| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
and G11 Knockout Mice1
Oregon Regional Primate Research Center (D.S., J.A.J., P.M.C.), Divisions of Neuroscience and Reproductive Science, Beaverton, Oregon 97006; Oregon Health Sciences University (D.S., P.M.C.), Department of Physiology and Pharmacology, Portland, Oregon 97201; University of Wyoming (T.J.), Department of Molecular Biology, Laramie, Wyoming 82071; University of Texas Southwestern Medical Center (T.M.W.), Department of Pharmacology, Dallas, Texas 75235; and California Institute of Technology (S.O.), Pasadena, California 91125
Address all correspondence and requests for reprints to: P. Michael Conn, Oregon Regional Primate Research Center, 505 N.W. 185th Avenue, Beaverton, Oregon 97006-3499.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
[G11 knockout (KO)] or Gq gene
(Gq KO) to examine LH release in response to a
metabolically stable GnRH agonist (Buserelin). Mice homozygous for the
absence of G11 and Gq appear to breed
normally. Treatment of (5 wk old) female KO mice with the GnRH agonist
Buserelin (2 µg/100 µl, sc) resulted in a rapid increase of serum
LH levels (reaching 328 ± 58 pg/25 µl for G11 KO;
739 ± 95 pg/25 µl for Gq KO) at 75 min. Similar
treatment of the control strain, 129SvEvTacfBr for G11 KO
or the heterozygous mice for Gq KO, resulted in an increase
in serum LH levels (428 ± 57 pg/25 µl for G11 KO;
884 ± 31 pg/25 µl for Gq KO) at 75 min. Both
G11 KO and Gq KO male mice released LH in
response to Buserelin (2 µg/100 µl of vehicle; 363 ± 53 pg/25
µl and 749 ± 50 pg/25 µl 1 h after treatment,
respectively). These values were not significantly different from the
control strain. In a long-term experiment, Buserelin was administered
every 12 h, and LH release was assayed 1 h later. In female
G11 KO mice and control strain, serum LH levels reached
approximately 500 pg/25 µl within the first hour, then subsided to a
steady level (
100 pg/25 µl) for 109 h. In male
G11 KO mice and in control strain, elevated LH release
lasted for 13 h; however, LH levels in the G11 KO male
mice did not reach control levels for approximately 49 h. In a
similar experimental protocol, the Gq KO male mice released
less LH (531 ± 95 pg/25 µl) after 13 h from the start of
treatment than the heterozygous male mice (865 ± 57 pg/25 µl),
but the female KO mice released more LH (634 ± 56 pg/25 µl)
after 1 h from the start of treatment than the heterozygous female
mice (346 ± 63 pg/25 µl). However, after the initial LH flare,
the LH levels in the heterozygous mice never reached the basal levels
achieved by the KO mice. G11 KO mice were less sensitive to
low doses (5 ng/per animal) of Buserelin than the respective control
mice. Male G11 KO mice produced more testosterone than the
control mice after 1 h of stimulation by 2 µg of Buserelin,
whereas there was no significant difference in Buserelin stimulated
testosterone levels between Gq KO and heterozygous control
mice. There was no significant difference in Buserelin stimulated
estradiol production in the female Gq KO mice compared with
control groups of mice. However, female G11 KO mice
produced less estradiol in response to Buserelin (2 µg) compared with
control strain. Although there were differences in the dynamics of LH
release and steroid production in response to Buserelin treatment
compared with control groups of mice, the lack of complete abolition of
these processes, such as stimulated LH release, and steroid production,
suggests that these G proteins are either not absolutely required or
are able to functionally compensate for each other. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Multiple G proteins appear to be involved in mediating the response of
the gonadotrope to GnRH (4, 5). GnRH is capable of stimulating IP
release through pertussis toxin-sensitive G proteins, whereas a cholera
toxin-sensitive G protein appears to provoke gonadotrope sensitization
to GnRH and other secretagogues. Immunodepletion studies from T3–1
cell membranes suggest that the GnRH receptor is coupled to
Gq/11 protein (6), and more recently we have shown that
the GnRH receptor regulates Gq/11 in rat pituitary cell
cultures and in GGH3 cells that stably express the GnRH
receptor (7). Stimulation with GnRH also provokes palmitoylation and
redistribution of Gq/11 in primary pituitary cultures
(7, 8).
The Gq subfamily includes Gq,
G11, G14, G15, and
G16 (9). These G proteins are capable of activating
phospholipase C-ß (PLCß) and are unmodified by pertussis toxin (10, 11). Gq and G11 have 88% amino acid
sequence identity (10). In SDS-PAGE, Gq and
G11 migrate at 41–42 kDa (12). Due to the structural
similarities between Gq and G11, it is
technically difficult to discriminate between the two G proteins by
biochemical approaches.
Very few studies are available to attribute a specific activity to
either Gq or G11, and the likelihood
exists that these two proteins functionally compensate for each other.
Studies done on Swiss 3T3 cells, for example, indicate that bombesin
and vasopressin receptors concurrently activate both Gq
and G11 (13), suggesting that, with respect to
phospholipase C-ß activation, these two proteins may function
interchangeably. However, when 1A/D, 1B
and 1C adrenergic receptors are activated by agonists,
Gq and G11 proteins, which are activated
by these receptors, are degraded at a similar rate, an observation
suggesting that the G proteins may couple to these receptors without
any preference (14). Furthermore, in Xenopus oocytes,
Gq and G11 show similar modulation of
response to TSH releasing hormone (15), suggesting that these two
proteins activate similar effectors, although an earlier report in the
same system suggests that the response to TSH-releasing hormone is
differentially coupled to downstream effectors by Gq and
G11 proteins (16).
All of these studies were performed either in transfected cell lines or
in Xenopus oocytes. Therefore, little is known about the G
protein coupling to the GnRH receptor in intact animals, particularly
under endocrine systems with complex feedback mechanisms. To examine
this question with respect to G protein-coupling to the GnRH receptor,
we examined the role of Gq and G11 in the
mouse gonadotrope by using knockout mice, lacking either the
Gq or the G11 protein. This study
provides evidence to suggest that Gq and
G11 proteins can functionally compensate for each other
in GnRH analog stimulated LH release and steroidogenesis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene knockout mice were prepared from 129/SvEv
strain of mice as previously described (Wilkie, T., manuscript
submitted). For control experiments 129/SvEvTacfBR strain of mice
(Taconic Farms, Germantown, NY) were used. Both control mice and
knockout mice were 5 weeks old, and weighed approximately 16–18 g. The
breeding pair of G11 knockout mice were homozygous for
the knockout gene. The weight to age curves, litter size, and other
external characteristics were indistinguishable between 129/SvEvTacfBR
mice and knockout mice. Therefore, we used age-matched 129/SvEvTacfBR
strain as controls.
Preparation of mice lacking the Gq gene
Gq knockout mice were prepared as previously
described (18). Male mice homozygous for the Gq knockout
were mated to female mice heterozygous for the Gq
knockout. Offspring that were heterozygous for the Gq
knockout were used as control mice. The experiments were performed at 5
weeks of age, and at this time, both homozygous and heterozygous
mice for the knockout gene weighed approximately 15–18 g each. The
mice were genotyped at 3 weeks to identify the homozygous knockout mice
in the litter. To keep the variations between the animals to a minimum,
heterozygous mice from the same litter was used as controls.
Heterozygous mice, who have only one functioning Gq
gene, do not show any adverse effects. These mice have weight to age
curves similar to the wild-type mice and were indistinguishable from
the wild-type mice. Thus, heterozygous mice from the same litter were
an appropriate control.
Genotyping of Gq knockout mice
Approximately 0.5 cm size section of the mouse tails were
digested overnight under constant agitation at 50 C in 300 µl of
digestion buffer (100 mM EDTA, 0.5% SDS, 0.5 mg/ml
proteinase K and 50 mM Tris-HCl; pH 8). The digested
samples were spun at 12,000 x g for 2 min, and
200 µl of the supernatant was mixed with 100 µl of 7.5
M ammonium acetate to obtain a final concentration of 2.5
M. Genomic DNA was precipitated by adding 600 µl of ice
cold ethanol and collected at 12,000 x g for 10 min.
The DNA pellet was washed once with 70% ethanol and dried. Finally,
the DNA pellet was dissolved in 300 µl of Tris-EDTA buffer (pH
8).
A 150-bp sequence of the disrupted Gq gene containing
the neomycin gene was amplified by PCR with flanking primers NEO4 (5'
GATTCGCAGCGCATCGCCTTCTAT 3') and QNEO (5' TTCAAAGTATCACACTCACATCACAG
3'). A 150-bp sequence of the wild-type Gq gene was
amplified with the flanking primers 5EXQ (5' GAACCGCATGGAGGAGAGCAAAGC
3') and 3EXQ (5' CTGGGAAGTAG TCGACTAGGTGGG 3'). The PCR protocol used
is as follows: 5 min at 94 C, 35 cycles of 1 min at 94 C, 1 min at 63 C
and 3 min at 72 C, and finally 10 min at 72 C.
Serum collection and LH RIA
Each mouse received 2 µg of Buserelin (GnRH agonist, Hoechst)
in 100 µl of vehicle (PBS/0.3% BSA) or vehicle alone. This is a
saturating dose of Buserelin with respect to LH release (19). For the
dose-response studies, indicated doses of Buserelin in 100 µl of
vehicle was given. Buserelin was injected sc into the skin behind the
neck. Mice were anesthetized with methoxyflurane, and serum collected
at the indicated times by intraorbital puncture. In long time course
experiments, serum was collected 1 h after injection of Buserelin.
Serum was aliquoted and stored at -20 C before assay.
The RIA used a highly purified rat LH for iodination (NIDDK; 20) and a mouse reference preparation obtained as a kind gift from Dr. Al Parlow (Harbor-UCLA Hospital, Torrance, CA). LH antisera (C102) was prepared and characterized as previously described (21). Bound and free proteins were separated using the second antibody technique (22). The minimum detectable dose for the RIA was 6 ± 1 pg (n = 6) and the inter and intraassay variance was less than 10%. The rat and mouse LH standards were approximately identical; the rat ED20 never varied more than 9% from the mouse ED20.
Steroid assays for testosterone and estradiol
Serum estradiol (23, 24) and testosterone (25) levels were
measured by RIA in the ORPRC RIA Laboratory using previously described
methods. Antisera for estradiol (23, 24) and testosterone (25) were
obtained as previously described. For the estradiol assay, the minimum
detectable dose was approximately 0.5 pg. The intra and interassay
variance was approximately 7 and 13%, respectively. For the
testosterone assay, the minimum detectable dose was 5 pg. The intra and
interassay variance was approximately 5 and 8%, respectively.
Statistical analyses
The results are presented as the mean ± SEM of
the indicated number of animals. Data were analyzed by one-way ANOVA,
followed by Student’s t test with Bonferoni correction for
multiple comparisons. To examine the overall LH release in mice over
time, a two-way ANOVA for repeated measures was performed.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, A and B, shows,
respectively, serum LH levels in male and female G11
knockout mice, after an sc injection of 2 µg of Buserelin or vehicle.
Samples were collected at 0, 15, 30, 45, and 75 min after the injection
of drug or the vehicle. In male G11 knockout mice, serum
LH levels increased from 7 ± 2 pg/25 µl (n = 6) to
363 ± 53 pg/25 µl (n = 6), when administered with 2 µg
of Buserelin (Fig. 1A). In the control strain, the same treatment of
Buserelin resulted in an increase of serum LH from 10 ± 1 pg/25
µl (n = 5) to 458 ± 59 pg/25 µl (n = 5).
When treated with the vehicle (PBS/0.1% BSA), the serum LH levels in
male G11 knockout mice and in the male control strain
remained between 7–10 pg/25 µl. In female G11
knockout mice, serum LH levels increased from 6 ± 1 pg/25 µl
(n = 7) to 328 ± 58 pg/25 µl (n = 7), when
administered with 2 µg of Buserelin (Fig. 1B). In the control strain,
the same treatment of Buserelin resulted in an increase of serum LH
from 10 ± 1 pg/25 µl (n = 6) to 428 ± 57 pg/25 µl
(n = 6). LH released in response to Buserelin was not
significantly different (P < 0.05) in both male and
female G11 knockout mice compared with control mice.
When treated with the vehicle (PBS/0.1% BSA), the serum LH levels in
female G11 knockout mice and in female control strain
remained between 6–10 pg/25 µl.
|
, A and B, shows serum LH levels
in mice 1 h after an sc injection of 2 µg of Buserelin given
every 12 h for 108 h. In male G11 knockout
mice, the serum LH levels reached a maximum of 753 ± 29 pg/25
µl (n = 7) after 13 h from the start of treatment (Fig. 2A). In the male control strain, a similar treatment resulted in a
maximum LH level of 507 ± 27 pg/25 µl (n = 6) after
13 h from the start of treatment. After 61 h from the start
of treatment, the serum LH levels in the male G11
knockout mice reached the serum LH level of the control mice. Male
G11 knockout mice released significantly
(P < 0.05) more LH over time than male control mice.
In female G11 knockout mice, the serum LH levels reached
a maximum of 579 ± 88 pg/25 µl (n = 5) after 1 h from
the start of treatment (Fig. 2B). In the female control strain, a
similar treatment resulted in a maximum LH level of 461 ± 45
pg/25 µl (n = 7) after 1 h from the start of treatment. The
serum LH levels in female G11 knockout mice and control
strain were maintained at similar levels after 13 h from start of
treatment. There was no significant (P < 0.05)
differences in LH release over time between the female
G11 knockout mice and female control mice.
|
, A and B, shows, respectively,
the serum LH level in male and female Gq knockout mice
after an sc injection of 2 µg of Buserelin or vehicle. Samples were
collected at 0, 15, 30, 45, and 75 min after the injection of drug or
the vehicle. In male Gq knockout mice, serum LH levels
increased from 8 ± 0 pg/25 µl to 749 ± 50 pg/25 µl
(n = 5), when administered with 2 µg of Buserelin (Fig. 3A). In
the heterozygous strain, the same treatment of Buserelin resulted in an
increase of serum LH from 10 ± 2 pg/25 µl to 765 ± 85
pg/25 µl (n = 5). When treated with vehicle (PBS/0.1% BSA), the
serum LH levels in male Gq knockout mice and in male
control strain remained between 9–10 pg/25 µl (data not shown). In
female Gq knockout mice, serum LH levels increased from
7 ± 0 pg/25 µl to 740 ± 95 pg/25 µl (n = 9),
when administered with 2 µg of Buserelin (Fig. 3B). In the female
heterozygous strain, the same treatment of Buserelin resulted in an
increase of serum LH from 9 ± 1 pg/25 µl to 884 ± 31
pg/25 µl (n = 6). LH released in response to Buserelin was not
significantly different (P < 0.05) in both male and
female Gq knockout mice compared with heterozygous mice.
When treated with the vehicle (PBS/0.1% BSA), the serum LH levels in
female Gq knockout mice and in female heterozygous mice
remained between 9–10 pg/25 µl (data not shown).
|
, A and B, shows serum LH levels
in Gq knockout mice 1 h after an sc injection of 2
µg of Buserelin given every 12 h for 108 h. In male
Gq knockout mice, the serum LH level reached a maximum
of 556 ± 43 pg/25 µl (n = 7) after 1 h from the start
of treatment (Fig. 4A). In the heterozygous male, a similar treatment
resulted in LH levels of 570 ± 60 pg/25 µl (n = 4)
after 1 h from the start of treatment, a maximum serum LH level of
865 ± 57 pg/25 µl was achieved after 13 h from the start
of treatment. The serum LH levels of the heterozygous male mice never
returned to the serum LH levels of the Gq knockout mice
during the treatment period. In female Gq knockout mice,
the serum LH level reached a maximum of 634 ± 56 pg/25 µl
(n = 4) after 1 h from the start of treatment (Fig. 4B). In
the heterozygous strain, a similar treatment resulted in a maximum LH
level of 346 ± 63 pg/25 µl (n = 7) after 1 h from the
start of treatment. The serum LH level in female Gq
knockout mice was maintained after the initial LH flare below the
heterozygous serum LH levels. There was a significant
(P < 0.05) difference in LH release over time (both
males and females) between Gq knockout and heterozygous
mice.
|
, A and B, shows the LH released after
1 h in response to the indicated doses of Buserelin in
G11 knockout male and female mice, respectively. There
is no significant difference between the knockout mice and control mice
at doses above 0.05 µg of Buserelin. The control mice responded more
robustly to a 5 ng/per animal dose of Buserelin than the knockout mice;
448 ± 18 pg/25 µl (n = 5) vs. 198 ± 25
pg/25 µl (n = 6) in male knockout mice, 417 ± 23 pg/25
µl (n = 5) vs. 175 ± 24 pg/25 µl (n = 7)
in female knockout mice.
|
, A and B, shows the LH released
after 1 h in response to the indicated doses of Buserelin in
Gq knockout male and female mice, respectively. There
was a significant difference in LH release in female Gq
knockout mice when 2 µg of Buserelin was administered; 634 ± 56
pg/25 µl (n = 4) for Gq knockout vs.
346 ± 63 pg/25 µl (n = 4) for control. However, unlike the
G11 knockout mice, there was no significant
(P < 0.05) difference between Gq
knockout mice and heterozygous mice with respect to LH release in
response to 0.05 µg of Buserelin.
|
, A and B, shows the testosterone and
estradiol levels in the serum, respectively, of male and female
G11 knockout mice, before and 1 h after an sc
injection of 2 µg of Buserelin. In male G11
knockout mice, serum testosterone levels increased from 2 ± 1
ng/ml to 23 ± 4 ng/ml (n = 10) in response to an sc
injection of 2 µg of Buserelin. In the male control strain, a similar
treatment of Buserelin increased serum testosterone levels from 1
± 1 ng/ml to 14 ± 3 ng/ml (n = 5). In female
G11 knockout mice, we were unable to detect a change in
serum estradiol levels in response to 2 µg of Buserelin; 8 ± 1
pg/ml before Buserelin treatment, and 6 ± 1 pg/ml (n = 12)
1 h after Buserelin treatment. In the female control strain, serum
estradiol levels increased in response to 2 µg of Buserelin from
12 ± 1 pg/ml (n = 4) to 17 ± 2 pg/ml (n = 5).
|
, A and B, shows the serum
testosterone and estradiol levels, respectively, of male and female
mice, before and 1 h after an sc injection of 2 µg of Buserelin
in Gq knockout mice. In male Gq knockout
mice, serum testosterone levels increased from 1 ± 0 ng/ml to
14 ± 2 ng/ml (n = 7) in response to an sc injection of 2
µg of Buserelin. In the male heterozygous mice, a similar treatment
of Buserelin increased serum testosterone levels from 1 ± 0 ng/ml
to 17 ± 2 ng/ml (n = 5). In female Gq
knockout mice there was no significant change in serum estradiol levels
in response to 2 µg of Buserelin; 5 ± 2 pg/ml before
Buserelin treatment, and 4 ± 2 pg/ml (n = 3) 1 h after
Buserelin treatment. The same was true for female heterozygous mice;
4 ± 1 pg/ml before Buserelin treatment and 7 ± 1 pg/ml
(n = 3) after Buserelin treatment. There was no significant
difference between Gq knockout mice and heterozygous
mice, with respect to Buserelin stimulated steroid (testosterone and
estradiol) release.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
G11 in mouse gonadotrope function using knockout mice
lacking the Gq or the G11 protein. The
fact that these knockout mice breed relatively normally immediately
suggested that either protein is not essential in the regulation of the
gonadotrope; potentially Gq and G11 can
substitute for each other. To examine the role of these two proteins in
GnRH-stimulated LH release, we examined the dynamics of GnRH-stimulated
LH release in mice. We used two different protocols to address this
question. First, we gave each mouse (control and knockout) a single
dose of Buserelin and subsequently measured the serum LH levels at the
given times. This protocol would show any differences in the release of
LH between the knockout mice and control mice in response to acute GnRH
analog treatment. Alternatively, we administered Buserelin every
12 h for 108 h, and 1 h after each administration,
measured the serum LH levels. The second protocol would address any
differences in the LH release between the control mice and knockout
mice in response to chronic GnRH analog treatment, and allow assessment
of the development of desensitization. To determine the sensitivity of
the gonadotrope, we performed an in vivo dose-response of
Buserelin-stimulated LH release in the knockout and control mice.
Furthermore, to determine whether any differences in
Buserelin-stimulated LH release between knockout mice and control mice
are due to different levels of gonadal steroids, producing varying
levels of negative feedback, we assayed the serum testosterone and
estradiol levels in male and female mice, respectively.
In the short time course study, in both sexes, we did not observe any
significant differences between the control strain and the
G11 knockout mice. In the long time course study, the
male G11 knockout mice had a rapid increase in serum LH
levels after Buserelin treatment compared with the control strain.
Furthermore, in the male G11 knockout mice, the serum LH
levels were elevated above those of the control mice up to 61 h
after the start of treatment, indicating that the knockout mice did not
become refractory to the GnRH analog as rapidly as did the control
strain. Another possible interpretation would be that LH is elevated to
such an extent, that it takes a longer time to return to control plasma
levels.
The short time course studies, in both sexes of the Gq
knockout mice, showed no significant differences in LH release in
response to a GnRH analog when compared with the control heterozygous
strain. In the long time course studies, both sexes showed a
significant difference in the LH release compared with heterozygous
mice. The Gq knockout male mice released less LH than
the heterozygous mice, and after the initial LH flare, the LH levels in
the heterozygous mice never reached the basal levels achieved by the
knockout mice. Paradoxically, in the female Gq knockout
mice, Buserelin stimulated a higher level of LH release compared with
the control heterozygous strain.
Only G11 knockout mice and not Gq
knockout mice were less sensitive to low doses of Buserelin with
respect to LH release. Stimulation of knockout mice with 5 ng of
Buserelin resulted in substantially less LH release than in the control
mice in G11 knockout mice. This may indicate different
roles for G11 and Gq in the
gonadotrope.
To determine whether the differential responses to Buserelin, with
respect to LH release, was due to different levels of gonadal steroids
being released resulting in differing levels of negative feedback on
the gonadotrope, we examined the serum testosterone and estradiol
levels in male and female mice, respectively. Buserelin-stimulated
serum testosterone levels in male G11 knockout mice was
significantly higher than in control mice, although Buserelin
stimulated estradiol levels in female G11 knockout mice
were lower than in control mice. In male and female Gq
knockout mice, there were no significant differences in
Buserelin-stimulated gonadal steroid levels compared with control
heterozygous strain.
The fact that there was a difference in Buserelin-stimulated LH release between the short and long time course studies suggests that there is a differential response to Buserelin under different treatment protocols. It is possible that mice in the short time course protocol may be stressed, resulting in a retarded response to Buserelin.
In the gonadotrope, LH release is under the negative feedback control
of estrogen and testosterone. Therefore, if gonadal steroid production
was affected in the knockout mice, this could produce different
intensities of negative feedback on the gonadotrope resulting in
differential levels of LH release in response to Buserelin. The steroid
data suggest that negative feedback cannot account for the high LH
release in male G11 knockout mice in the long time
course study, because in the G11 knockout mice, the
testosterone levels are higher than in control mice. In
Gq knockout male mice, Buserelin-stimulated LH release
is lower than in the control mice in the long time course study,
although there is no significant difference in testosterone production
compared with the control strain, at 1 h or 13 h after the
start of Buserelin treatment. Therefore the differences in the
Buserelin-stimulated LH release in the knockout mice compared with the
control mice cannot be clearly explained with the differing steroid
levels. In the female G11 knockout mice we could not
detect an increase in the serum estradiol production after Buserelin
stimulation, although in the control wild-type mice we measured a
Buserelin-stimulated increase in serum estradiol production. The
absence of a Buserelin-stimulated estradiol increase in female
G11 knockout mice may be a physiological manifestation
of G11 absence, or may be a technical artifact due to
serum estradiol levels too low to detect with our assay. In the female
Gq knockout mice, we could not detect an increase in
serum estradiol in response to Buserelin. However, there were no
significant differences in the serum estradiol production between the
knockout mice and the control heterozygous mice. This may indicate that
Gq does not play a role in Buserelin-stimulated
estradiol production in these mice, although, as mentioned earlier,
this observation may be due to low serum estradiol levels compared with
the sensitivity of our assay.
The fact that in the long time course study, Buserelin-stimulated LH
release is higher in male G11 knockout mice than in
control (Fig. 2
), whereas in male Gq knockout mice,
Buserelin-stimulated LH release is lower than in the control strain
(Fig. 4), suggests that these proteins may play a different role in LH
synthesis. A disruption in LH synthesis, manifested as a difference in
Buserelin-stimulated LH release in the long time course experiments
cannot be discounted in these knockout mice.
The differences between male control mice and male G11
knockout mice, with regard to Buserelin-stimulated LH release and
testosterone production, may be due to the fact that the control mice
and the knockout mice were from two different breeding groups. However,
this is unlikely, as the strain of the two groups of mice were the same
(129/SvEvTacfBR). Similarly, the differences between the heterozygous
mice and Gq knockout mice, with respect to LH release,
are not likely due to differences in strain, age or pubertal status, as
we tried to use mice from the same litter group.
The reason for a sex based difference in Buserelin-stimulated LH
release in Gq and G11 knockout mice is
unclear. One possibility is that there may be differences in the sexual
maturation time between males and females, although how this may affect
Buserelin-stimulated LH release is not known. It would be interesting
to see whether there are other sex based differences in these G protein
knockout mice.
The changes in serum LH levels observed between the knockout mice and the control mice is not due to differences in degradation, because serum LH clearance is dependent on sialation of the protein. Changes in sialation is observed in different aged animals, and we used mice that were of similar age (26).
This study shows that there are differences in the dynamics of LH
release in response to chronic GnRH analog treatment. The lack of
complete abolition of processes, such as stimulated LH release and
steroid production, suggest that these G proteins are either not
required or are able to functionally compensate for each other.
Experiments similar to this study will have to be performed with
conditional double knockouts of G11 and
Gq to determine whether these proteins are required for
GnRH activity in the pituitary.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received October 29, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
by the GnRH receptor. Mol
Endocrinol 11:738–746 in the pituitary gonadotrope in
response to a GnRH agonist. Endocrinology 139:397–402 subunit
multigene family. Nat Genet 1:85–91[CrossRef][Medline]
subunits is present in vertebrates and
invertebrates. Proc Natl Acad Sci USA 87:9113–9117 and G11. J
Biol Chem 268:14367–14375 subunits to
seven-helix receptors expressed in Xenopus oocytes. J
Biol Chem 269:30164–3017211 and Gq guanine nucleotide binding
proteins differentially modulate the response to thyrotropin-releasing
hormone in Xenopus oocytes. FEBS Lett 307:237–40[CrossRef][Medline]
q-deficient mice.
Nature 389:183–186[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  T Zhang and M S Roberson Role of MAP kinase phosphatases in GnRH-dependent activation of MAP kinases J. Mol. Endocrinol., February 1, 2006; 36(1): 41 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Baba, J. Mimura, N. Nakamura, N. Harada, M. Yamamoto, K.-i. Morohashi, and Y. Fujii-Kuriyama Intrinsic Function of the Aryl Hydrocarbon (Dioxin) Receptor as a Key Factor in Female Reproduction Mol. Cell. Biol., November 15, 2005; 25(22): 10040 - 10051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Liu, M. S. Ruiz, D. A. Austin, and N. J. G. Webster Constitutively Active Gq Impairs Gonadotropin-Releasing Hormone-Induced Intracellular Signaling and Luteinizing Hormone Secretion in L{beta}T2 Cells Mol. Endocrinol., August 1, 2005; 19(8): 2074 - 2085. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Hartmann, R. Blum, Y. Kovalchuk, H. Adelsberger, R. Kuner, G. M. Durand, M. Miyata, M. Kano, S. Offermanns, and A. Konnerth Distinct Roles of G{alpha}q and G{alpha}11 for Purkinje Cell Signaling and Motor Behavior J. Neurosci., June 2, 2004; 24(22): 5119 - 5130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Zhang, M. W. Wolfe, and M. S. Roberson An Early Growth Response Protein (Egr) 1 cis-Element Is Required for Gonadotropin-releasing Hormone-induced Mitogen-activated Protein Kinase Phosphatase 2 Gene Expression J. Biol. Chem., November 30, 2001; 276(49): 45604 - 45613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Cheng, P. S. Nathwani, and P. C. K. Leung Regulation of Human Gonadotropin-Releasing Hormone Receptor Gene Expression in Placental Cells Endocrinology, July 1, 2000; 141(7): 2340 - 2349. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Roberson, T. Zhang, H. L. Li, and J. M. Mulvaney Activation of the p38 Mitogen-Activated Protein Kinase Pathway by Gonadotropin-Releasing Hormone Endocrinology, March 1, 1999; 140(3): 1310 - 1318. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
