Endocrinology Vol. 139, No. 7 3202-3209
Copyright © 1998 by The Endocrine Society
Bidirectional Transcription Regulation of Glial Fibrillary Acidic Protein by Estradiol in Vivo and in Vitro1
David J. Stone,
Yubei Song,
Christopher P. Anderson,
Knut K. Krohn,
Caleb E. Finch and
Irina Rozovsky
Andrus Gerontology Center and Department of Biological Sciences,
University of Southern California (D.J.S., Y.S., C.P.A., C.E.F., I.R.),
Los Angeles, California 90089-0191; Medical Department III, University
of Leipzig (K.K.K.), D-04103, Leipzig, Germany
Address all correspondence and requests for reprints to: Dr. David J. Stone, Andrus Gerontology Center and Department of Biological Sciences, University of Southern California, Los Angeles, California 90089-0191. E-mail: dstone{at}almaak.usc.edu
 |
Abstract
|
|---|
Glial fibrillary acidic protein (GFAP) expression shows cyclic
variation in the rat hypothalamus and hippocampus during the normal
estrous cycle. To elucidate the role of transcription in the regulation
of GFAP, we examined levels of GFAP intron 1 by in situ
hybridization in the hypothalamus and hippocampus of normal, cycling
rats. On the afternoon of proestrus, when plasma estradiol levels are
highest, GFAP transcription and messenger RNA were both increased in
the arcuate nucleus of the hypothalamus and decreased in the outer
molecular layer of the dentate gyrus. In the hilus of the hippocampus,
neither GFAP transcription nor messenger RNA changed during the estrous
cycle. In vitro, astrocytes showed bidirectional
responses, such that estradiol treatment increased GFAP transcription
in monotypic astrocytic cultures but decreased GFAP transcription in
astrocytes cocultured with neurons. The functionality of an estrogen
response element in the 5'-upstream region of the GFAP promoter was
established by site-directed mutagenesis and binding of human
recombinant estrogen receptor in gel shift assays. We conclude that
estrogen may act directly upon astrocytes by estrogen receptor binding,
and that the direction of the transcriptional response is influenced by
astrocyte-neuron interactions.
 |
Introduction
|
|---|
IN THE hypothalamus, modulation of
neurosecretion of GnRH by estrogen is subject to changes in glial
fibrillary acidic protein (GFAP) that modify astrocyte-neuron
interactions (1, 2). However, the mechanisms underlying this process
are not completely understood. In the arcuate nucleus of the
hypothalamus, GFAP expression varies cyclically during the normal
estrous cycle, with messenger RNA (mRNA) elevated on proestrus (3) and
protein increased 12 h later on estrus (4). These cyclic
variations in GFAP levels may mediate the preovulatory surge of GnRH.
Before the LH surge, there are decreases in perikaryal membrane in
contact with presynaptic terminals and synapse number in the arcuate
nucleus (1). It has been suggested that these synapses are primarily
inhibitory (2, 5). The decreased number of contacts is hypothesized to
be an integral step in a cascade that results in disinhibition and
increased neurosecretion by GnRH neurons. Astrocytes are implicated in
this process, because the decrease in synapse number is associated with
an increase in the amount of perikaryal membrane covered by
GFAP-positive astrocytic processes (1). Treatment with antiestrogens
blocks both the drop in synapse number and the LH surge (2).
The hippocampus shows similar transient synaptic remodeling across the
estrous cycle, in which there is a gradual increase in both dendritic
spine density and synapses on dendritic spines in CA1 pyramidal
neurons, followed by a rapid decrease during the 24 h between
proestrus and estrus (6, 7). Although GFAP levels vary cyclicly in the
hippocampus as well, there are obvious differences. Most strikingly,
GFAP immunoreactivity in the hilus of the hippocampus is significantly
increased on the afternoon of proestrus (8), 12 h before peak GFAP
immunoreactivity in the hypothalamus. This suggests differential
regulation of GFAP transcription by 17ß-estradiol
(E2) in different brain regions.
To further elucidate the role of E2 in regulation
of GFAP, we examined several aspects of GFAP transcription. Regional
differences in transcription were examined in vivo by
in situ hybridization with an intron probe with which we
have observed transcriptional regulation of GFAP by glucocorticoids (9)
and increases in transcription with age (10). We also examined the
effects of astrocyte-neuron interactions on
E2-mediated GFAP transcription, because the
direction of the effect of glucocorticoids on GFAP transcription is
influenced by astrocyte-neuron interactions (9), and because the effect
of E2 on another astrocytic mRNA (apolipoprotein
E) is dependent upon cell-cell interactions (11). Finally, because
estrogen receptor (ER
) mRNA has been detected in astrocytes (12),
the role of a putative estrogen response element (ERE) in the GFAP
promoter was studied by site-directed mutagenesis and ER
binding.
 |
Materials and Methods
|
|---|
Animals
Three-month-old female F344 rats (n = 50) were kept on a
12-h light, 12-h dark schedule (lights on at 0700 h, lights off at
1900 h). Vaginal cytology in vaginal lavages (1000 h) were followed for
1 month to determine regularly cycling animals, of which a total of 36
were selected for study. Animals were killed at one of four cycle
stages (diestrous morning, proestrous morning, proestrous evening, or
estrous morning) between 10001200 h (morning) or between 17301830 h
(evening). After death (by decapitation under nembutal anesthesia),
brains were frozen in isopentane (-18 C) and stored at -70 C until
sectioning (16 µm); coronal sections 2.8 mm posterior to bregma
allowed simultaneous examination of the arcuate nucleus, dentate gyrus,
and hilus. Sections were mounted on polylysine-coated slides.
LH assay
Trunk blood was collected immediately after decapitation for LH
assay. LH levels were measured using the DELFIA rat LH assay (Wallac,
Oy, Finland). Briefly, serum was incubated in streptavidin-coated
plates with europium-(Eu)-labeled and biotinylated antirat LH
antibodies at room temperature. After washing and enhancement,
fluorescence was counted (Wallac 1230 Arcus Fluorometer; courtesy of
Stephanie Griffith, Harbor-University of California-Los Angeles Medical
Center). Rat LH reference preparation (AFP-7187B) was obtained from the
National Hormone and Pituitary Program (NIDDK, Bethesda, MD). Blood LH
levels were transiently increased 30-fold on proestrous evening
(P < 0.0001), suggesting that proestrous evening rats
were killed after the elaboration of glial processes and the decrease
in synapse number, as these precede the LH surge (2).
In situ hybridization
Sections were fixed in 4% buffered paraformaldehyde, washed in
PBS, and dehydrated in an ethyl alcohol series (30100%). Sections
were prehybridized for 1 h at 55 C (prehybridization buffer: 0.75
M NaCl, 50% formamide, 10% dextran sulfate, and 0.05
M phosphate, pH 7.4) and hybridized with a
35S-labeled complementary RNA (cRNA) probe (9, 10).
Antisense 35S-labeled cRNA was transcribed from the
pBluescript transcription vector containing the 0.9-kb rat GFAP intron
I or 2.7 kb of rat GFAP complementary DNA including coding and
3'-untranslated region. Sections were hybridized for 3 h at 55 C
(mRNA probe) or for 18 h at 50 C (intron probe). Slides were then
covered with NTB2 emulsion (Eastman Kodak, Rochester, NY) and exposed
for 1 week (mRNA) or 3 weeks (intron) for cellular analysis. After
development, slides were counterstained with cresyl violet. Grain
density per cell was measured by computer videodensitometry for the 10
cells that most clearly had signal higher than background in the
arcuate nucleus, hilus, and outer molecular layer of the dentate gyrus
for each brain (see Fig. 1
). Background
measurements came from quantification of unlabeled cells. Unlabeled
cells had a signal intensity less than 1% of labeled cells. A detailed
analysis of frequency distributions of signal intensity for all regions
is in preparation.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 1. GFAP intron 1 in situ hybridization
signal in the arcuate nucleus of the hypothalamus (A and B) and in the
outer molecular layer of the dentate gyrus (C and D) during the rat
estrous cycle. In the hypothalamus, GFAP intron 1 hybridization signal
is higher on proestrus evening (B; when plasma E2 levels
are high) than on diestrus (A). In contrast, in the hippocampus, GFAP
intron 1 levels are lower on proestrous evening (C) than on estrus (D),
when E2 levels are reduced. Boxes localize
the areas where grain density was analyzed. Magnification, x100. High
power micrographs show cellular localization for intron 1 (E) and mRNA
(F) hybridization signals in arcuate nucleus. Magnification, x1000.
|
|
Cell culture
Mixed glia were isolated from the cerebral cortex after
mechanical dissociation (13) from 1- to 3-day-old F344 rat pups. Cells
were plated onto plastic culture dishes at 2 x 105
cell/cm2 and maintained in DMEM-Hams F-12 culture medium
(Mediatech, Herndon, VA) supplemented with 10% FBS (Life Technologies,
Grand Island, NY), 100 U/ml penicillin, and 50 U/ml streptomycin (Sigma
Chemical Co., St. Louis, MO) at 37 C in a 5% CO2-95% air
incubator. Medium was renewed every 23 days until confluence.
Confluent cultures were purified from containing microglia by shaking;
the purity of monotypic cultures was confirmed (>99%) by
immunohistochemical staining (9). Primary neurons were derived from the
cerebral cortex of 18-day-old embryos. After mechanical dissociation, 5
million neurons were plated on the bed layer of confluent astrocytes
(15 million cells/flask) and maintained in mixed sandwich cocultures
for 58 days in serum-free, chemically defined medium (9). Pure
astrocyte cultures or astrocyte-neuron cocultures were treated with
E2 (Sigma) for 24 h in serum-free, phenol
red-free medium.
Northern blot hybridization
Total RNA was extracted from cell culture using Tri-Reagent
(Molecular Research Center, Cincinnati, OH). Total RNA (5 mg) was
electrophoresed on a 1% denaturing agarose gel (0.66 M
formaldehyde) and transferred to nylon membranes. Membranes were
hybridized with a [32P]GFAP cRNA probe (9) in buffer
(50% formamide, 1.5 x SSPE (0.15 M NaCl, 1
mM EDTA, 11.5 mM
NaH2PO4, pH 7.4) 1% SDS, 0.5% powdered milk,
0.1 mg/ml yeast RNA, and 0.3 mg/ml single stranded DNA) for 12 h
at 54 C, followed by high stringency washing [0.2 x SSC
(standard saline citrate)-0.2% SDS; 73 C]. Membranes were placed
against PhosphorImager exposure cassettes, from which relative
radioactivity of bands was analyzed with a PhosphorImager system
(Molecular Dynamics, Sunnyvale, CA).
Transfection of primary astrocyte cultures
Rat GFAP promoter constructs with a luciferase reporter (9) were
transiently transfected into pure astrocyte cultures and
astrocyte-neuron cocultures by lipofection using the DOTAP transfection
reagent (Boehringer Mannheim, Mannheim, Germany). Eighteen hours
after transfection, the culture medium was changed. Twenty-four hours
later, transfected cells were treated with E2 (final
concentration, 1 pM) in serum-free, phenol red-free medium
and lysed after an additional 24 h. Transfection efficiency was
assayed by cotransfection with a simian virus 40 promoter-driven
ß-galactosidase gene (pSV-ß-galactosidase control vector, Promega,
Madison, WI). Luciferase activity was measured in cell lysates by the
luciferase assay system (Promega). The activity was normalized to total
protein with the Coomassie protein assay (Pierce, Rockford, IL) and
ß-galactosidase (Promega). Data were expressed as a percentage of the
vehicle-treated control value (mean ± SEM).
GFAP promoter luciferase constructs
Some 1.9 kb of the GFAP 5'-upstream region were excised from
BSSK (Stratagene, La Jolla, CA) using KpnI and
XbaI sites of the cloning cassette. After directional
subcloning into the KpnI and NheI sites of the
pGL3 Basic plasmid (Promega), the insert was confirmed by
sequencing.
GFAP promoter constructs were cloned into pGL3 Basic (Fig. 4
).
Construct A contains the full 1.9-kb 5'-upstream sequence. The other
constructs result from consecutive deletions of the GFAP 5'-upstream
sequence (Fig. 4A
, numbering according to the transcription start
site). Fragments were cut out using internal restriction sites (Fig. 4A
) in combination with KpnI, SmaI, and
ApaI sites in the pGL3 basic vector. Cut sites were blunt
ended using T4 DNA polymerase and religated. Fragment A8 was
constructed using one of the internal XhoII sites in
combination with Bgl2 in the pGL3 basic vector and religated
into the pGL3 basic vector cut with Bgl2.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 4. GFAP transcription is controlled by
E2. Role of ERE1 in the rat GFAP promoter. A,
E2 responses of the full-length promoter and several
deleted constructs (A1A7). Construct A contains the full 1.9-kb
5'-upstream sequence. All other constructs result from the consecutive
deletions of construct A (numbering according to the transcription
start site). These fragments were cut out using internal restriction
sites in combination with SmaI and
HindIII sites in the PGL-3 basic vector, blunt ended
using T4 DNA polymerase, and religated. Primary astrocyte cultures were
transfected with full-length and deleted constructs of the rat GFAP
promoter; 48 h later, cell were treated with 1 pM
E2 for 24 h in serum-free, phenol red-free medium.
Luciferase activity was normalized to total cellular protein and
ß-galactosidase to control for transfection efficiency. Data
(mean ± SEM of three independent experiments) are
expressed as a percentage of the untreated control value. *,
P < 0.05, by ANOVA. B, The ERE1
sequence in the A3 construct of the rat GFAP promoter was mutated by
site-directed mutagenesis (see Materials and Methods).
This mutation abolished the E2-mediated increase in GFAP
transcription. WT ERE1, Astrocytes transfected with
wild-type A3; mERE1, astrocytes transfected with mutated
A3. Luciferase activity was normalized to total cellular protein and
ß-galactosidase to control for transfection efficiency. Data
(mean ± SEM) are expressed as a percentage of the
value in untreated cells transfected with WT or mERE A3 constructs,
respectively. *, P < 0.05, by ANOVA. C, Labeled
32-bp DNA containing the putative ERE1 site in the GFAP
promoter was incubated with human recombinant ER or BSA as a
control. Complexes of ER protein and DNA were resolved on a
polyacrylamide gel. Unlabeled 32-bp DNA containing wild-type
ERE1 or mERE1 was used as a competitor in the
binding reaction to demonstrate that ER binds DNA specifically. Lane
1, BSA control; lane 2, no competitor; lanes 36, wild-type DNA that
at equal molar and higher concentrations effectively reduced the
labeled ER protein/DNA complex; lanes 710, mERE1. In
contrast to the wild-type DNA, the mutated oligonucleotide was a much
less effective competitor for binding of ER . Competitors were used
in a concentration range from 2- to 100-fold.
|
|
Site-directed mutations in ERE1 were introduced
into fragment A3 by standard PCR (30 cycles). Briefly, two PCR primers
were used: mutated, 5'-CCTTGACTCTGTGTTCAGTAGCCTTGGTGGGG-3'; and
reversed, 5'-GTTTCCTGTGAACACCAGCCTG-3'. The wild-type A3 sequence was
used as a template. PCR products were gel purified, religated, and
verified by sequencing. The sequence of ERE consensus in frog and chick
vitellogenin (14) is GGTCA nnn TGACC. The ERE1 in
GFAP promoter (at -149 bp) is GGGTA cag TGACC. The mutated sequence is
GTGTT cagTAGCC.
Gel shift
Two complementary 32-bp oligonucleotides were synthesized using
an Applied Biosystems DNA synthesizer (Foster City, CA): wild-type
containing the putative ER-binding site (ERE1)
found in the rat GFAP promoter
(CCTTGACTCTGGGTACAGTGACCTTGGTGGGG, coordinates
-172 to -141), and ERE mutant (CCTTGACTCTGTGTTCAG
TAGCCTTGGTGGGG). Underlining = mutation site of
ERE. Double-stranded oligomers were constructed by annealing
complementary DNA in saline-Tris-EDTA after heating to 95 C for 5 min
and cooling slowly to 4 C. The wild-type DNA fragment was then labeled
using [32P]deoxy-ATP in a polynucleotide transferase
reaction. Human recombinant ER (functionally active ER
; 6.25
pM; Panvera, Madison, WI) were incubated in binding buffer
[10 mM HEPES (pH 7.9), 2 mM MgCl2,
50 mM KCl, 1 mM EDTA, 5 mM
dithiothreitol, 10% glycerol, 0.1% Nonidet P-40, 200 mg BSA/ml, and
0.2 mM phenylmethylsulfonylfluoride] with 0.12
pM labeled wild-type DNA and 0.0612 pM
wild-type or mutant competitor DNA without radioactive label. Twenty
minutes later, samples were loaded on a 20-cm, low cross-link, 8%
polyacrylamide gel while running at 150 V at 4 C. The gel was run at
350 V for 4 h, dried, exposed to a phosphorimaging screen, and
analyzed using ImageQuant software (Molecular Dynamics).
Statistics
Data were analyzed by ANOVA, and statistical significance in
pairwise comparisons between means was assessed with Dunnetts
post-hoc tests. All statistics were run on either StatView
4.5 or SuperANOVA (both from Abacus Concepts, Berkeley, CA).
 |
Results
|
|---|
GFAP intron 1 and mRNA expression in hypothalamus and hippocampus
during the estrous cycle
GFAP intron and mRNA levels were quantified by in situ
hybridization (grains per cell for the 10 cells most clearly labeled
above background per region) in the arcuate nucleus of the hypothalamus
(Fig. 1
, A and B), the outer molecular layer of the dentate gyrus (Fig. 1
, C and D), and the hilus of the hippocampal formation. In the arcuate
nucleus, both GFAP intron (Fig. 2A
) and
mRNA (Fig. 2B
) were increased (by 1.7- to 3-fold) on the afternoon of
proestrus, after the LH surge. In contrast, in the outer molecular
layer of the dentate gyrus, GFAP intron and mRNA were decreased
(3040%) on the afternoon of proestrus (Fig. 2
, C and D); here, the
ascending phase of mRNA levels lagged slightly behind intron levels. In
the hilus, where GFAP protein levels respond to estrogen and
progesterone (8) no changes in either intron or mRNA levels were
detected during the estrous cycle (Fig. 2
, E and F).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. In situ hybridization analysis of
GFAP intron 1 (A, C, and E) and GFAP mRNA (B, D, and F) levels in the
arcuate nucleus of the hypothalamus (A and B), the outer molecular
layer of the dentate gyrus (C and D), and the hilus (E and F) during
the rat estrous cycle. In all areas, grain density was calculated on
the 10 cells most clearly labeled above background levels per region in
each rat (n = 36; 9/time point). In the hypothalamus, both GFAP
intron and mRNA levels were significantly higher on proestrous evening
than on diestrus (P < 0.05; (A and B), whereas in
the outer molecular layer of the dentate gyrus, both GFAP intron and
mRNA were significantly lower on proestrous evening than on diestrus
(P < 0.05; C and D). However, in the hilar region
of the hippocampus, neither GFAP intron nor mRNA levels changed during
the estrous cycle (E and F). Data (mean ± SEM) are
expressed as a percentage of the value on diestrus.
|
|
E2-mediated responses of GFAP transcription
and mRNA are influenced by the presence of neurons
Previously, we showed that cell-cell interactions can influence
the direction and degree of astrocytic mRNA response to
E2 (11). We, therefore, examined the effect of
estrogen on GFAP transcription in astrocytes both in monotypic culture
and when cocultured with cerebral cortex neurons. In monotypic culture,
astrocytes responded to E2 with a 2-fold increase
in GFAP mRNA levels at 24 h (Fig. 3A
; dose-response curve), whereas in the
presence of neurons GFAP mRNA was decreased by 50% when treated with 1
pM E2 (Fig. 3B
).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 3. E2 effect on GFAP mRNA and
transcription in pure astrocyte cultures and in astrocyte-neuron
cocultures. A, GFAP mRNA 24 h after treatment of pure astrocyte
cultures with various concentrations of E2 in serum-free,
phenol red-free medium. B, In contrast to the E2-mediated
increase in GFAP mRNA in pure astrocyte cultures, 24-h treatment of
astrocyte-neuron cocultures with 1 pM E2
resulted in a decrease in GFAP mRNA. Total cellular RNA was analyzed by
Northern blot hybridization with the GFAP cRNA probe. Data (mean
± SEM of three independent experiments) of integrated
optical densities are expressed as a percentage of the untreated control value. *,
P < 0.05. C, Pure astrocytes or astrocyte-neuron
cocultures were transfected with full-length GFAP promoter; 48 h
later, cells were treated with 1 pM E2 for
24 h in serum-free, phenol red-free medium. Luciferase activity
was normalized to total cellular protein and ß-galactosidase to
control for transfection efficiency. GFAP promoter was not active when
transfected into neurons. Data (mean ± SEM of three
independent experiments) are expressed as a percentage of the untreated
control value. *, P < 0.05, by ANOVA (Abacus
Concepts).
|
|
These findings were extended to GFAP promoter activity.
Astrocytes in pure culture or cocultured with neurons were transfected
with a 1.9-kb full-length GFAP promoter construct (Fig. 4A
), which suffices for transcriptional
regulation by glucocorticoids (9) and contains two putative EREs.
Transfected cells were treated with 1 pM
E2 for 24 h. As was observed for mRNA
levels, the full-length promoter showed an
E2-mediated increase in activity in pure
astrocytic cultures. When cocultured with neurons, the direction of the
response to E2 was reversed from induction to
inhibition of promoter activity (Fig. 3C
). The sex of neonatal rats
from which astrocytes were derived did not alter the direction of the
GFAP response to E2 (data not shown).
GFAP promoter construct analysis: role of
ERE1 in the rat GFAP promoter
Using sequential deletions in the GFAP promoter (see
Materials and Methods and Fig. 4A
), we examined the activity
of putative EREs. ERE1 is contained in construct
A3, whereas ERE2 is contained only within the
full-length promoter and deleted in construct A7. Constructs A1
(minimal promoter) and A2 (-106 bp) that do not contain ERE sequence
did not respond to E2. However, in longer
constructs (A3 to construct A7, which contain
ERE1), GFAP transcription was induced by
E2, which suggests that
ERE1 in the rat GFAP promoter is functional.
Moreover, constructs A3A7 showed consistently greater responses to
E2 (1.6- to 1.8-fold) than the full-length
promoter (1.4-fold). Thus, ERE2 and/or other
sequences that are upstream of -1546 bp may inhibit the activity of
ERE1.
Site-directed mutagenesis of ERE1 within the A3 construct
(4 bp; see Materials and Methods) and ER
gel shift assays
further show the functionality of ERE1. The
E2-mediated activation of the GFAP promoter was
abolished by mutation of ERE1 in the A3 construct
transfected into cultured astrocytes (Fig. 4B
).
The binding of ER
to the ERE1 site in the GFAP promoter
was assayed by gel shift. Oligonucleotide (32 bp) containing the
putative ERE1 site in the GFAP promoter was incubated with
human recombinant ER
or BSA for a control. Complexes of ER
protein and DNA were resolved on a polyacrylamide gel (Fig. 4C
).
Unlabeled 32-bp DNA containing wild-type ERE1 or mutated
oligonucleotide DNA (mERE1; containing a 4-bp mutation in
the putative ERE1-binding site; see Materials and
Methods) was used as a competitor in the binding reaction to
demonstrate that ER
binds DNA specifically. Wild-type DNA at
equimolar and higher concentrations effectively competed for the
labeled ER
protein/DNA complex (Fig. 4C
, lanes 36).
mERE1 competed less effectively for binding of ER
(Fig. 4C
, lanes 710). Titration of the competition in a concentration range
from 2- to 100-fold revealed a 11.5-fold higher affinity of the
wild-type DNA for ER
. These results show that ER
protein binds
specifically to the wild-type ERE1-binding site in the GFAP
promoter and that the 4-bp mutations in the ERE1 reduced
the binding of ER
in this competition assay.
 |
Discussion
|
|---|
These data demonstrate that changes in GFAP mRNA expression in
response to E2 are the result of changes in
transcription, in which GFAP intron and mRNA levels follow parallel
trends. However, this coordination does not extend to GFAP protein
levels. In the arcuate nucleus, GFAP immunoreactivity is maximal on
estrus (4), 16 h after the peak we observed in GFAP intron mRNA.
GFAP immunoreactivity is increased on the afternoon of proestrus in the
hilus (8), a region in which no changes in GFAP intron or mRNA were
found during the estrous cycle. These effects of estrogen on GFAP
transcription are region specific, with rates being high in the
hypothalamus but low in the hippocampus on proestrus, when circulating
E2 levels are highest. These results are
consistent with regional differences in sex steroid regulation of GFAP
levels in male rats, in which castration caused GFAP mRNA to increase
in the hippocampus but decrease in the hypothalamus (15). Both
E2 and testosterone were shown to reverse this
effect.
These results give further insight into the effect of estrogen on GFAP
expression in response to brain lesions in the cerebral cortex and
hippocampus. GFAP levels in the hippocampus are increased after
deafferenting entorhinal cortex lesioning (ECL) (16, 17). Castration
also increased GFAP mRNA, and this effect is additive with the effect
of ECL and is reversed by the administration of
E2 or testosterone (15, 18). Moreover, after a
brain stab wound, gonadal steroids (E2,
progesterone, or testosterone) decrease GFAP immunoreactivity at
72 h postlesion up to 2 mm away from the wound (19).
E2 also increases reactive synaptogenesis in
response to ECL (20, 21). Because inhibition of GFAP expression
supports dendritic outgrowth (22), we suggest that decreased GFAP
expression may be one mechanism by which E2
increases reactive synaptogenesis to the dentate gyrus in response to
ECL. How these diverse steroids similarly enhance responses to brain
lesions is very puzzling.
These data also give insight into the mechanism of neuroendocrine
control of the LH surge. Because synaptic retraction in the arcuate
nucleus precedes the LH surge, and because blocking the synaptic
retraction on proestrus also blocks the LH surge (2), astrocyte process
reorganization in the arcuate nucleus could be an early trigger of the
cascade that leads to the LH surge. Estrogenic control of the LH surge,
and thus ovulation, would be mediated by astrocytes through GFAP
transcription as a primary locus of control.
The region-dependent effect of estrogen on GFAP expression parallels
the distribution of ER
and ERß. In the arcuate nucleus, where
estrogen induces GFAP expression, ER
is the prominent ER (23),
whereas in the hippocampus, where estrogen inhibits GFAP expression,
ERß is predominant (24). The number of astrocytes expressing these
receptors in these regions, however, is not known, and it is not clear
which nuclear ER mediates the E2 responses
observed in vivo or in vitro.
E2 regulation of GFAP transcription in
vitro
The induction of GFAP transcription by E2 is
consistent with the presence of two palindromic, ERE sequences in the
upstream region of the rat GFAP promoter: ERE1 (at -149
bp) and ERE2 (at -1830 bp; Fig. 4A
). These EREs differ in
12 bases from the perfect palindrome consensus ERE in the
vitellogenin promoter of frog and chick (14).
We demonstrated the functional significance of ERE1 (at
-149) in the rat GFAP promoter. A 4-bp mutation in ERE1
abolished the E2-mediated increase in GFAP
expression. We also showed that human recombinant ER
protein binds
to the wild-type ERE1-binding site in the GFAP promoter and
that the 4-bp mutation in this putative binding site reduces the
binding of ER
by more than 10-fold. The ERE in the near upstream
region of the human GFAP promoter (at -150 bp) was also cited in an
abstract as functional on the basis of site-directed mutagenesis and
ER
gel shift assays (25). Note that this ERE in the human GFAP
promoter is identical to ERE1 in the rat GFAP promoter
(26). As mentioned previously, ER
has been localized to glial cells
in vitro (12), but ERß may also be involved. Currently, we
are examining the distribution of ER
and ERß in rat brain
astrocytes.
Treatment with E2 induced the greatest increase
in GFAP mRNA at a very low physiological concentration of 1
pM, which approximates plasma E2
levels after ovariectomy. Others also found that 1 pM
E2 is sufficient to induce elaboration of
astrocytic processes (27). The concentration of
E2 in the microenvironment of astrocytes is not
known; however, because E2 levels in CSF are less
than 1/10th of blood levels (28), it is likely that
E2 levels within the brain are lower than those
in the periphery.
Cell-cell interactions and transcriptional inversion
Cell-cell interactions are involved in the regulation of GFAP
transcription by estrogen. Monotypic astrocytes responded to
E2 by induction of both mRNA levels and rates of
transcription as assayed by exogenous rat GFAP promoter activity after
transient transfection. In contrast, coculture of astrocytes with
neurons reversed these responses to inhibition. Similarly, the
transcriptional response of GFAP to glucocorticoids was inverted from
positive to negative by the presence of neurons in cocultures (9), the
latter of which was the direction of in vivo
glucocorticoid-induced responses throughout the brain (29). The ability
of neurons to alter the estrogen response in astrocytes is also region
dependent. Hypothalamic glial cells in culture responded to
E2 treatment with increases in
GFAP-immunoreactive processes when cocultured with hypothalamic
neurons, but not when in monotypic culture. However, coculture with
cerebellar neurons failed to change the estrogen response of
hypothalamic astrocytes from that of monotypic cultures (30).
In vivo, GFAP transcription is subject to both negative and
positive physiological influences by hormones and cytokines (this
report and Ref. 26). The ability of neurons in vitro to
switch the direction of E2- and
glucocorticoid-mediated GFAP expression suggests that local changes in
neuronal activities and/or astrocyte-neuron interactions in
vivo could accomplish the same result. Ongoing studies in the lab
implicate a tetra-phorbolacetate response element sequence
(AP-1-binding site) in the transcriptional inversion induced by both
E2 and glucocorticoids (Rozovsky, I., and C.
E. Finch, in preparation). These results are not surprising in light of
recent findings of differential transcriptional activation by the ER
and ERß at AP-1 sites (31), in which ER
activates transcription
and ERß inhibits transcription. The effect of induced mutation of the
AP-1 site in the GFAP promoter on GFAP expression is currently under
investigation in this lab.
 |
Footnotes
|
|---|
1 This work was supported by National Research Service Awards
AG-057660151 (to D.J.S.) and AG-14751 (to C.E.F.). 
Received December 17, 1997.
 |
References
|
|---|
-
Olmos G, Naftolin F, Perez J, Tranque PA,
Garcia-Segura LM 1989 Synaptic remodeling in the rat arcuate
nucleus during the estrous cycle. Neuroscience 32:663667[CrossRef][Medline]
-
Naftolin F, Mor G, Horvath TL, Luquin S, Fajer AB,
Kohen F, Garcia-Segura LM 1996 Synaptic remodeling in the arcuate
nucleus during the estrous cycle is induced by estrogen and precedes
the preovulatory gonadotropin surge. Endocrinology 137:55765580[Abstract]
-
Kohama SG, Goss JR, McNeill TH, Finch CE 1995 Glial fibrillary acidic protein mRNA increases at proestrus in the
arcuate nucleus of mice. Neurosci Lett 184:13[CrossRef][Medline]
-
Garcia-Segura LM, Luquin S, Parducz A, Naftolin F 1994 Gonadal hormone regulation of glial fibrillary acidic protein
immunoreactivity and glial ultrastructure in the rat neuroendocrine
hypothalamus. Glia 10:5969[CrossRef][Medline]
-
Parducz A, Perez J, Garcia-Segura LM 1993 Estradiol induces plasticity of GABAergic synapses. Neuroscience 53:395401[CrossRef][Medline]
-
Woolley CS, McEwen BS 1992 Estradiol mediates
fluctuation in hippocampal spine density during the estrous cycle in
the adult rat. J Neurosci 12:25492554[Abstract]
-
Woolley CS, McEwen BS 1993 Roles of estradiol and
progesterone in regulation of hippocampal dendritic spine density
during the estrous cycle in the rat. J Comp Neurol 336:293306[CrossRef][Medline]
-
Luquin S, Naftolin F, Garcia-Segura LM 1993 Natural fluctuation and gonadal hormone regulation of astrocyte
immunoreactivity in dentate gyrus. J Neurobiol 24:913924[CrossRef][Medline]
-
Rozovsky I, Laping NJ, Krohn K, Teter B, OCallaghan
JP, Finch CE 1995 Transcriptional regulation of glial fibrillary
acidic protein by corticosterone in rat astrocytes in vitro
is influenced by the duration of time in culture and by
astrocyte-neuron interactions. Endocrinology 136:20662073[Abstract]
-
Yoshida T, Goldsmith SK, Morgan TE, Stone DJ, Finch
CE 1996 Transcription supports age-related increases of GFAP gene
expression in the male rat brain. Neurosci Lett 215:107110[CrossRef][Medline]
-
Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Hajian H,
Finch CE 1997 Astrocytes and microglia respond to estrogen with
increased apoE mRNA in vivo and in vitro. Exp
Neurol 143:313318[CrossRef][Medline]
-
Santagati S, Melcangi RC, Celotti F, Martini L, Maggi
A 1994 Estrogen receptor is expressed in different types of glial
cells in culture. J Neurochem 63:20582064[Medline]
-
McCarthy KD, de Vellis J 1980 Preparation of
separate astroglial and oligodendroglial cell cultures from rat
cerebral tissue. J Cell Biol 85:890902[Abstract/Free Full Text]
-
Klein-Hitpass L, Ryffel GU, Heitlinger E, Cato ABC 1988 A 13 bp palindrome is a functional estrogen responsive element and
interacts specifically with estrogen receptor. Nucleic Acids Res 16:647664[Abstract/Free Full Text]
-
Day JR, Laping NJ, Lampert-Etchells M, Brown SA,
OCallaghan JP, McNeill TH, Finch CE 1993 Gonadal steroids
regulate the expression of glial fibrillary acidic protein in the adult
male rat hippocampus. Neuroscience 55:435443[CrossRef][Medline]
-
Poirier J, May PC, Osterburg HH, Geddes J, Cotman C,
Finch CE 1990 Selective alterations of RNA in rat hippocampus
after entorhinal cortex lesioning. Proc Natl Acad Sci USA 87:303307[Abstract/Free Full Text]
-
Steward O, Torre ER, Phillips LL, Trimmer PA 1990 The process of reinnervation in the dentate gyrus of adult rats: time
course of increase in mRNA for glial fibrillary acidic protein. J
Neurosci 10:23732384[Abstract]
-
Day JR, Laping NJ, McNeill TH, Schreiber SS, Pasinetti
G, Finch CE 1990 Castration enhances expression of glial
fibrillary acidic protein and sulfated glycoprotein-2 in the intact and
lesion-altered hippocampus of adult male rat. Mol Endocrinol 4:19952002[CrossRef][Medline]
-
Garcia-Estrada J, Del Rio JA, Luquin S, Soriano E,
Garcia-Segura LM 1993 Gonadal hormones down-regulate reactive
gliosis and astrocyte proliferation after a penetrating brain injury.
Brain Res 628:271278[CrossRef][Medline]
-
Morse JK, DeKosky ST, Scheff SW 1992 Neurotrophic
effects of steroids on lesion-induced growth in the hippocampus. II.
Hormone replacement. Exp Neurol 118:4752[CrossRef][Medline]
-
Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Finch
CE 1998 Increased synaptic sprouting in response to estrogen via
an apoE-dependent mechanism: implications for Alzheimers disease.
J Neurosci 18:31803185[Abstract/Free Full Text]
-
Lefrancois T, Fages C, Peschanski M, Tardy M 1997 Neurite outgrowth associated with astroglial phenotypic changes induced
by antisense glial fibrillary acidic protein (GFAP) mRNA in injured
neuron-astrocyte cocultures. J Neurosci 17:41214128[Abstract/Free Full Text]
-
Shughrue PJ, Komm B, Merchenthaler I 1996 The
distribution of estrogen receptor-ß mRNA in the rat hypothalams.
Steroids 61:678681[CrossRef][Medline]
-
Shughrue PJ, Lane MV, Merchenthaler I 1997 The
comparative distribution of estrogen receptor-
and -ß mRNA in the
rat central nervous system. J Comp Neurol 388:119[CrossRef][Medline]
-
Boncam-Rudloff E, Andersson G, Nister M, Westmark B 1993 Identification of an estrogen-responsive element in the human GFAP
gene. J Cell Biol [Suppl] 17A:152
-
Laping NJ, Teter B, Nichols NR, Rozovsky I, Finch
CE 1994 Glial fibrillary acid protein: regulation by hormones,
cytokines, and growth factors. Brain Pathol 4:259274[Medline]
-
Garcia-Segura LM, Torres-Aleman I, Naftolin F 1989 Astrocytic shape and glial fibrillary acidic protein immunoreactivity
are modified by estradiol in primary rat hypothalamic cultures. Dev
Brain Res 47:298302[CrossRef][Medline]
-
Molnar G, Kassai-Bazsa Z 1997 Gonadotropin, ACTH,
prolactin, sexual steroid and cortisol levels in postmenopausal
womens cerebrospinal fluid (CSF). Arch Gerontol Geriatr 24:269280
-
Laping NJ, Nichols NR, Day JR, Johnson SA, Finch CE 1994 Transcriptional control of hippocampal glial fibrillary acidic
protein and glutamine synthetase in vivo: opposite responses
to corticosterone. Endocrinology 135:19281933[Abstract]
-
Torres-Aleman I, Rejas MT, Pons S, Garcia-Segura LM 1992 Estradiol promotes cell shape changes and glial fibrillary acidic
protein redistribution in hypothalamic astrocytes in vitro:
a neuronal-mediated effect. Glia 6:180187[CrossRef][Medline]
-
Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson JA,
Kushner PJ, Scanlan TS 1997 Differential ligand activation of
estrogen recptors ER
and ERß at AP1 sites. Science 277:15081510[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. Parkash and G. Kaur
Neuronal-glial plasticity in gonadotropin-releasing hormone release in adult female rats: role of the polysialylated form of the neural cell adhesion molecule
J. Endocrinol.,
August 1, 2005;
186(2):
397 - 409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Dhandapani, V. B. Mahesh, and D. W. Brann
Astrocytes and Brain Function: Implications for Reproduction
Experimental Biology and Medicine,
March 1, 2003;
228(3):
253 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Cashion, M. J. Smith, and P. M. Wise
The Morphometry of Astrocytes in the Rostral Preoptic Area Exhibits a Diurnal Rhythm on Proestrus: Relationship to the Luteinizing Hormone Surge and Effects of Age
Endocrinology,
January 1, 2003;
144(1):
274 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Rozovsky, M. Wei, D. J. Stone, H. Zanjani, C. P. Anderson, T. E. Morgan, and C. E. Finch
Estradiol (E2) Enhances Neurite Outgrowth by Repressing Glial Fibrillary Acidic Protein Expression and Reorganizing Laminin
Endocrinology,
February 1, 2002;
143(2):
636 - 646.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Wise, D. B. Dubal, M. E. Wilson, S. W. Rau, and M. Bottner
Minireview: Neuroprotective Effects of Estrogen--New Insights into Mechanisms of Action
Endocrinology,
March 1, 2001;
142(3):
969 - 973.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Dubal, P. J. Shughrue, M. E. Wilson, I. Merchenthaler, and P. M. Wise
Estradiol Modulates bcl-2 in Cerebral Ischemia: A Potential Role for Estrogen Receptors
J. Neurosci.,
August 1, 1999;
19(15):
6385 - 6393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Mong, E. Glaser, and M. M. McCarthy
Gonadal Steroids Promote Glial Differentiation and Alter Neuronal Morphology in the Developing Hypothalamus in a Regionally Specific Manner
J. Neurosci.,
February 15, 1999;
19(4):
1464 - 1472.
[Abstract]
[Full Text]
[PDF]
|
 |
|