this study, PACAP and VIP antagonists were dissolved directly in the perifusion medium, and therefore, the normal culture medium 199 was used as the control treatment.

View larger version (56K): [in this window] [in a new window]   Figure 3. Effects of frog PACAP38 (A), zebra fish PACAP27 (B), and zebra fish PACAP38 (C) on basal GH release from perifused goldfish pituitary cells. Increasing concentrations (0.01 nM to 1 µM) of frog PACAP38, zebra fish PACAP27, and zebra fish PACAP38 were given as 5-min pulses, as indicated by the vertical bars. GH data presented for these peptides, expressed as the mean ± SEM (n = 4–5), were pooled results from at least four independent experiments. In this study, separate columns were used for individual concentrations of peptide tested, and the mean basal GH level was 35.5 ± 4.2 ng GH/ml. Profiles of GH release are presented on the left, and the quantitated GH responses are shown on the right. GH responses were quantitated as the net change in GH release after a pulse of drug treatment (i.e. a net change in the area under the curve). A similar magnitude of GH responses is denoted by the same letter (by ANOVA and Fisher’s LSD test, P > 0.05). ED50 values for the GH-releasing effect of frog PACAP38, zebra fish PACAP27, and zebra fish PACAP38 were 14.4 ± 3.5, 1.4 ± 0.2, and 15.4 ± 4.1 nM, respectively.

View larger version (54K): [in this window] [in a new window]   Figure 4. Effect of repeated exposure to increasing concentrations of ovine PACAP38 on basal GH release from perifused goldfish pituitary cells. Ovine PACAP38 with concentrations ranging from 0.01 nM to 1 µM (A–F) was given as three consecutive 5-min pulses at 1-h intervals as indicated by the vertical bars. As a positive control, a 10-min pulse of ionomycin (50 µM) was given at the end of these perifusion experiments. The kinetics of GH release in response to different concentrations of PACAP38 during the course of perifusion are presented in the left panels (SEMs are omitted for clarity), whereas the quantitated GH responses, calculated as the net change in the area under the curve, are given in the right panels. A similar magnitude of GH responses is denoted by the same letter (by ANOVA followed by Fisher’s LSD test, P > 0.05). GH data (mean ± SEM) are pooled results from six separate experiments (n = 6), and the mean basal GH release was 36.8 ± 1.3 ng GH/ml.

View larger version (89K): [in this window] [in a new window]   Figure 5. A, Distribution of PACAP immunoreactivity in the goldfish pituitary. PACAP immunoreactivity was found in branches of nerve bundles located mainly in the periphery of the RPD (a). In the PPD (b) and NIL (c), PACAP immunostaining was identified mainly in nerve fibers of a smaller size. In contrast to that in the RPD, no specific distribution pattern of PACAP immunostaining was observed in the PPD or NIL. B, Immunostaining of PACAP (a) and GH (b) in consecutive goldfish pituitary sections. Pituitary cells with GH immunoreactivity were found only in the PPD, not in the RPD nor NIL. In the PPD, some of the fibers with PACAP immunoreactivity (indicated by arrows) were identified in the vicinity of pituitary cells with GH immunostaining. The distribution of PACAP immunostaining (dots) and GH cells (shaded area) in consecutive pituitary sections was mapped using a computer-generated overlay diagram (c). Brightfield microscopy; magnification, x100.

View larger version (144K): [in this window] [in a new window]   Figure 6. Pituitary cells with PACAP immunoreactivity in the neurointermediate lobe. A, Pituitary cells with PACAP immunostaining were identified occasionally around the blood vessels in the neurointermediate lobe (brightfield; magnification, x100). B, PACAP immunoreactivity was found in the cytoplasm but not in the nuclei of these cells (brightfield; magnification, x200). C, These PACAP-positive pituitary cells do not have the flattened structure typical of the endothelial cells, suggesting that they may not be a part of the blood vessels (brightfield; magnification, x400).

View larger version (106K): [in this window] [in a new window]   Figure 7. The cDNA and deduced amino acid sequences of the goldfish type I PACAP receptor. The seven transmembrane domains (TMD1–7) of this goldfish receptor are double underlined and labeled accordingly. The conserved cysteine residues and putative N-linked glycosylation sites are in bold and labeled * and #, respectively. The proline residues in TMD4–6, which are highly conserved among G protein-coupled receptors, are in bold italic. The consensus sequence RLAR in the third intracellular loop for the coupling with Gs is in bold, and the polyadenylation signals AATAAA/AACAAA in the 3'-end are underlined.

View larger version (45K): [in this window] [in a new window]   Figure 8. Amino acid sequence alignment of human, rat, and goldfish type I PACAP receptor. The horizontal arrows indicate the seven putative transmembrane domains (TMD1–7) of the receptor. The amino acid residues that are identical or conserved among these PACAP receptors are boxed. The conserved sequences of N-linked glycosylation sites, cysteine residues, and aspartic acid at position 75 are labeled #, *, and +, respectively.

View larger version (21K): [in this window] [in a new window]   Figure 9. Functional expression of goldfish type I receptor in COS-7 cells. A, Effects of ovine PACAP27, PACAP38, and related peptides, including VIP, GHRH, glucagon, secretin, GIP, and PTH, on cellular cAMP contents in COS-7 cells with stable expression of goldfish type I PACAP receptors. The concentration of peptide tested was fixed at 100 nM, and cAMP data were transformed into the fold increase in cAMP content in the control group (without drug treatment). B, Effect of increasing concentrations (0.01 nM-1 µM) of ovine PACAP27 and PACAP38 on cAMP synthesis in COS-7 cells with goldfish type I PACAP receptors. Similar concentrations of GHRH (0.01 nM to 1 µM) and PACAP16–38 (0.01 nM to 1 µM), an inactive analog of PACAP38, were used as the negative control. In these experiments, cAMP data were simply expressed as picomoles of cAMP per ml/well, and the estimated ED50 values for ovine PACAP27 and PACAP38 were 2.4 ± 0.8 and 4.2 ± 1.2 nM, respectively. In this study, the duration of drug treatment was fixed at 45 min in the presence of 0.2 mM IBMX.

View larger version (40K): [in this window] [in a new window]   Figure 10. Northern blot analysis of the goldfish type I PACAP receptor. Poly(A)+ RNA was prepared from various tissues of the goldfish, including A) heart, kidney, liver, muscle, pituitary, and spleen; and B) brain, gall bladder, gill, gonad, intestine, and heart. These samples (3 µg) were electrophoresed in a 1.2% agarose gel with formaldehyde and transblotted onto a Hybond N+ nylon membrane. Northern hybridization was performed using a full-length goldfish PACAP receptor cDNA probe. Transcripts of 7.4 and 5.4 kb were detected at high levels in the brain and heart and at a modest level in the pituitary, but were not detectable in other tissues. In this study, a Northern blot of goldfish ß-actin was also performed to control for the quality of mRNA prepared (results not shown), and there was no indication of mRNA degradation.

View larger version (32K): [in this window] [in a new window]   Figure 11. Tissue distribution of goldfish type I PACAP receptors as revealed by RT-PCR. Poly(A)+ RNA was prepared from various tissues of the goldfish, including the brain, gall bladder, gill, gonad, intestine, heart, kidney, liver, muscle, pituitary, and spleen. RT-PCR was performed using the specific primers for goldfish type I PACAP receptor, and a 700-bp PCR product was observed in the brain, heart, and pituitary (A). In other tissues, a faint band of the same size was also observed. As an internal control, RT-PCR for goldfish ß-actin was performed (B). In these tissue samples, except for the negative control (i.e. PCR without a template), a 200-bp PCR product specific for goldfish ß-actin was consistently observed.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Consistent with our hypothesis that PACAP may function as a GH regulator in the goldfish, PACAPs from different species, including mammalian and nonmammalian variants, concentration dependently stimulated GH release from perifused goldfish pituitary cells. The rank order of ED₅₀ of these peptides was: zebra fish PACAP₃₈ ovine PACAP₃₈ < ovine PACAP₂₇ zebra fish PACAP₂₇ frog PACAP₃₈ << mammalian VIP. Similarly, the rank order of sensitivity of goldfish pituitary cells to PACAP stimulation (as indicated by the minimal effective concentration of PACAP to induce GH release) was: zebra fish PACAP₃₈ < ovine PACAP₃₈ frog PACAP₃₈ < zebra fish PACAP₂₇ ovine PACAP₂₇. Apparently, zebra fish PACAP₃₈ is the most potent PACAP analog tested in this study. Comparison with other known GH secretagogues in the goldfish tested under a similar, if not identical, column perifusion system showed that the potency of zebra fish PACAP₃₈ (ED₅₀ = 1.4 ± 0.2 nM) is higher than those of chicken GnRH-II (ED₅₀ = 19.2 ± 1.3 nM) (42) and dopamine (ED₅₀ = 0.26 ± 0.06 µM) (43), similar to those of TRH (ED₅₀ = 5.7 ± 3.1 nM) (44) and salmon GnRH (ED₅₀ = 2.5 ± 1.4 nM) (45), but lower than that of mammalian neuropeptide Y (ED₅₀ = 0.5 ± 0.2 nM) (46) and common carp GHRH (ED₅₀ = 0.1 ± 0.1 nM) (47). The maximal GH responses induced by these GH secretagogues, e.g. dopamine (184% of basal) (43), salmon GnRH (150% of basal) (45), TRH (125% of basal) (44), mammalian neuropeptide Y (150% of basal) (46), and common carp GHRH (175% of basal) (47), were lower than that of zebra fish PACAP₃₈ (1301 ± 174% of basal). These findings suggest that, unlike mammals, PACAP is not only a modulator of pituitary hormone secretion, but may also function as a novel GH-releasing factor in the goldfish.

Stimulatory effects of PACAP on GH release have been demonstrated in vitro in rat somatotrophs (27) and clonal pituitary cell lines (26, 28). In perifusion studies with GH₃ cells, PACAP-stimulated GH release can be mimicked by the structurally related peptide VIP and abolished by simultaneous treatment with a VIP antagonist (28). The pharmacology of these GH responses suggests that PACAP stimulates GH release from GH₃ cells via activation of type II PACAP receptors. This is in agreement with the findings that type II PACAP receptors, in particular the helodermin-preferring VIP2 (PVR3) receptors, are the major form of PACAP receptors expressed in GH₄C₁ cells (48). In this clonal GH cell line, type I PACAP receptors are not expressed at a significant level. In the present study, VIP was unable to stimulate GH release from perifused goldfish pituitary cells. In addition, the GH-releasing action of ovine PACAP₃₈ was blunted by the PACAP antagonist PACAP_6–38, and the VIP antagonist [4-Cl-D-Phe⁶,Leu¹⁷]VIP was not effective in this regard. These results indicate that PACAP-stimulated GH release in the goldfish is mediated through pituitary receptors resembling the mammalian type I PACAP receptors.

Given that the structure of type I PACAP receptors is virtually unknown in lower vertebrates, molecular cloning of the goldfish type I PACAP receptor was performed to establish its structural identity and functional relevance in regulating GH release in the goldfish. A full-length cDNA clone of goldfish type I PACAP receptor was isolated, and the deduced amino acid sequence revealed that it is a G protein-coupled receptor with 7 transmembrane domains. At the amino acid sequence level, this goldfish receptor is highly homologous to that of the rat (85.7%) (49) and human (85.1%) (50) type I PACAP receptors. The 15 cysteine residues reported in these mammalian counterparts together with the proline residues found in TMD4, TMD5, and TMD6 are all conserved in this fish receptor. Cysteine residues, by forming intramolecular disulfide bonds, determine the 3-dimensional structure of receptors (51), whereas proline residues are known to introduce kinks in the -helixes of TMDs and are involved in the formation of a ligand binding pocket in some receptors, e.g. dopamine receptors (52). Based on this structural information, it would be expected that the goldfish PACAP receptor should have a tertiary structure similar to that of the mammalian receptor. This idea is in agreement with the present findings that ovine PACAP₂₇ and PACAP₃₈ were effective in stimulating GH release from goldfish pituitary cells, suggesting that this fish type I PACAP receptor can cross-react with mammalian PACAPs.

The aspartic acid residue at position 75 of the N-terminal, which is a common feature of the secretin receptor family, is also found in this goldfish type I PACAP receptor. A point mutation that altered this aspartic acid to glycine has been reported in the GHRH receptor of the little (lit) mouse model (53), and this mutated receptor is defective in transducing signals through the cAMP-dependent pathway. In this goldfish type I PACAP receptor, a consensus sequence, RLAR, has been identified in the third intracellular loop. A similar motif reported in ß-adrenergic receptors is known to be essential for the coupling to G_s and the activation of adenylate cyclase (54). These structural characteristics suggest that the biological actions of goldfish PACAP receptor are mediated through the cAMP-dependent pathway. To test this hypothesis, functional expression of goldfish type I PACAP receptors was conducted in COS-7 cells. Ovine PACAP₂₇ and PACAP₃₈ stimulated cAMP production in these COS-7 cells in a concentration-dependent manner. Other related peptides, including VIP, GHRH, GIP, PTH, glucagon, and secretin, were not effective in this respect. The lack of a stimulatory action of VIP on cAMP synthesis further confirms that this newly cloned goldfish receptor is indeed a type I PACAP receptor. The ED₅₀ values for PACAP₂₇- and PACAP₃₈-stimulated cAMP production were 2.4 ± 0.8 and 4.2 ± 1.2 nM, respectively. These ED₅₀ values are in the same concentration range as that for PACAP-stimulated GH release from goldfish pituitary cells. In our previous studies, the adenylate cyclase activator forskolin and membrane- permeant cAMP analogs were effective in stimulating GH release from goldfish pituitary cells (55). Therefore, it is conceivable that the cAMP signaling pathway is involved in PACAP-stimulated GH release in goldfish via activation of type I PACAP receptors.

To examine the tissue distribution of this goldfish type I PACAP receptor, Northern blot using mRNAs prepared from various tissues of the goldfish was performed. Transcripts of this goldfish receptor were identified in the brain, heart, and pituitary, but not in other tissues, including the liver, kidney, gonads, spleen, intestine, gills, muscle, and gall bladder. The presence of type I PACAP receptors in the brain is consistent with the roles of PACAP as a neurotransmitter/neuromodulator (6) and nerve growth factor (7). Although PACAP is also proposed to be a vasoregulator (8), the expression of PACAP receptors in the heart has not been previously reported. In the goldfish, the heart contains a high level of mRNA for type I PACAP receptors. Therefore, it is logical to speculate that PACAP may play a role in the control of cardiac functions in this fish species. Compared with those in the brain and heart, the level of expression of goldfish PACAP receptors was lower in the pituitary. Nevertheless, the presence of type I PACAP receptors in the goldfish pituitary is consistent with our findings that PACAP stimulates GH release from goldfish pituitary cells through activation of type I PACAP receptors. Together with the identification of PACAP nerve fibers in the goldfish pituitary, it is highly possible that PACAP may function as a classical hypophysiotropic factor in teleost fishes. In this study, the tissue distribution of this goldfish type I PACAP receptor was further confirmed using RT-PCR. Using this more sensitive approach, besides the predominant signals found in the brain, heart, and pituitary, a faint band of the same size was demonstrated in other tissues as well (e.g. gall bladder, gills, gonads, intestine, kidney, liver, muscle, and spleen). The authenticity of these PCR signals was confirmed by Southern blot, suggesting that type I PACAP receptors are also expressed in these tissues at low levels. At present, the biological relevance of such a low level of receptor expression in the goldfish is unclear.

In this study, direct actions of PACAP on GH release from goldfish pituitary cells were tested using a column perifusion system. Static incubation of goldfish pituitary cells were deliberately avoided. In mammals, such as the rat, PACAP-stimulated GH release is not a consistent observation using static incubation of pituitary cells; both no effects (2) and a weak stimulation after a long incubation has been reported (25, 29). In those studies with a stimulatory effect, an indirect action of PACAP by inducing the release of autocrine/paracrine factors has been suggested (29). This idea is supported by the findings that PACAP stimulates interleukin-6 release from folliculo-stellate cells in the rat pituitary (56), and interleukin-6 is known to have GH-releasing activity (57). In the goldfish, the rapidity of GH responses to PACAP stimulation (<5 min) argues against the possibility of an indirect action of PACAP through autocrine/paracrine factors. Furthermore, indirect actions of PACAP in this study were avoided using a perifusion system that removes the secreted products from goldfish pituitary cells and prevents any accumulation of autocrine/paracrine factors. Besides, in this study it has been shown that repeated exposure to PACAP dose dependently reduced the GH-releasing action of PACAP in perifused goldfish pituitary cells. This desensitization of GH-releasing action may explain why some of the static incubation studies with PACAP did not exhibit a consistent GH-releasing effect. In the goldfish, this loss of responsiveness could not be due to a depletion of cellular GH stores, as the positive control ionomycin was still effective in stimulating GH release at the end of these experiments. At present, the mechanism(s) for this down-regulation of PACAP-stimulated GH release is unknown, but similar observations in other receptor systems have been attributed to a decrease in receptor capacity [e.g. GnRH receptors, (58)] and/or an uncoupling of signaling pathways from membrane receptors [e.g. ß-adrenergic receptors (59)].

In summary, we have demonstrated that PACAP nerve fibers are present in the goldfish pituitary, and PACAPs from different species, including the mammalian and nonmammalian variants, are effective in stimulating GH release from perifused goldfish pituitary cells. The potency of these PACAPs on GH release is in the nanomolar concentration range, and the efficacy of their GH-releasing actions, especially for zebra fish PACAP₃₈, is higher than that of other known GH-releasing factors reported in the goldfish. The GH-releasing effect of PACAP can be desensitized by repeated exposure to increasing concentrations of ovine PACAP₃₈. In this study, the pharmacology of PACAP-stimulated GH release reveals that this stimulatory action is mediated through pituitary type I PACAP receptors. This idea is supported by the molecular cloning and subsequent tissue distribution studies of goldfish type I PACAP receptor. This newly cloned goldfish PACAP receptor has the classical structure of a G protein-coupled receptor with seven transmembrane domains and is highly homologous to the mammalian type I PACAP receptors. Functional expression of this goldfish receptor indicates that it is functionally coupled to the cAMP-dependent pathway and exhibits a similar pattern of ligand selectivity as that of type I PACAP receptors. In the goldfish, this type I PACAP receptor is expressed at a high level in the brain and heart and to a modest level in the pituitary, but to a low level in other tissues, including the liver, kidney, gonads, spleen, gill, intestine, muscle, and gall bladder. These results, as a whole, suggest that PACAP, through activation of pituitary type I PACAP receptors, may function as a novel GH-releasing factor in the goldfish.

	Acknowledgments

 
Special thanks are given to Dr. R. E. Peter (University of Alberta, Edmonton, Canada) for the supply of GH standard and antiserum for GH RIA, Dr. S. Mojsov (Rockefeller University, New York, NY) for providing us with zebra fish PACAP₂₇ and PACAP₃₈, and Mr. E. K. Y. Lee (Hong Kong University) for his help with PACAP immunohistochemical staining. We are also grateful to Drs. K. L. Yu, D. K. O. Chan, F. C. Leung, and S. M. Chan for their support throughout the research project.

	Footnotes

 
¹ Part of the present study was presented in the 10th International Congress of Endocrinology, San Francisco, CA, June 12–15, 1996, and the 2nd International Union of Biological Sciences Symposium on Advances in Molecular Endocrinology of Fish, Toronto, Canada, May 17–19, 1997. This work was supported by Research Grant Council Grants (Hong Kong; to A.O.L.W. and B.K.C.C.) and the Department of Zoology (Hong Kong University; to M.Y.L., L.Y.T., and W.L.C.S.) in the form of teaching assistantship.

Received November 24, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Rawlings SR 1994 PACAP, PACAP receptors, and intracellular signalling. Mol Cell Endocrinol 101:C5–C9
2. Miyata A, Arimura A, Dahl DH, Minamino N, Uehara A, Jiang L, Culler MD, Coy DH 1989 Isolation of a novel 38 residue hypothalamic peptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun 164:567–574[CrossRef][Medline]
3. Miyata A, Dah DH, Jiang L, Kitada K, Fujino M, Minamino N, Arimura A 1990 Isolation of a neuropeptide corresponding to the N-terminal 27 residues of the pituitary adenylate cyclase activating polypeptide with 38 residues (PACAP₃₈). Biochem Biophys Res Commun 170:643–648[CrossRef][Medline]
4. Arimura A, Shioda S 1995 Pituitary adenylate cyclase polypeptide (PACAP) and its receptors: neuroendocrine and endocrine interaction. Front Neuroendocrinol 16:53–88[CrossRef][Medline]
5. Arimura A, Somogyvari-Vigh A, Miyata A, Mizuno K, Coy DH, Kitada C 1991 Tissue distribution of PACAP as determined by RIA: highly abundant in the rat brain and testes. Endocrinology 129:2787–2789[Abstract]
6. Masuo Y, Suzuki N, Matsumoto H, Tokito F, Matsumoto Y, Tsuda M, Fujino M 1993 Regional distribution of pituitary adenylate cyclase activating polypeptide (PACAP) in the rat central nervous system as determined by sandwich-enzyme immunoassay. Brain Res 602:57–63[CrossRef][Medline]
7. Chang JY, Korolev VV, Wang JZ 1996 Cyclic AMP and pituitary adenylate cyclase-activating polypeptide (PACAP) prevent programmed cell death of cultured rat cerebellar granule cells. Neurosci Lett 206:181–184[CrossRef][Medline]
8. Carlsson PO, Ostenson CG, Efendic S, Langel U, Jansson L 1996 Pituitary adenylate cyclase activating polypeptide (PACAP) redistributes the blood within the pancreas of anesthetized rats. Regul Pept 63:123–128[CrossRef][Medline]
9. Ogi K, Kimura C, Onda H, Arimura A, Fujino M 1990 Molecular cloning and characterization of the cDNA for the precursor of rat pituitary adenylate cyclase-activating polypeptide (PACAP). Biochem Biophys Res Commun 173:1271–1279[CrossRef][Medline]
10. Kimura C, Ohkubo S, Ogi K, Hosoya M, Itoh Y, Onda H, Miyata A, Jiang L, Dahl RR, Stibbs HH, Arimura A, Fujino M 1990 A novel peptide which stimulates adenylate cyclase: molecular cloning and characterization of the ovine and human cDNAs. Biochem Biophys Res Commun 166:81–89[CrossRef][Medline]
11. Okazaki K, Itoh Y, Ogi K, Ohkubo S, Onda H 1995 Characterization of murine PACAP mRNA. Peptide 16:1295–1299[CrossRef][Medline]
12. Ohkubo S, Kimura C, Ogi K, Okazaki K, Hosaya M, Onda H, Miyata A, Arimura A, Fujino M 1992 Primary structure and characterization of the precursor to human pituitary adenylate cyclase activating polypeptide. DNA Cell Biol 11:21–30[Medline]
13. Chartrel N, Tonon MC, Vaudry H, Conlon JM 1991 Primary structure of frog pituitary adenylate cyclase-activating polypeptide (PACAP) and effects of ovine PACAP on frog pituitary. Endocrinology 129:3367–3371[Abstract]
14. Yasuhara T, Mizuno K, Somogyvari-Vigh A, Komaki G, Arimura A 1992 Isolation and primary structure of chicken PACAP. Regul Pept 37:326 (Abstract)[CrossRef]
15. Montero M, Yon L, Rousseau K, Arimura A, Fournier A, Dufour S, Vaudry H 1997 Distribution, characterization, and hypophysiotropic activity of PACAP in the European eel Anguilla anguilla. Regul Pept 71:123 (Abstract)
16. Parker DB, Coe IR, Dixon GH, Sherwood NM 1993 Two salmon neuropeptides encoded by one brain cDNA are structurally related to members of the glucagon superfamily. Eur J Biochem 215:439–448[Medline]
17. McRory JE, Parker DB, Ngamvongchon S, Sherwood NM 1995 Sequence and expression of cDNA for pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH)-like peptide in catfish. Mol Cell Endocrinol 108:169–177[CrossRef][Medline]
18. Parker DB, Power ME, Swanson P, Rivier J, Sherwood NM 1997 Exon skipping in the gene encoding pituitary adenylate cyclase-activating polypeptide in salmon alters the expression of two hormones that stimulate growth hormone release. Endocrinology 138:414–423[Abstract/Free Full Text]
19. McRory J, Sherwood NM 1997 Two protochordate genes encode pituitary adenylate cyclase-activating polypeptide and related family members. Endocrinology 138:2380–2390[Abstract/Free Full Text]
20. Convineau A, Rouyer-Fessard C, Darmoul D, Maoret JJ, Carrero I, Ogier-Denis E, Laburthe M 1994 Human intestinal VIP receptor: cloning and functional expression of two cDNA encoding proteins with different N-terminal domains. Biochem Biophys Res Commun 200:769–776[CrossRef][Medline]
21. Lutz EM, Sheward WJ, West KM, Morrow JA, Fink G, Harmar AJ 1993 The VIP2 receptor: molecular characterization of a cDNA encoding a novel receptor for VIP. FEBS Lett 334:3–8[CrossRef][Medline]
22. Rawlings SR, Hezareh M 1996 Pituiaty adenylate cyclase activating polypeptide (PACAP) and PACAP/vasoactive intestinal polypeptide receptors: actions on the anterior pituitary gland. Endocr Rev 17:4–29[CrossRef][Medline]
23. Koves K, Arimura A, Somogyvari-Vigh A, Vigah S, Miller J 1990 Immunohisto-chemical demonstration of a novel hypothalamic peptide, pituitary adenylate cyclase-activating polypeptide, in the ovine hypothalamus. Endocrinology 127:264–271[Abstract]
24. Dow RC, Bennie J, Fink G 1994 Pituitary adenylate cyclase-activating polypeptide-38 (PACACP38) is released into hypophysial portal blood in the male and female rat. J Endocrinol 142:R1–R4
25. Hart GR, Gowing H, Burrin JM 1992 Effects of a novel hypothalamic peptide, pituitary adenylate cyclase-activating polypeptide, on pituitary hormone release in rats. J Endocrinol 134:33–41[Abstract/Free Full Text]
26. Propato-Mussafiri R, Kanse SM, Ghatei MA, Bloom SR 1992 Pituitary adenylate cyclase activating polypeptide releases 7B2, adenocorticotropin, growth hormone, and prolactin from the mouse and rat clonal pituitary cell lines AtT-20 and GH₃. J Endocrinol 132:107–113[Abstract/Free Full Text]
27. Goth MI, Lyons CE, Canny BJ, Thorner MO 1992 Pituitary adenylate cyclase activating polypeptide, growth hormone (GH)-releasing peptide and GH-releasing hormone stimulate GH release through distinct pituitary receptors. Endocrinology 130:939–944[Abstract]
28. Murakami Y, Koshimura K, Yamauchi K, Nishiki M, Tanaka J, Furuya H, Miyake T, Kato Y 1995 Pituitary adenylate cyclase activating polypeptide (PACAP) stimulates growth hormone release from GH3 cells through type II PACAP receptor. Regul Pept 56:35–40[CrossRef][Medline]
29. Jarry H, Leonhardt S, Schmidt WE, Creutzfeldt W, Wuttke W 1992 Contrasting effects of pituitary adenylate cyclase activating polypeptide (PACAP) on in vivo and in vitro prolactin and growth hormone release in male rats. Life Sci 51:823–830[CrossRef][Medline]
30. Sawangjaroen K, Curlewis JD 1994 Effects of pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP) on prolactin, luteinizing hormone and growth hormone secretion in the ewe. J Neuroendocrinol 6:549–555[Medline]
31. Chiodera P, Volpi R, Capretti L, Caffarri G, Magotti MG, Coiro V 1996 Effects of intravenously infused pituitary adenylate cyclase-activating polypeptide on adenohypo-physeal hormone secretion in normal men. Neuroendocrinology 64:242–246[Medline]
32. Kah O, Anglade I, Lepretre E, Dubourg P, De Monbrison D 1993 The reproductive brain in fish. Fish Physiol Biochem 11:85–98[CrossRef]
33. Peter RE, Yu KL, Marchant TA, Rosenblum PM 1990 Direct neural regulation of the teleost adenohypophysis. J Exp Zool [Suppl] 4:84–98
34. Peng C, Peter RE 1997 Neuroendocrine regulation of growth hormone secretion and growth in fish. Zool Stud 36:79–89
35. Chang JP, Cook H, Freeman GL, Wiggs AJ, Somoza GM, De Leeuw R, Peter RE 1990 Use of a pituitary cell dispersion method and primary culture system for the studies of gonadotropin-releasing hormone action in the goldfish, Carassius auratus. I. Initial morphological, static, and cell column perifusion studies. Gen Comp Endocrinol 77:256–273[CrossRef][Medline]
36. Marchant TA, Fraser RA, Andrews PC, Peter RE 1987 The influence of mammalian and teleost somatostatins on the secretion of growth hormone from goldfish (Carassius auratus L) pituitary fragments in vitro. Regul Pept 17:41–52[CrossRef][Medline]
37. Chow BKC 1997 The goldfish vasoactive intestinal polypeptide receptor: functional studies and tissue distribution. Fish Physiol Biochem 17:213–222[CrossRef]
38. Chow BKC 1995 Molecular cloning and functional characterization of a human secretin receptor. Biochem Biophys Res Commun 212:204–211[CrossRef][Medline]
39. Takahashi K, Totsune K, Murakami O, Satoh F, Sone M, Ohneda M, Sasano H, Mouri T 1994 Pituitary adenylate cyclase activating polypeptide (PACAP)-like immunoreactivity in human hypothalamus: co-localization with arginine vasopressin. Regul Pept 50:267–275[CrossRef][Medline]
40. Koves K, Molnar J, Kantor O, Gorcs TJ, Lakatos A, Arimura A 1995 New aspects of the neuroendocrine role of PACAP. Ann NY Acad Sci 805:648–654[Medline]
41. Vigh S, Arimura A, Gottschall PE, Kitada C, Somogyvari-Vigh A, Childs GV 1993 Cytochemical characterization of anterior pituitary target cells for the neuropeptide, pituitary adenylate cyclase activating polypeptide (PACAP) using biotinylated ligands. Peptides 14:59–65[CrossRef][Medline]
42. Habibi HR, Peter RE, Nahorniak CS, De L Milton RC, Millar RP 1992 Activity of vertebrate gonadotropin-releasing hormones and analogs with variant amino acid residues in positions 5, 7, and 8 in the goldfish pituitary. Regul Pept 37:271–284[CrossRef][Medline]
43. Wong AOL, Chang JP, Peter RE 1992 Dopamine stimulates growth hormone release from the pituitary of goldfish, Carassius auratus, through the dopamone D1 receptors. Endocrinology 130:1201–1210[Abstract]
44. Trudeau VL, Somoza GM, Nahorniak CS, Pet