Endocrinology Vol. 139, No. 3 1338-1345
Copyright © 1998 by The Endocrine Society
Regulation of Matrix Metalloproteinases (MMP-2, -3, -9, and -13) by Interleukin-1 and Interleukin-6 in Mouse Calvaria: Association of MMP Induction with Bone Resorption1
Kenichiro Kusano2,
Chisato Miyaura2,
Masaki Inada,
Tatsuya Tamura,
Akira Ito,
Hideaki Nagase,
Kyuichi Kamoi and
Tatsuo Suda
Department of Biochemistry (Ke.K., C.M., M.I., T.T., T.S.), School
of Dentistry, Showa University, Tokyo 142, Japan; Fuji Gotemba Research
Laboratories (T.T.), Chugai Pharmaceutical Company, Ltd., Shizuoka 412,
Japan; Department of Biochemistry (A.I.), School of Pharmacy, Tokyo
University of Pharmacy and Life Science, Tokyo, 19203, Japan;
Department of Biochemistry and Molecular Biology (H.N.), University of
Kansas Medical Center, Kansas City, Kansas 66160; and Department of
Periodontology (M.I., Ky.K.), School of Dentistry at Tokyo, Nippon
Dental University, Tokyo, 102, Japan
Address all correspondence and requests for reprints to: Tatsuo Suda, Department of Biochemistry, School of Dentistry, Showa University, 15-8 Hatanodai, Shinagawa-ku, Tokyo 142, Japan.
 |
Abstract
|
|---|
Interleukin-1 (IL-1) greatly induces osteoclast formation and
stimulates bone resorption of mouse calvaria in culture. In the
presence of soluble IL-6 receptor (sIL-6R), IL-6 similarly induces
osteoclast formation, but the potency of IL-6 in inducing bone
resorption in organ culture is weaker than that of IL-1. To study the
differences in bone-resorbing activity between IL-1 and IL-6, we
examined the effects of the two cytokines on the induction of matrix
metalloproteinases (MMPs). In mouse calvarial cultures, IL-1 markedly
enhanced the messenger RNA (mRNA) expression of MMP-13 (collagenase 3),
MMP-2 (gelatinase A), MMP-9 (gelatinase B), and MMP-3 (stromelysin 1),
which associated with increases in bone matrix degradation. A
hydroxamate inhibitor of MMPs significantly suppressed bone-resorbing
activity induced by IL-1. Gelatin zymography showed that both pro- and
active-forms of MMP-2 and MMP-9 were detected in the conditioned medium
collected from calvarial cultures, and IL-1 markedly stimulated both
pro- and active-forms of the two gelatinases. IL-6 with sIL-6R also
stimulated mRNA expression and biological activities of these MMPs, but
the potency was much weaker than that of IL-1. Conditioned medium
collected from IL-1-treated calvariae degraded native type I collagen,
but 3/4- and 1/4-length collagen fragments were not
detected, suggesting that both collagenases and gelatinases
synergistically degraded type I collagen into smaller fragments. In
mouse osteoblastic cells, the expression of MMP-2, MMP-3, and MMP-13
mRNAs could be detected, and they were markedly enhanced by IL-1
on
days 2 and 5. IL-6 with sIL-6R also induced expression of MMP-13 and
MMP-2 mRNAs on day 2, but the expression was rather transient. These
results demonstrate that the potency of induction of MMPs by IL-1 and
IL-6 is closely linked to the respective bone-resorbing activity,
suggesting that MMP-dependent degradation of bone matrix plays a key
role in bone resorption induced by these cytokines.
 |
Introduction
|
|---|
INTERLEUKIN-1 (IL-1) markedly stimulates
osteoclastic bone resorption in vivo and in vitro
by enhancing both osteoclast formation and function (1, 2, 3). Other
cytokines (including IL-6 and IL-11, which transduce their signals
through the signal-transducing gp130 chain) also induce osteoclast
formation in vitro (4, 5, 6). Both IL-1 and IL-6 seem to induce
osteoclast formation from its progenitors via a mechanism involving
osteoblastic cells (6). We reported previously that the presence of
soluble IL-6 receptor (sIL-6R) was essential for the osteoclast
formation induced by IL-6 in cocultures of mouse bone marrow cells and
osteoblastic cells (4). This suggests that osteoblastic cells lack
membrane-bound IL-6 receptors under physiological conditions. The
potency of IL-6 with sIL-6R in osteoclast formation was equivalent to
that of IL-1, but in organ culture systems such as mouse calvarial
cultures, bone-resorbing activity of IL-1 was much greater than that of
IL-6, even in the presence of sIL-6R. Bone resorption consists of
multiple steps, including osteoclast differentiation, activation of
osteoclast function, degradation of bone matrix proteins, and bone
mineral mobilization. Because IL-1 and IL-6 similarly stimulate
osteoclast differentiation, the differences in bone-resorbing activity
between IL-1 and IL-6 may be caused by the actions of these cytokines
in other processes, such as matrix degradation.
Degradation of the organic matrix in bone depends on the activity of
proteolytic enzymes, which consist of 2 major classes: the cysteine
proteinase family (such as catepsin K) and the matrix metalloproteinase
(MMPs) family (7, 8, 9, 10, 11). Over the past years, 18 different mammalian MMPs
have been identified. These can be divided into 4 subgroups;
collagenases (MMP-1, MMP-8, MMP-13, and MMP-18), gelatinases (MMP-2
and MMP-9), stromelysins (MMP-3 and MMP-10), and membrane-type
metalloproteinases (MMPs-1417) (12, 13, 14). These MMPs are all
zinc-dependent endopeptidases with the ability to degrade the organic
matrix at physiological pH. Sequence comparisons have revealed that
mouse and rat collagenases are homologous to the human collagenase 3
identified by Freije et al. (15) and are now referred to as
MMP-13. Stromelysins such as MMP-3 not only act as a metalloproteinase
but also activate a latent pro-MMP. Therefore, the cooperative effects
of collagenases, gelatinases, and stromelysins may be important for
MMP-dependent degradation of bone matrix.
Previous reports suggested that MMPs are involved in bone resorption.
MMP-13 (collagenase 3) and MMP-2 and MMP-9 (gelatinases A and B) are
produced by osteoblasts and/or osteoclasts (8, 10, 16, 17, 18, 19). Tezuka
et al. (20) demonstrated the selective expression of MMP-9
in osteoclasts. Hill et al. (21, 22) reported that synthetic
inhibitors of collagenase and/or gelatinase prevented bone resorption
in vitro. It also has been proposed that osteoblast-derived
collagenase is responsible for degrading the nonmineralized osteoid
layer covering bone surfaces, which is essential for exposing the
mineralized matrix to osteoclasts (9, 23). More recently, it was
reported that not only denatured, but also native type I collagens
could be degraded by MMP-2 (24). MMP-9 failed to degrade native type I
collagen. Osteoblasts produce gelatinases such as MMP-2 (16). The
regulation of MMP-2 in osteoblasts and involvement of gelatinases in
bone resorption, however, are not well understood.
In this study, we examined the regulation of expression of several MMPs
by IL-1 and IL-6 at the messenger RNA (mRNA) level in mouse calvarial
cultures. Not only MMP-13 (collagenase 3), but also MMP-2 and MMP-9
(gelatinases) and MMP-3 (stromelysin 1), were markedly induced by IL-1
and moderately induced by IL-6. These MMPs may act in concert for the
degradation of bone matrix associated with bone resorption.
 |
Materials and Methods
|
|---|
Animals and drugs
Newborn (5 days old) and adult ddy mice (7 weeks old) were
obtained from Shizuoka Laboratory Animal Center (Shizuoka, Japan).
Recombinant human IL-1
was purchased from Genzyme (Cambridge, MA).
Recombinant mouse IL-6 and sIL-6R were prepared from CHO cells
transfected with a mouse IL-6 complementary DNA (cDNA) expression
vector and a mouse sIL-6R cDNA expression vector, respectively, as
reported (4). Purified human collagenase (MMP-1) and gelatinase (MMP-2)
were purchased from Yagai Co. Ltd. (Yamagata, Japan). A hydroxamate
inhibitor of MMPs [HONHCOCH2CH(i-Bu)CO-Trp-NHMe; GM6001X] was kindly
provided by Dr. J. Oleksyszyn (OsteoArthritis Science, Inc. Cambridge,
MA). All other chemicals were of analytical grade.
Mouse calvarial culture
Five-day-old mice were killed and their calvariae were
aseptically harvested and dissected free of suture tissues. The
calvariae were divided into paired halves and cultured for 24 h at
37 C under 5% CO2 in air in 0.5 ml BGJb medium (Gibco BRL,
Rockville, MD) containing 1 mg/ml BSA (fraction V, Sigma, St. Louis,
MO). After preculture for 24 h, each half calvaria was transferred
to fresh medium, with and without respective cytokines, and cultured
for an additional 5 days. To determine bone-resorbing activity of test
materials, the concentration of calcium in the conditioned medium was
measured on day 5 using a calcium kit (Calcium C-test Wako; Wako Pure
Chemical, Osaka, Japan). On day 5, to detect osteoclasts, calvariae
were fixed with 10% formalin and stained with tartrate-resistant acid
phosphatase (TRAP). TRAP-stained calvariae were counterstained with
alkaline phosphatase.
Culture of primary mouse osteoblastic cells
Primary osteoblastic cells were isolated from 1-day-old mouse
calvariae after five routine sequential digestions with 0.1%
collagenase (Wako) and 0.2% dispase (Godo Shusei, Tokyo, Japan), as
described (25). Osteoblasts isolated from fractions 35 were combined
and cultured in
-modified MEM (
MEM), supplemented with 10% FBS
at 37 C in a humidified atmosphere of 5% CO2 in air. To
measure steady-state levels of MMP mRNAs, osteoblastic cells were
cultured for 24 h in
MEM with 1% FBS and further cultured for
an additional 5 days with cytokines.
Northern blot analysis
Total cellular RNA was extracted from cultured mouse calvariae
and osteoblastic cells using the acid guanidium-phenol-chloroform
method (25). For Northern blotting, 20 µg total RNA were resolved by
electrophoresis in a 1% agarose-formaldehyde gel and transferred onto
nylon membranes (Hybond N, Amersham, Arlington Heights, IL), then
hybridized with a [32P]-labeled cDNA probe, as
reported (25). The signals were densitometrically quantified using an
image analyzer (Micro Computer Imaging Device, Fuji Film, Tokyo,
Japan). Mouse MMP-13 cDNA probe (26) was amplified by RT-PCR (sense
primer: 5' CTTCTGGTCTTCTGGCACACG 3', antisense primer: 5'
CCCCACCCCATACATCTGAAA 3') and cut with EcoRI, yielding a
485-bp fragment. A 250-bp fragment of human MMP-2 cDNA (27) was used as
a probe, which specifically hybridized with mouse MMP-2 mRNA. A 1500-bp
fragment of human MMP-3 cDNA was used as a probe for MMP-3 (28). Mouse
MMP-9 cDNA probe (29), a 459-bp fragment, was amplified by PCR (sense
primer: 5' TGTTCAGCAAGGGGCGTGTC 3', antisense primer: 5'
AAACAGTCCAACAAGAAAGG 3'). Human tissue inhibitor of matrix
metalloproteinase (TIMP)-1 cDNA was kindly provided by Dr. M. Naruto
(Toray Industries, Inc., Kanagawa, Japan).
Assay of collagenase and gelatinase activities
To measure collagenase and gelatinase activities, conditioned
media of calvarial cultures were treated for 4 h with
4-aminophenylmercuric acetate (APMA), which activates pro-MMPs into the
respective active forms. Collagenase and gelatinase activities were
measured by the degradation of fluorescein isothiocyanate
(FITC)-labeled type I and type IV collagen using a type I collagenase
activity assay kit and a type IV collagenase activity assay kit,
respectively (Yagai Co.). One unit of these activities degrades 1 µg
of respective collagen per min at 37 C.
Gelatin zymography
Gelatinase activity in the conditioned medium of calvarial
cultures was analyzed by zymography after incubation for 4 h, with
or without 10 mM APMA, as reported previously (30).
Aliquots (10 µl) were mixed with 5 µl of nonreducing SDS-PAGE
sample buffer, then subjected to SDS-PAGE using 10% polyacrylamide
gels containing 0.6 mg/ml of gelatin. After electrophoresis, gels were
incubated for 1 h in washing buffer consisting of 50
mM Tris-HCl, containing 5 mM CaCl2,
1 µM ZnCl2, and 2.5% Triton X-100 to remove
SDS, and then in the same buffer without Triton X-100 at 37 C for
3 h. Gels were stained with 0.1% (wt/vol) Coomassie brilliant
blue in 50% (vol/vol) methanol, 10% (vol/vol) acetic acid, and
destained in a solution of 30% (vol/vol) methanol and 1% (vol/vol)
formic acid. Enzyme activity was detected as a clear zone in a darkly
stained background.
SDS-PAGE
SDS-PAGE was performed to detect the degradation of native type
I collagen by conditioned medium of calvarial cultures. Conditioned
medium was incubated with 10 mM APMA for 4 h, and
further incubated for 20 h at 37 C with 2 µg purified bovine
type I collagen (Yagai Co.); then the reaction was stopped by adding 10
mM EDTA. As standard collagenase and gelatinase, purified
human MMP-1 and human MMP-2 (Yagai Co.) were used for incubation with
type I collagen. The samples were then subjected to SDS-PAGE using a
10% polyacrylamide gel. After electrophoresis, the gels were stained
with Coomassie brilliant blue solution.
Statistical analysis
Statistical analysis was carried out by Dunnetts t
test, and the data are expressed as means ± SEM.
 |
Results
|
|---|
Bone-resorbing activities of IL-1 and IL-6
IL-1 markedly stimulates osteoclastic bone resorption in
vitro by enhancing both osteoclast formation and function. We have
reported previously that IL-6 induces osteoclast formation in
cocultures of mouse bone marrow cells and osteoblastic cells when
sIL-6R is present (4). To compare the bone-resorbing activities of IL-1
and IL-6, we measured the concentration of calcium in the medium on day
5 in mouse calvarial cultures. Both IL-1
(2 ng/ml) and IL-6 (100
ng/ml) in the presence of sIL-6R (200 ng/ml) stimulated bone
resorption, but the activity of IL-1
was significantly more potent
than that of IL-6 (Fig. 1A
). The
concentrations of IL-1
, IL-6, and sIL-6R used were the doses
sufficient to induce maximal bone resorption. In the cultures treated
with 100 ng/ml IL-6, a higher concentration of sIL-6R (400 ng/ml)
showed an effect on bone-resorbing activity similar to that induced by
200 ng/ml sIL-6R (data not shown). A large number of TRAP-positive
osteoclasts were detected in calvarial tissues cultured with IL-1
or
IL-6 with sIL-6R (Fig. 1B
). This indicated that both IL-1 and IL-6
markedly stimulate osteoclast formation in calvarial cultures.
Therefore, the difference of bone-resorbing activity between IL-1 and
IL-6 seems to be caused by other processes of bone resorption, such as
matrix degradation regulated by MMPs. When a hydroxamate inhibitor of
MMPs was added to calvarial cultures, IL-1-induced bone resorption was
markedly inhibited on day 5. In addition, IL-6-induced bone resorption
also was suppressed by the same inhibitor to a similar level to IL-1
plus hydroxamate. The medium calcium (mg/dl) levels were: control,
6.43 ± 0.04; IL-1
, 14.04 ± 0.45; IL-1
plus 30
µM hydroxamate, 8.08 ± 0.48; IL-6 with sIL-6R,
9.38 ± 0.25; IL-6 with sIL-6R plus 30 µM
hydroxamate, 8.06 ± 0.11.

View larger version (66K):
[in this window]
[in a new window]
|
Figure 1. Effects of IL-1 and IL-6 in the presence of
sIL-6R on bone-resorbing activity in cultured mouse calvariae.
Five-day-old neonatal mouse calvariae were cultured for 5 days with
vehicle, IL-1 (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml).
The concentrations of IL-1 , IL-6, and sIL-6R used were the doses
sufficient to induce maximal bone resorption. A, Conditioned media were
collected, and the concentration of calcium in the medium was measured
to monitor the bone-resorbing activity. The data are expressed as
means ± SEM of 9 cultures, significantly different
from the control (**, P < 0.01) and from cultures
treated with IL-1 (#, P < 0.01). B, Calvariae
were fixed and stained with TRAP, shown in red, as
described in Materials and Methods.
|
|
Expression of MMP mRNAs in mouse calvariae treated with IL-1 and
IL-6 with sIL-6R
To compare the effects of IL-1 and IL-6 on expression of MMP
mRNAs, we performed Northern blot analysis using total RNA extracted
from mouse calvariae. IL-1
stimulated expression of MMP-13, MMP-2,
and MMP-3 mRNAs on day 2, and the enhanced levels were maintained on
day 5 (Fig. 2
). Treatment with IL-6
together with sIL-6R also stimulated expression of MMP-13, MMP-2, and
MMP-3 mRNAs on day 2, but the increased levels decreased to the
respective control levels on day 5 (Fig. 2
). MMP-3 has been reported to
activate other pro-MMPs, which suggests that the induction of MMP-2,
-3, and -13 is cooperatively involved in MMP-dependent matrix
degradation. Expression of mRNA encoding TIMP-1, a negative regulator
of activated MMPs in target tissues, also was enhanced by IL-1 and IL-6
with sIL-6R (Fig. 2
). The expression of TIMP-1 mRNA was further
increased by IL-1
, but not by IL-6, on day 5 (Fig. 2
). Expression of
MMP-9 mRNA was similarly enhanced by IL-1 and IL-6 with sIL-6R (Fig. 2
).
Collagenase and gelatinase activities
To analyze the functional activities of MMPs expressed in mouse
calvariae, collagenase and gelatinase activities in the conditioned
medium of calvarial cultures were measured by the degradation of
FITC-labeled type I and type IV collagen. IL-1
markedly stimulated
both collagenase and gelatinase activities (Fig. 3
). In the presence of sIL-6R, IL-6 also
stimulated collagenase and gelatinase activities, but the effects were
much less than those of IL-1
. The differences between collagenase
and gelatinase activities induced by IL-1 and those induced by IL-6
were consistent with the potency of the respective cytokines in
inducing expression of MMP-13 and MMP-2 mRNAs (Fig. 2
).
Effects of IL-1 and IL-6 on the production of pro- and active-forms
of MMP-2
To compare the effects of IL-1 and IL-6 on the production of
gelatinases, conditioned media from calvarial cultures collected on day
5 were incubated for 4 h, with or without APMA, and used for
gelatin zymography. In the absence of APMA, not only pro-MMP-2 (72 kDa)
but also a small amount of active-MMP-2 (67 kDa) was detected on the
gel from the control cultures. Levels of expression of both pro- and
active-forms of MMP-2 were markedly enhanced by treatment with IL-1
.
Pro-MMP-9 also was detected, and it was markedly enhanced by IL-1.
Treatment with IL-6 together with sIL-6R slightly enhanced the
production of pro-MMP-2 and pro-MMP-9, but the effect was much less
than that of IL-1. When the respective conditioned medium was incubated
with APMA, most of the pro-MMP-2 and pro-MMP-9 induced by IL-1
was
processed into the respective active forms (Fig. 4
). In the presence of APMA, pro-MMP-2
induced by IL-6 was also processed into active-MMP-2, but pro-MMP-9 was
not (Fig. 4
). The lack of pro-MMP-9 activation by APMA is most likely
caused by the short period of time exposed to APMA, as human pro-MMP-9
requires about 48 h incubation at 37 C with APMA to be fully
activated (31).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. Detection of MMP-2 and MMP-9 in the conditioned
media collected from cultured mouse calvariae, by gelatin zymography.
Mouse calvariae were cultured for 5 days with IL-1 (2 ng/ml) or IL-6
(100 ng/ml) with sIL-6R (200 ng/ml), and conditioned media were
collected and treated for 4 h with or without 10 mM
APMA. For gelatin zymography, the samples were run on a polyacrylamide
gel (10%) containing 0.6 mg/ml of gelatin and were analyzed as
described in Materials and Methods. Gelatinase
activities corresponding to pro-MMP-2, active-MMP-2, pro-MMP-9, and
active-MMP-9 are indicated by arrows.
|
|
Collagenase and gelatinase cooperatively degrade type I
collagen
It is well known that collagenase cleaves native type I collagen
into 3/4- and 1/4-length collagen fragments. Recent
studies have indicated that MMP-2 also cleaves native type I collagen
under appropriate conditions (24). To analyze collagenolytic activities
of conditioned media from calvarial cultures, we performed SDS-PAGE to
detect the degraded products of native type I collagen. When type I
collagen was incubated with conditioned medium from calvarial cultures
treated with IL-1
, levels of both
1 and
2 chains were markedly
decreased, but no 3/4- or 1/4-length fragments, such as
1A and
2A, could be detected (Fig. 5B
). Purified collagenase, human MMP-1,
cleaved type I collagen to generate
A fragments, but
human MMP-2 did not (Fig. 5A
). When type I collagen was incubated with
both purified MMP-1 and MMP-2, type I collagen was degraded into
smaller fragments but not into
A fragments (Fig. 5A
).
The conditioned media from calvarial cultures treated with IL-6 and
sIL-6R slightly degraded type I collagen, but the collagenolytic
activity was much weaker than that of IL-1
.
Expression of MMP mRNAs in osteoblasts
To examine the regulation of MMPs in bone, we performed Northern
blot analysis using osteoblastic cells collected from newborn mouse
calvariae. Osteoblastic cells expressed MMP-13 and MMP-2 mRNAs, and the
levels of expression of these MMPs were markedly enhanced by IL-1
on
days 2 and 5 (Fig. 6
). MMP-3 was slightly
detected in the control osteoblastic cells, and it was markedly
enhanced by treatment with IL-1 on days 2 and 5. IL-6 with sIL-6R
similarly induced expression of MMP-2 and MMP-13 mRNAs on day 2, but
the stimulated expression of these MMPs was decreased on day 5. MMP-3
mRNA was slightly enhanced by IL-6 with sIL-6R on day 5. MMP-9 mRNA was
not detected in osteoblastic cells, irrespective of the presence or
absence of IL-1 and IL-6 (Fig. 6
), but it was detected in
osteoclast-like cells formed in cocultures of bone marrow cells and
osteoblastic cells (data not shown). These results indicate that MMP-2,
MMP-3, and MMP-13 are expressed in osteoblasts, and they are markedly
enhanced by IL-1 and moderately enhanced by IL-6 with sIL-6R.
 |
Discussion
|
|---|
The present study clearly demonstrated that both IL-1 and IL-6
with sIL-6R induce mRNA expression of various MMPs, including MMP-13,
MMP-2, MMP-9, and MMP-3 in mouse calvarial cultures. The potency of
IL-1 was much greater and lasted longer than that of IL-6, which was
correlated well with the potencies of bone-resorbing activity of these
cytokines. We have reported that IL-1 and IL-6 with sIL-6R similarly
stimulate osteoclast formation in cocultures of mouse bone marrow cells
and osteoblastic cells (4, 6). Consistently, IL-1 and IL-6 with sIL-6R
similarly induced osteoclast formation in mouse calvarial cultures
(Fig. 1B
). In addition to osteoclast formation, matrix degradation is
another important step in the process of bone resorption in calvarial
cultures. We found that not only MMP-13 (collagenase), but also MMP-2
(gelatinase) and MMP-3 (stromelysin), were markedly induced by IL-1 in
calvarial cultures (Fig. 2
). In the presence of sIL-6R, IL-6 also
stimulated expression of these MMP mRNAs in calvarial cultures but only
slightly and rather transiently. As reported previously, IL-1 markedly
induces PGE2 production in calvarial cultures (2). The potency of IL-6
in inducing PGE2 synthesis was less than that of IL-1 in calvarial
cultures (data not shown). When indomethacin was added to the calvarial
cultures, IL-1-induced bone-resorbing activity, as well as collagenase
and gelatinase activities, were similarly suppressed to the respective
levels induced by IL-6 with sIL-6R (Miyaura, C. et al.,
unpublished results). In addition, PGE2 markedly stimulated the
expression of MMP-13 and MMP-2 mRNAs in osteoblasts (data not shown).
These findings suggest that PGE2 production is involved in the MMP
induction by IL-1 in calvarial cultures.
Transcriptional regulation of collagenases, human MMP-1, and mouse
MMP-13 has been reported in various cell types such as connective
tissue cells, monocyte-macrophages, and endothelial cells. Human MMP-1
can be stimulated by various growth factors and cytokines, including
basic fibroblast growth factor, epidermal growth factor, IL-1, and
tumor necrosis factor
. The promoter regions of the genes encoding
human MMP-1 and MMP-3 have been sequenced and analyzed. These promoters
contain AP-1 sites, and their expression is up-regulated by
12-O-tetradecanoylphorbol-13-acetate and IL-1 (32, 33, 34). In contrast, no
AP-1 sites have been found in the promoter region of the human MMP-2
gene (35). Neither 12-O-tetradecanoylphorbol-13-acetate nor IL-1
induced MMP-2 mRNA in most cell types reported, except for glomerular
mesangial cells (13, 27, 36). In the present study, both IL-1 and IL-6
with sIL-6R markedly induced not only MMP-13 but also MMP-2 mRNA in
osteoblasts. Little is known about the effects of bone-resorbing
factors on the regulation of MMP-2. Lorenzo et al. (16)
reported that MMP-2 expressed in osteoblasts was not regulated by
bone-resorbing factors. Recently, Franchimont et al. (37)
reported that IL-6 with sIL-6R caused a marked induction of MMP-13
expression in rat osteoblasts by transcriptional mechanism. Further
studies are necessary to examine the mechanism of transcription of
MMP-2 and MMP-13 genes by IL-1 and IL-6 in mouse osteoblasts.
MMP-9 has been reported to be localized in monocyte-macrophages and
osteoclasts. In the present study, MMP-9 mRNA was not detected in
osteoblastic cells (Fig. 6
), but it was detected in osteoclasts, using
an in situ hybridization technique, in calvarial cultures
(data not shown). These results are consistent with the previous
findings (19, 20, 38). In calvarial cultures, both IL-1 and IL-6 with
sIL-6R stimulated the expression of MMP-9 mRNA, which was correlated
with the induction of osteoclast-like cell formation (Figs. 1
and 2
).
Therefore, the increased expression of MMP-9 mRNA in calvarial organ
cultures seems to be caused by the increased number of osteoclasts.
Jimi et al. (39) have reported that IL-1, but not IL-6,
directly acts on osteoclast-like cells and supports their survival
in vitro. However, it is not known whether IL-1 directly
regulates MMP-9 expression in osteoclasts. Further studies are needed
to define the regulation and biological roles of MMPs in
osteoclasts.
The activation of pro-MMPs is essential for matrix degradation. MMP-3
was reported to activate pro-MMPs such as pro-MMP-1 and pro-MMP-9
(40, 41, 42). In calvarial cultures, IL-1 markedly induced the expression
of MMP-3 mRNA (Fig. 2
), whereas IL-6 did so only weakly, even in the
presence of sIL-6R. These results are consistent with the observation
that both pro- and active-forms of MMP-2 and MMP-9 could be detected in
gelatin zymography using conditioned media collected from IL-1-treated
cultures (Fig. 4
), suggesting that MMP-3 may act as an activator for
other pro-MMPs induced by IL-1 and IL-6. Recently, Kinoh et
al. (43) reported that membrane type (MT)1-MMP was coexpressed
with pro-MMP-2 in mouse embryonic osteoblasts. Sato et al.
(44) also demonstrated the presence of MT1-MMP in rabbit osteoclasts.
MT1-MMP was reported to activate pro-MMP-2 and pro-MMP-13 and act as a
collagenase (45, 46). Further studies are needed to define the role(s)
of MT1-MMP in bone resorption.
Recently, Hill et al. (21, 22) reported that synthetic
inhibitors of MMPs prevent bone resorption induced by IL-1,
1
,25-dihydroxyvitamin D3, and PTH. Using concentration-dependent
selective inhibitors of collagenase and gelatinase, they concluded that
both collagenase and gelatinase are involved in bone resorption (22).
In the present study, conditioned media from calvarial cultures treated
with IL-1 showed marked collagenolytic activity, but the
collagenase-induced typical cleavage products of type I collagen,
3/4- and 1/4-length fragments, could not be detected
(Fig. 5B
). The degraded pattern of type I collagen was similar to that
by simultaneous treatment with purified collagenase and gelatinase
(Fig. 5A
). Therefore, it is likely that gelatinases are also involved
in the subsequent degradation of the collagen fragments cleaved by
collagenase in bone.
It is essential to elucidate the distribution of MMPs in bone tissues
to determine the selective role of each MMP in bone remodeling. It has
been reported that MMP-13 is expressed preferentially in osteoblasts
(8, 10, 17, 18), whereas MMP-9 is expressed selectively in osteoclasts
(19, 20, 38). Gack et al. (47) demonstrated strong
expression of MMP-13 in osteoblastic cells located adjacent to mature
osteoclasts. Fuller and Chambers (48) have also reported that MMP-13
mRNA is expressed in osteoblastic cells adjacent to osteoclasts at the
sites of active bone resorption. Therefore, MMP-13 in osteoblasts and
MMP-9 in osteoclasts may act in concert to promote bone matrix
degradation. MMP-13 produced by osteoblasts is responsible for removing
the unmineralized osteoid tissues, which protect bone mineral from
osteoclastic bone resorption, because osteoclasts cannot adhere to the
unmineralized osteoid layer.
In conclusion, IL-1 markedly stimulates expression of MMP-2, -3, and
-13 mRNAs in mouse calvariae, but IL-6 stimulates their expression only
slightly, even in the presence of sIL-6R. IL-1 and IL-6 similarly
induce osteoclast formation, resulting in an increase in the expression
of MMP-9 mRNA. Because the differences in the potency of MMP induction
between IL-1 and IL-6 correlated well with the bone-resorbing
activities of these cytokines, it is likely that the MMP-dependent
matrix degradation is the rate-limiting step in osteoclastic bone
resorption.
 |
Acknowledgments
|
|---|
We thank Dr. J. Oleksyszyn (OsteoArthritis Science, Inc.) for
his generous gift of the hydroxamate MMP inhibitor. We also thank Dr.
M. Naruto (Toray Industries, Inc.) for his generous gift of human
TIMP-1 cDNA, and Dr. S. Konno (Yagai Co.) for his helpful
discussion.
 |
Footnotes
|
|---|
1 This work was supported by Grants-in-Aid 08407060 (to T.S.) and
08457493 (to C.M.) from the Ministry of Science, Education and Culture
of Japan and NIH Grant AR-39189 (to H.N.). 
2 Equal first authors. 
Received September 4, 1997.
 |
References
|
|---|
-
Gowen M, Wood DD, Ihrie EJ, McGuire MKB, Russell
RGG 1983 An interleukin-1-like factor stimulates bone resorption
in vitro. Nature 306:378380[CrossRef][Medline]
-
Akatsu T, Takahashi N, Udagawa N, Imamura K, Yamaguchi
A, Sato K, Nagata N, Suda T 1991 Role of prostaglandins in
interleukin-1-induced bone resorption in mice in vitro.
J Bone Miner Res 6:183190[Medline]
-
Sato K, Fujii Y, Kasono K, Saji M, Tsushima T, Shizume
K 1986 Stimulation of prostaglandin E2 and bone resorption by
recombinant human interleukin 1 alpha in fetal mouse bones. Biochem
Biophys Res Commun 138:618624[CrossRef][Medline]
-
Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S,
Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, Kishimoto T, Suda
T 1993 Soluble interleukin-6 receptor triggers osteoclast
formation by interleukin 6. Proc Natl Acad Sci USA 90:1192411928[Abstract/Free Full Text]
-
Girasole G, Passeri G, Jilka RL, Manolagas SC 1994 Interleukin-11: a new cytokine critical for osteoclast development.
J Clin Invest 93:15161524
-
Suda T, Takahashi N, Martin TJ 1992 Modulation of
osteoclast differentiation. Endocr Rev 13:6680[CrossRef][Medline]
-
Everts V, Delaisse JM, Korper W, Niehof A, Vaes G,
Beerts W 1992 Degradation of collagen in the bone-resorbing
compartment underlying the osteoclast involves both
cysteine-proteinases and matrix metalloproteinases. J Cell Physiol 150:221231[CrossRef][Medline]
-
Partridge NC, Jeffrey JJ, Ehlich LS, Teitelbaum SL,
Fliszar C, Welgus HG, Kahn AJ 1987 Hormonal regulation of the
production of collagenase and collagenase inhibitor activity by rat
osteogenic sarcoma cells. Endocrinology 120:19561962[Abstract]
-
Chambers TJ, Fuller K 1985 Bone cells predispose
bone surfaces to resorption by exposure of mineral to osteoclastic
contact. J Cell Sci 76:155165[Abstract]
-
Meikle MC, Bord S, Hembry RM, Compston J, Croucher PI,
Reynolds JJ 1992 Human osteoblasts in culture synthesize
collagenase and other matrix metalloproteinases in response to
osteotropic hormones and cytokines. J Cell Sci 103:10931099[Abstract/Free Full Text]
-
Inui T, Ishibashi O, Inaoka T, Origane Y, Kumegawa M,
Kokubo T, Yamamura T 1997 Cathepsin K antisense
oligodeoxynucleotide inhibits osteoclastic bone resorption. J Biol
Chem 272:81098112[Abstract/Free Full Text]
-
Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ,
Birkedal-Hansen B, DeCarlo A, Engler JA 1993 Matrix
metalloproteinases: a review. Crit Rev Oral Biol Med 4:197250[Abstract/Free Full Text]
-
Mauviel A 1993 Cytokine regulation of
metalloproteinase gene expression. J Cell Biochem 53:288295[CrossRef][Medline]
-
Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto
E, Seiki M 1994 A matrix metalloproteinase expressed on the
surface of invasive tumor cells. Nature 370:6165[CrossRef][Medline]
-
Freije JMP, Diez-Itza I, Balbin M, Sanchez LM, Blasco R,
Tolivia J, Lopez-Otin C 1994 Molecular cloning and expression of
collagenase-3, a novel human matrix metalloproteinase produced by
breast carcinomas. J Biol Chem 269:1676616773[Abstract/Free Full Text]
-
Lorenzo JA, Pilbeam CC, Kalinowski JF, Hibbs MS 1992 Production of both 92- and 72-kDa gelatinases by bone cells.
Matrix 12:282290[Medline]
-
Heath JK, Atkinson SJ, Meikle MC, Reynolds JJ 1984 Mouse osteoblasts synthesize collagenase in response to bone resorbing
agents. Biochim Biophys Acta 802:151154[Medline]
-
Quinn CO, Scott DK, Brinckerhoff CE, Matrisian LM,
Jeffrey JJ, Partridge NC 1990 Rat collagenase: cloning amino acid
sequence comparison and parathyroid hormone regulation in osteoblastic
cells. J Biol Chem 265:2234222347[Abstract/Free Full Text]
-
Reponen P, Sahlberg C, Muhnaut C, Thesleff I, Tryggvason
K 1994 High expression of 92-kDa type IV collagenase (gelatinase
B) in the osteoclast lineage during mouse development. J Biol Chem 124:10911102
-
Tezuka K, Nemoto K, Tezuka Y, Sato T, Ikeda Y, Kobori M,
Kawashima H, Eguchi H, Hakeda Y, Kumegawa M 1994 Identification of
matrix metalloproteinase 9 in rabbit osteoclasts. J Biol Chem 269:1500615009[Abstract/Free Full Text]
-
Hill PA, Murphy G, Docherty AJP, Hembry RM, Millican A,
Reynolds JJ, Meikle MC 1994 The effects of selective inhibitors of
matrix metalloproteinases (MMPs) on bone resorption and the
identification of MMPs and TIMP-1 in isolated osteoclasts. J Cell Sci 107:30553064[Abstract]
-
Hill PA, Docherty AJP, Bottomley KMK, OConnell JP,
Morphy JR, Reynolds JJ, Meikle MC 1995 Inhibition of bone
resorption in vitro by selective inhibitors of gelatinase
and collagenase. Biochem J 308:167175
-
Chambers TJ, Darby JA, Fuller K 1985 Mammalian
collagenase predisposes bone surfaces to osteoclastic resorption. Cell
Tissue Res 241:671675[Medline]
-
Aimes RT, Quigley JP 1995 Matrix
metalloproteinase-2 is an interstitial collagenase. J Biol Chem 270:58725876[Abstract/Free Full Text]
-
Onoe Y, Miyaura C, Kaminakayashiki T, Nagai Y, Noguchi
K, Chen QR, Seo H, Ohta H, Nozawa S, Kudo I, Suda T 1996 IL-13 and
IL-4 inhibit bone resorption by suppressing cyclooxygenase-2-dependent
prostaglandin synthesis in osteoblasts. J Immunol 156:758764[Abstract]
-
Henriet P, Rousseau GG, Eeckhout Y 1992 Cloning and
sequencing of mouse collagenase cDNA. FEBS Lett 310:175178[CrossRef][Medline]
-
Collier IE, Wilhelm SM, Eisen AZ, Marmer BL, Grant GA,
Seltzer JL, Kronberger A, He C, Bauer EA, Goldberg GI 1988 H-ras oncogene-transformed human bronchial epithelial cells (TBE-1)
secrete a single metalloprotease capable of degrading basement membrane
collagen. J Biol Chem 263:65796587[Abstract/Free Full Text]
-
Saus J, Quinones S, Otani Y, Nagase H, Harris ED,
Kurkinen M 1988 The complete primary structure of human matrix
metalloproteinase-3. J Biol Chem 263:67426745[Abstract/Free Full Text]
-
Tanaka H, Hojo K, Yoshida H, Yoshioka T, Sugita K 1993 Molecular cloning and expression of the mouse 105-kDa gelatinase
cDNA. Biochem Biophys Res Commun 190:732740[CrossRef][Medline]
-
Takahashi S, Ito A, Nagino M, Mori Y., Xie B, Nagase
H 1991 Cyclic adenosine 3', 5'-monophosphate suppresses
interleukin-1-induced synthesis of matrix metalloproteinases but not of
tissue inhibitor of metalloproteinases in human uterine cervical
fibroblasts. J Biol Chem 266:1989419899[Abstract/Free Full Text]
-
Morodomi T, Ogata Y, Sasaguri Y, Morimatsu M, Nagase
H 1992 Purification and characterization of matrix
metalloproteinase 9 from U937 monocytic leukaemia and HT1080
fibrosarcoma cells. Biochem J 285:603611
-
Brenner DA, OHara M, Angel P, Chojkier M, Karin
ML 1989 Prolonged activation of jun and collagenase genes by tumor
necrosis factor-
. Nature 337:661663[CrossRef][Medline]
-
Schonthal A, Herrlich P, Rahmsdorf HJ, Ponta H 1988 Requirement for fos expression in the transcriptional activation of
collagenase by other oncogenes and phorbol esters. Cell 54:325334[CrossRef][Medline]
-
McDonnell SE, Kerr LD, Matrisian LM 1990 Epidermal
growth factor stimulation of stromelysin mRNA in rat fibroblasts
requires induction of proto-oncogenes c-fos and c-jun and activation of
protein kinase C. Mol Cell Biol 10:42844293[Abstract/Free Full Text]
-
Frisch S, Morisaki JH 1990 Positive and negative
transcriptional elements of the human type IV collagenase gene. Mol
Cell Biol 10:65246532[Abstract/Free Full Text]
-
Marti H, McNeil L, Davies M, Martin J, Lovett DH 1993 Homology cloning of rat 72 kDa type IV collagenase: cytokine and
second-messenger inducibility in glomerular mesangial cells. Biochem J 291:441446
-
Franchimont N, Rydziel S, Delany AM, Canalis E 1997 Interleukin-6 and its soluble receptor cause a marked induction of
collagenase 3 expression in rat osteoblast cultures. J Biol Chem 272:1214412150[Abstract/Free Full Text]
-
Okada Y, Naka K, Kawamura K, Matsumoto T, Nakanishi I,
Fujimoto N, Sato H, Seiki M 1995 Localization of matrix
metalloproteinase 9 (92-kilodalton gelatinase/type IV collagenase
= gelatinase B) in osteoclasts: implications for bone resorption. Lab
Invest 72:311322[Medline]
-
Jimi E, Shuto T, Koga T 1995 Macrophage
colony-stimulating factor and interleukin-1
maintain the survival of
osteoclast-like cells. Endocrinology 136:808811[Abstract]
-
Murphy G, Cockett MI, Stephens PE, Smith BJ, Docherty
AJP 1987 Stromelysin is an activator of procollagenase. Biochem J 248:265268[Medline]
-
Suzuki K, Enghild JJ, Morodomi T, Salvesen G, Nagase
H 1990 Mechanisms of activation of tissue procollagenase by matrix
metalloproteinase 3. Biochemistry 29:1026110270[CrossRef][Medline]
-
Ogata Y, Enghild JJ, Nagase H 1992 Matrix
metalloproteinase 3 (stromelysin) activates the precursor for the human
matrix metalloproteinases 9. J Biol Chem 267:35813584[Abstract/Free Full Text]
-
Kinoh H, Sato H, Tsunezuka Y, Takino T, Kawashima A,
Okada Y, Seiki M 1996 MT-MMP, the cell surface activator of
proMMP-2 (pro-gelatinase A), is expressed with its substrate in mouse
tissue during embryogenesis. J Cell Sci 109:953959[Abstract]
-
Sato T, Ovejero MC, Hou P, Heegaard AM, Kumegawa M,
Foged NT, Delaisse JM 1997 Identification of the membrane-type
matrix metalloproteinase MT1-MMP in osteoclasts. J Cell Sci 110:589596[Abstract]
-
Knauper V, Will H, Lopez-Otin C, Smith B, Atkinson SJ,
Stanton H, Hembry RM, Murphy G 1996 Cellular mechanisms for human
procollagenase-3 (MMP-13) activation. J Biol Chem 271:1712417131[Abstract/Free Full Text]
-
Ohuchi E, Imai K, Fujii Y, Sato H, Seiki M, Okada Y 1997 Membrane type 1 matrix metalloproteinase digests interstitial
collagens and other extracellular matrix macromolecules. J Biol
Chem 272:24462451[Abstract/Free Full Text]
-
Gack S, Vallon R, Schmidt J, Grigoriadis A, Tuckermann
J, Schenkel J, Weiher H, Wagner EF, Angel P 1995 Expression of
interstitial collagenase during skeletal development of the mouse is
restricted to osteoblast-like cells and hypertrophic chondrocytes. Cell
Growth Differ 6:759767[Abstract]
-
Fuller K, Chambers TJ 1995 Localization of mRNA for
collagenase in osteocytic, bone surface and chondrocytic cells but not
osteoclasts. J Cell Sci 108:22212230[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
S. L. Kominsky, S. M. Abdelmagid, M. Doucet, K. Brady, and K. L. Weber
Macrophage Inflammatory Protein-1{delta}: A Novel Osteoclast Stimulating Factor Secreted by Renal Cell Carcinoma Bone Metastasis
Cancer Res.,
March 1, 2008;
68(5):
1261 - 1266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A.N. Rose, F. Pepin, C. Russo, J. E. Abou Khalil, M. Hallett, and P. M. Siegel
Osteoactivin Promotes Breast Cancer Metastasis to Bone
Mol. Cancer Res.,
October 1, 2007;
5(10):
1001 - 1014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Greenlee, Z. Werb, and F. Kheradmand
Matrix Metalloproteinases in Lung: Multiple, Multifarious, and Multifaceted
Physiol Rev,
January 1, 2007;
87(1):
69 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Inada, C. Matsumoto, S. Uematsu, S. Akira, and C. Miyaura
Membrane-Bound Prostaglandin E Synthase-1-Mediated Prostaglandin E2 Production by Osteoblast Plays a Critical Role in Lipopolysaccharide-Induced Bone Loss Associated with Inflammation
J. Immunol.,
August 1, 2006;
177(3):
1879 - 1885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qi, A. M. Fox, L. G. Alexopoulos, L. Chi, D. Bynum, F. Guilak, and A. J. Banes
IL-1beta decreases the elastic modulus of human tenocytes
J Appl Physiol,
July 1, 2006;
101(1):
189 - 195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. Hall, F. R. Westwood, and P. F. Wadsworth
Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate
Toxicol Pathol,
February 1, 2006;
34(2):
131 - 147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Oka, Y. Kubota, T. Yamashiro, S. Ogata, T. Ninomiya, S. Ito, and K. Shirasuna
Effects of Positive Pressure in Odontogenic Keratocysts
J. Dent. Res.,
October 1, 2005;
84(10):
913 - 918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Choi, H. S. Koh, D. Kluess, D. O'Connor, A. Mathur, G. A. Truskey, J. Rubin, D. X. F. Zhou, and K.-L. P. Sung
Effects of titanium particle size on osteoblast functions in vitro and in vivo
PNAS,
March 22, 2005;
102(12):
4578 - 4583.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Inada, Y. Wang, M. H. Byrne, M. U. Rahman, C. Miyaura, C. Lopez-Otin, and S. M. Krane
Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification
PNAS,
December 7, 2004;
101(49):
17192 - 17197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.-Q. Li, Z. Chen, X. J. Song, L. Luo, and S. C. Pflugfelder
Stimulation of Matrix Metalloproteinases by Hyperosmolarity via a JNK Pathway in Human Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci.,
December 1, 2004;
45(12):
4302 - 4311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Barnes
Mediators of Chronic Obstructive Pulmonary Disease
Pharmacol. Rev.,
December 1, 2004;
56(4):
515 - 548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kitamura, Y. Nakamoto, S. Kaneko, and N. Mukaida
Pivotal roles of interleukin-6 in transmural inflammation in murine T cell transfer colitis
J. Leukoc. Biol.,
December 1, 2004;
76(6):
1111 - 1117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Mori, M. Shibanuma, and K. Nose
Invasive Potential Induced under Long-Term Oxidative Stress in Mammary Epithelial Cells
Cancer Res.,
October 15, 2004;
64(20):
7464 - 7472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth
Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification
Endocr. Rev.,
August 1, 2004;
25(4):
629 - 672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Wright and J. S. Friedland
Regulation of monocyte chemokine and MMP-9 secretion by proinflammatory cytokines in tuberculous osteomyelitis
J. Leukoc. Biol.,
June 1, 2004;
75(6):
1086 - 1092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Selvamurugan, S. Kwok, T. Alliston, M. Reiss, and N. C. Partridge
Transforming Growth Factor-{beta}1 Regulation of Collagenase-3 Expression in Osteoblastic Cells by Cross-talk between the Smad and MAPK Signaling Pathways and Their Components, Smad2 and Runx2
J. Biol. Chem.,
April 30, 2004;
279(18):
19327 - 19334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. G. Sandler, M. M. Mentink-Kane, A. W. Cheever, and T. A. Wynn
Global Gene Expression Profiles During Acute Pathogen-Induced Pulmonary Inflammation Reveal Divergent Roles for Th1 and Th2 Responses in Tissue Repair
J. Immunol.,
October 1, 2003;
171(7):
3655 - 3667.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Matsuyama, N. Sakai, M. Ishigami, H. Hiraoka, S. Kashine, A. Hirata, T. Nakamura, S. Yamashita, and Y. Matsuzawa
Matrix Metalloproteinases as Novel Disease Markers in Takayasu Arteritis
Circulation,
September 23, 2003;
108(12):
1469 - 1473.
[Abstract]
[Full Text]
[PDF]
|
![]() |