| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Medicine, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599
Address all correspondence and requests for reprints to: David R. Clemmons, M.D., Division of Endocrinology, CB no. 7170, 6111 Thurston-Bowles Building, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599-7170.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Assessment of proteolysis
To determine the degree of IGFBP-4 proteolysis, approximately
2.0 µg/ml IGFBP-4 was added to 0.05 ml of 0.5 M Tris (pH
7.4) containing 4 mM CaCl2, and the mixture was
incubated with varying amounts of pSMC-conditioned medium (25–40 µl)
that contained the IGFBP-4 protease, for 36 h at 37 C. IGF-1 (1.0
µg/ml) was also added to the incubation buffer. After this
incubation, 50 µl was removed, and the reaction products were
separated by SDS-PAGE, as previously described (13). The proteins were
transferred to immobilon-P membranes (Millipore, Inc., Bedford, MA) and
were immunoblotted using a 1:1000 dilution of antihuman IGFBP-4 rabbit
serum (7). Immune complexes were visualized with the Proto-Blot system
(Promega, Madison, WI) using the manufacturer’s recommended protocol.
An alkaline phosphatase-conjugated second-antibody detection system was
used to detect immunoreactive IGFBP-4 and its fragments.
Identification of the proteolytic cleavage site
To determine the proteolytic cleavage site, 200 cc
pSMC-conditioned medium was collected by incubating 20 confluent 10-cm
cultures with 10 ml serum-free medium for 24 h. This medium was
chromatographed over heparin sepharose (Pharmacia Biotech, Piscataway,
NJ), as previously described. The IGFBP-4 protease was eluted with 0.6
M NaCl (7). The pool of active fractions was concentrated
8-fold on a Biomax filter (Millipore, Inc.). The concentrated
material (5 µl) was incubated with 10 µg human IGFBP-4 for 24
h at 37 C. The human IGFBP-4 had been purified to homogeneity, as
described previously (9). The products of the reaction were separated
by high-pressure electrophoresis using an Applied Biosystems (Palo
Alto, CA) model 230A high-pressure tube gel separatory apparatus. This
material was separated using a gel (10%) in 75 mM
Tris-phosphate (pH 7.5), 0.1% SDS for 14 h at 120 mV. The eluted
fractions were analyzed to determine exact fragment size and
homogeneity by SDS-PAGE with immunoblotting for IGFBP-4. The method was
found to reproducibly separate fragments with as little as a 2.0-kDa
difference. The N-terminal sequence of each fragment was determined by
Edman degradation, as described previously (14).
In vitro mutagenesis
To determine whether the cleavage site that was identified was
correct, in vitro mutagenesis was used. The IGFBP-4
complementary DNA that had been cloned to the pRc RSV vector
(Invitrogen, Carlsbad, CA) was used as a template for mutagenesis (15, 16), and an oligonucleotide with the following sequence: 5' c c t g c a
g a a a1 a1 a c t t c g c c a 3', which contained two base
substitutions that would change lysine120 and
histidine121 to asparginines was used. The method has been
previously published (16, 17). Briefly, 2 ng plasmid DNA was used to
transform Escherichia coli (strain no. CJ-236), which was
then superinfected with a helper phage R408. The secreted phagemid
particles were precipitated with 8% polyethylene glycol, and the
single-stranded DNA was then isolated by adherence to Glass Milk (Bio
101, Vista, CA). Complementary oligonucleotides containing bp
mismatches were then phosphorylated with T4 polynucleotide
kinase (New England Biolabs, Beverly, MA) and annealed to the IGFBP-4
template using a 30:1 molar ratio. Second-strand synthesis was
initiated by adding 2.5 U T4 DNA polymerase and 2 U DNA
ligase (Boerhinger Mannheim, Indianapolis, IN). Ten microliters of
synthesis mixture was used to transform 100 µl of competent
Escherichia coli (strain no. DH5
F’), and
ampicillin-resistant colonies were obtained. Six colonies were
amplified and sequenced. Sequencing verified that the correct mutations
were present. The plasmid, containing the altered IGFBP-4 sequence in
the correct orientation, was directly transfected into Chinese hamster
ovary (CHO) K-1 cells (Lineberger Cancer Research Center, Chapel Hill,
NC) using the poly(L)ornithine (Sigma) method (18). The cells
were grown to confluence in medium containing 400 µg/ml G-418
(Life Technologies), and the concentration of IGFBP-4 in the medium was
determined by immunoblotting. The cultures secreting the highest
concentration of mutant protein were then amplified.
Preparation of mutants containing the FLAG epitope and
determination of binding affinities for IGF-1
A second mutant IGFBP-4 construct was prepared using a
synthetic oligonucleotide that encodes the FLAG epitope. This 8-amino
acid extension (DYKDDDDK) was used to make possible the efficient
separation of the expressed human IGFBP-4 from Chinese hamster IGFBP-4
that is constitutively secreted by CHO cells. The oligonucleotide
contained the sequence
(ggcccggctcggatccactgatgttctgctgctgctgttctgcttcggtagg) that encoded the
last 6 amino acids of the human IGFBP-4 propeptide, the 8 amino acids
of the FLAG epitope, and the first 5 amino acids of the human IGFBP-4
peptide. Single-stranded mutagenesis was used exactly as described for
preparation of the IGFBP-4 mutant. Both the pRc plasmids containing the
full protein coding region of IGFBP-4, with substitutions for
lysine120, histidine121, and the full-length
wild-type IGFBP-4 sequences were used as templates. The insertion of
the FLAG epitope was confirmed by DNA sequencing (19). These plasmids
were used to transfect CHO cells, as described previously (9). After
selection and amplification in G-418-containing medium, the cultures
secreting the highest concentrations of either form of FLAG IGFBP-4
were identified by immunoblotting using specific anti-FLAG antiserum
(Eastman Kodak, Rochester, NY). Two liters of conditioned medium from
each of the four transfected cell lines was obtained, and the IGFBP-4
in each sample was purified by a 3-step purification described
previously (15). To separate Chinese hamster IGFBP-4 that is produced
by the CHO cells from human IGFBP-4, a specific immunoaffinity column
was used. The FLAG epitope-containing proteins that had been purified
as described previously were applied to the column containing 2.0 ml
anti-FLAG M2 affinity gel (Eastman Kodak) that had been
equilibrated with a buffer containing 0.05 M Tris, 150
mM NaCl, 2 mM CaCL2, pH 7.40. The
sample was eluted with 0.1 M glycine HCL, pH 3.0, using a
flow rate of 0.5 ml/min. Homogeneity of the eluted IGFBP-4 was
determined by SDS-PAGE with silver staining and by amino acid
sequencing. The amount of protein was estimated by comparing the HPLC
peak area in the final purification step to known concentrations of
IGFBP-4 that had been determined by amino acid composition
analysis.
To verify that the mutants did not have alterations in their affinities for IGF-1, increasing concentrations of IGF-1 (1–40 ng/ml), 5 ng/ml of each form of IGFBP-4, and 20,000 cpm 125I-IGF-1 were added to 0.5 cc of 0.025 M Tris, pH 7.0, 0.25% polyethylene glycol. After 14 h at 4 C, the IGFBP-4 was precipitated by adding 15% polyethylene glycol. The pellets were washed once and then counted (13). The affinity of each form of IGFBP-4 for IGF-1 was calculated using Scatchard analysis and was compared with wild-type IGFBP-4. No alteration in affinity was detected. The affinity constants were as follows: native IGFBP-4 (1.6 x 10-9 M-1) K120N, H121N; IGFBP-4 (1.2 x 10-9 M-1); FLAG IGFBP-4 (1.9 x 10-9 M-1); and FLAG K120N, H121N, IGFBP-4 (2.1 x 10-9 M-1).
To determine whether the mutants were resistant to proteolysis, 2.0 µg/ml of the FLAG containing wild-type IGFBP-4, or both the FLAG or non-FLAG containing K120N, H121N mutants were incubated with 20 µl of the partially purified IGFBP-4 protease and 1.0 µg/ml IGF-1 for 16 h at 37 C, as previously described (7, 20). The products were analyzed by immunoblotting.
Assessment of 3H-thymidine incorporation
To determine whether failure to cleave IGFBP-4 would alter the
cellular replication response to IGF-1, quiescent pSMC cultures were
plated in 96-well plates at a density of 5000 cells/well. After 5 days,
they were exposed to 0.2 cc DME containing 0.2% human platelet poor
plasma, 0.5 µCi 3H-thymidine (16 Ci/mM; ICN
Biochemicals, Costa Mesa, CA), increasing concentrations of
IGF-1 (2–50 ng/ml), and a constant amount of IGFBP-4 (500 ng/ml).
Additional cultures were exposed to 20 ng/ml IGF-1 and increasing
concentrations of wild-type or K120N, H121N IGFBP-4 (50–500 ng/ml).
After 36 h, the amount of 3H-thymidine that was
incorporated into DNA was determined (21).
Measurement of cell migration
To analyze the effects of the IGFBP-4 mutants on
IGF-1-stimulated pSMC migration, confluent monolayers were prepared
using 6-well (35-mm) plates (Falcon 3036). The monolayers were wounded
with a single-edge razor blade, as described by Jones et al.
(22). The plate was rinsed once and incubated in DME containing 0.2%
FBS with IGF-1 (100 ng/ml) and IGFBP-4 (500 ng–2.5 µg/ml) for
48 h at 37 C. The cells were fixed and stained with methylene
blue, then the mutant number of cells that migrated across the wound
edge was determined as described previously (22). Each data point
represents the mean of 7–9, 1-mm regions that were selected
immediately after wounding.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, lanes 1 and 2). The
primary cleavage site used by the pSMC protease was determined by
sequence analysis to be lysine120,
histidine121. This site was mutated by converting the
charged residues to asparginines; and the K120N, H121N IGFBP-1 was
purified. When K120N, H121N IGFBP-4 was incubated with the protease,
there was less cleavage, but a fragment was easily detected (Fig. 1A, lanes 3 and 4). To determine whether that fragment was derived from
nonmutated Chinese hamster ovary (CHO) IGFBP-4, nonmutated, human
IGFBP-4 containing the FLAG epitope was expressed. Two bands were noted
in the purified starting material; and based on the fragment sizes that
were detected, both bands seemed to be cleaved (Fig. 1A, lanes 5 and
6). Insertion of the FLAG epitope resulted in no change in the ability
of IGFBP-4 to be cleaved by the protease. To determine whether one of
the two bands was CHO-secreted IGFBP-4 and whether one was human
IGFBP-4 that contained the FLAG epitope, this material was further
purified by immunoaffinity chromatography using the specific anti-FLAG
column, as described in Materials and Methods. Analysis of
the purified, FLAG-containing wild-type IGFBP-4 showed that the
lower molecular mass form of intact IGFBP-4 was not present and that
the upper band that remained after purification was cleaved (Fig. 1A, lanes 7 and 8). To confirm that the lower band represented CHO-derived
IGFBP-4, the FLAG containing K120N, H121N IGFBP-4 that had not been
affinity purified was analyzed. As shown in lanes 9 and 10, the upper
band intensity was unchanged, whereas the lower band was decreased. To
further confirm that the K1210N, H121N FLAG IGFBP-4 was stable, the
immunopurified mutant was analyzed. No cleavage was detected after
14 h (lanes 11 and 12). To confirm that the higher molecular mass
form of IGFBP-4 contained the FLAG epitope, both the purified and
nonpurified forms were analyzed by immunoblotting using anti-FLAG
antiserum (Fig. 1B). Only the higher molecular band was detected with
the FLAG antiserum. Importantly, the wild-type IGFBP-4 containing the
FLAG epitope was degraded by the IGFBP-4 protease, indicating that
insertion of the FLAG sequence had no effect on its susceptibility to
degradation. The results show definitively that K120N, H121N IGFBP-4
and FLAG K120, H121N IGFBP-4 are resistant to cleavage.
|
). To determine the capacity of the
proteolytically generated fragments to bind IGF-1, ligand blotting was
performed. As shown in Fig. 3, after
cleavage of the FLAG- or non-FLAG-containing wild-type IGFBP-4, the
fragments that were generated had lost the ability to bind to IGF-1. In
contrast, when mutant FLAG and non-FLAG forms of IGFBP-4 were analyzed,
they remained intact, and the intact proteins bound to
125I-IGF-1.
|
|
).
Second, increasing concentrations of the FLAG-containing K120N, H121N
mutant and FLAG-containing wild-type IGFBP-4 were added to pSMC
cultures in the presence of 20 ng/ml IGF-1. The DNA synthesis response
to IGF-1 was completely inhibited by 500 ng/ml of FLAG K120H, H121H
IGFBP-4, and a significant inhibitory effect on the DNA synthesis
response could be detected at 100 ng/ml (Fig. 5). In contrast, nonmutated FLAG IGFBP-4
did not inhibit the response to IGF-1 until 500 ng/ml was added, and
then the inhibition was minimal, e.g. 21% (Fig. 5). These
results suggested that K120N, H121N IGFBP-4 results in significant
inhibition of IGF-1 response and that it is much more potent than
wild-type IGFBP-4. When the products of the reaction at the end of the
DNA synthesis experiment were analyzed by immunoblotting, no cleavage
of FLAG K120N, H121N IGFBP-4 was detected. When the medium from the
cultures that were exposed to 500 ng/ml wild-type IGFBP-4 was analyzed,
IGFBP-4 was found to be nearly completely cleaved (Fig. 6). Thus, it seems that mutagenesis of
the proteolytic cleavage site resulted in resistance to proteolytic
cleavage and maintenance of a large concentration of intact protein,
which resulted in inhibition of IGF-1 responsiveness.
|
|
|
). Coincubation with 500 ng/ml of native
IGFBP-4 resulted in no inhibition of migration, and 2.5 µg/ml had
only a minimal effect (e.g. 93 ± 21% increase). An
equal concentration of K120N, H121N IGFBP-5 resulted in 94 ± 8%
(P < 0.001) inhibition of the IGF-1-stimulated
response.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). However, a small amount of IGFBP-4 fragment was still
detectable. Because CHO cells also secrete IGFBP-4, we assumed that the
cleavage fragment that was detected arose from this nonmutated form of
Chinese hamster IGFBP-4. To confirm that hypothesis, we prepared a
second complementary DNA construct that contained the FLAG epitope.
Human K120N, H121N IGFBP-4 was separated from CHO-derived IGFBP-4 by
affinity chromatography. When the purified, FLAG-containing K120N,
H121N IGFBP-4 was analyzed by immunoblotting, there was a single band;
and after a prolonged incubation with the protease, no fragments were
detected by immunoblotting. This confirmed that lysine120,
histidine121 was the correct cleavage site and that the
native CHO-derived IGFBP-4 had been removed.
A small amount of a peptide (<10% of the total), beginning with
lysine136, was detected when wild-type IGFBP-4 was degraded
by the protease and the fragments were sequenced. This site has
previously been reported to be the cleavage site from an IGFBP-4
protease that is secreted by human fibroblasts (10). In contrast, this
peptide was not detected after prolonged exposure of K120N, H121N to
the IGFBP-4 protease (Fig 2B), indicating that the
methionine135, lysine136 site was not used.
Therefore, it seems that lysine120,
histidine121 is the primary cleavage site within human
IGFBP-4 that is used by the pSMC IGFBP-4 protease. Subsequently, a
small amount of the 121–232 peptide is further cleaved at
methionine135, lysine136.
To determine whether mutagenesis or insertion of the FLAG epitope resulted in a major change in the affinity of IGFBP-4 for IGF-1, Scatchard analysis was performed. Neither substitution for the two amino acids at the cleavage site nor insertion of the FLAG epitope resulted in a change in affinity. This suggests that K120N, H121N IGFBP-4 mutant is a useful reagent for analyzing the biologic activity of IGF-1 in this system.
To determine the effect of the IGFBP-4 mutant on IGF-1 actions, two
types of experiments were performed. Addition of the mutant protein,
using a 5:1 molar excess of IGFBP-4 over IGF-1, was shown to completely
inhibit the cellular DNA synthesis response to added IGF-1. It
inhibited the IGF-1-stimulated response dose dependently, and even a
2:1 molar excess ratio of IGFBP-4 to IGF-1 resulted in significant
reduction in IGF-1 responsiveness. In this regard, it seems to be more
potent than IGFBP-5 (8). To determine whether this mutant peptide would
affect other IGF-1 actions, cell migration was measured. As can be seen
in Table 1, concentrations as low as a 1.5:1 molar excess ratio of
mutant IGFBP-4 to IGF-1 resulted in significant attenuation of the cell
migration response, and a 4:1 molar excess completely inhibited the
cellular migration response to IGF-1. Because cleavage of IGFBP-4
results in a major reduction of affinity of the generated fragments for
IGF-1, this suggests that the protein is acting to block the DNA
synthesis and cell migration responses of pSMC by inhibiting the
association of IGF-1 with its receptor and that this mutant will be
very useful in determining the actions of IGF-1 in target cell systems
in vivo.
It is not completely possible to extrapolate these findings to a physiologic system in which no IGF-1 is added. However, IGFBP-4 inhibited the effect of 5 ng/ml IGF-1 on DNA synthesis, and this is a concentration that occurs in many in vitro test systems. The SMC migration assay requires higher concentrations of IGF-1, e.g. 100 ng/ml, to achieve reproducible stimulation of migration in 48 h. Therefore, it is difficult to make direct comparisons regarding the effect of IGFBP-4 on cell migration to physiologic test systems wherein 100 ng/ml of IGF-1 is usually not present.
Several cell types, including human fibroblasts (10, 20, 23), human decidual (24), vascular SMC (7) (25), glial B104 cells (9), and osteoblasts (26, 27) have been shown to secrete IGFBP-4 proteases. Whether all these proteases are identical is unclear, but our results indicate that the pSMC and B104 proteases use the same cleavage site. Whether the IGFBP-4 protease is expressed in smooth muscle in vivo has not been definitively determined. However, Wang and co-workers have transfected IGFBP-4 into aortic and bladder SMC. Extraction of these tissues has shown cleavage of the intact peptide into fragments, suggesting that cleavage does occur in vivo (28). Furthermore, using an SMC-specific promoter, Wang et al. showed that IGFBP-4 levels were increased 10-fold in aorta and bladder, and this was associated with SMC hypoplasia. This indicates that IGF-1 is an important growth factor for smooth muscle in vivo and that IGFBP-4 can act as an inhibitor.
IGF-1 is an important growth factor of aortic SMC, and its expression is altered in atherogenesis. Specifically, IGF-1 messenger RNA has been shown to increase after balloon denudation of the aorta in rats (29). More importantly, in human atherectomy specimens, IGF-1 expression has been shown to be markedly up-regulated (30). Because SMC possess IGF-1 receptors and respond to IGF-1 with both hypertrophy and hyperplasia, this suggests that up-regulation of IGF-1 synthesis may be an important component of the atherosclerotic process. IGF-1 stimulates not only increases in cell growth, but it also stimulates SMC protein synthesis (8) and cell migration (31); therefore, there are multiple potential mechanisms by which IGF-1 may stimulate SMC accumulation and enlargement within lesions. IGFBP-2 and -4 have been shown to inhibit IGF-1 actions in SMC. Specifically, when adequate amounts of intact proteins are added in vitro, they can overwhelm the effect of IGFBP proteases and lead to inhibition of IGF-1 action (9, 11). In contrast to IGFBP-4, the addition of IGFBP-5 to extracellular matrix (ECM) can result in a marked reduction in IGFBP-5 affinity for IGF-1 and augmentation of the effect of IGF-1 on cell growth (32). However, if proteolysis of IGFBP-5 is totally inhibited, and a 5:1 molar excess of IGFBP-5 to IGF-1 is added, this will overcome the stimulatory effect of ECM-associated IGFBP-5 and result in growth inhibition (8). The results from this study indicate that protease-resistant IGFBP-4 is a more potent inhibitor of IGF-1-stimulated DNA synthesis, compared with protease-resistant IGFBP-5 (e.g. a 1.5:1 ratio resulted in significant inhibition). This is probably caused by the fact that, unlike IGFBP-5, IGFBP-4 does not bind to ECM, and the addition of lower concentrations has no potentiating effect on IGF-1 actions.
Because all three forms of IGFBPs are synthesized by smooth muscle, it will be important in future studies to determine how coordinate regulation of these three proteins results in alterations in IGF-1 action. We have determined that SMC cultures, at high density, synthesize and release substantially less IGFBP-5, and this may mediate part of the density-dependent growth inhibition that occurs in these cultures (33). In contrast, high-density cultures have substantially lower amounts of IGFBP-4 proteolytic activity; and consequently, they have much higher concentrations of intact IGFBP-4, compared with low-density cultures. These findings suggest that there is coordinate regulation between IGFBP-4 and -5 in mediating density-dependent attenuation of growth responsiveness to IGF-1 in SMC. In contrast, IGFBP-2 is not regulated by changes in cell density, and its role in regulating SMC hyperplasia has not been definitively determined.
In summary, IGFBP-4 is cleaved into two non-IGF binding fragments by a serine protease in SMC medium. Mutagenesis of the cleavage site results in a form of IGFBP-4 that is not cleaved and is a potent inhibitor of IGF-1 action. IGFBP-4 is substantially more potent than IGFBP-5 in inhibiting IGF-1 action, and this is probably secondary to its inability to bind to ECM and potentiate IGF-1 actions. Future studies should be directed toward determining the major variables that control the synthesis and processing of this protease by SMC, because this may be an important mechanism by which these cells autoregulate their responsiveness to IGF-1. Likewise, determining whether macrophages and other cell types within atherosclerotic lesions produce this protease will be an important focus of future studies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received February 20, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia.
Endocrinology 139:2605–2614This article has been cited by other articles:
 |
|
 |
|
  T. C. Nichols, W. H. Busby Jr., E. Merricks, J. Sipos, M. Rowland, K. Sitko, and D. R. Clemmons Protease-Resistant Insulin-Like Growth Factor (IGF)-Binding Protein-4 Inhibits IGF-I Actions and Neointimal Expansion in a Porcine Model of Neointimal Hyperplasia Endocrinology, October 1, 2007; 148(10): 5002 - 5010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. T. Resch, R. D. Simari, and C. A. Conover Targeted Disruption of the Pregnancy-Associated Plasma Protein-A Gene Is Associated with Diminished Smooth Muscle Cell Response to Insulin-like Growth Factor-I and Resistance to Neointimal Hyperplasia after Vascular Injury Endocrinology, December 1, 2006; 147(12): 5634 - 5640. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P A Rooman, L. O. De Beeck, M. Martin, J. van Doorn, S. Mohan, and M. V L Du Caju Ethinylestradiol and testosterone have divergent effects on circulating IGF system components in adolescents with constitutional tall stature Eur. J. Endocrinol., April 1, 2005; 152(4): 597 - 604. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Firth and R. C. Baxter Cellular Actions of the Insulin-Like Growth Factor Binding Proteins Endocr. Rev., December 1, 2002; 23(6): 824 - 854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, E. P. Smith, H. Kuroda, W. Banach, S. D. Chernausek, and J. A. Fagin Targeted Expression of a Protease-resistant IGFBP-4 Mutant in Smooth Muscle of Transgenic Mice Results in IGFBP-4 Stabilization and Smooth Muscle Hypotrophy J. Biol. Chem., June 7, 2002; 277(24): 21285 - 21290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B.-K. Chen, M. T. Overgaard, L. K. Bale, Z. T. Resch, M. Christiansen, C. Oxvig, and C. A. Conover Molecular Regulation of the IGF-Binding Protein-4 Protease System in Human Fibroblasts: Identification of a Novel Inducible Inhibitor Endocrinology, April 1, 2002; 143(4): 1199 - 1205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Clemmons Use of Mutagenesis to Probe IGF-Binding Protein Structure/Function Relationships Endocr. Rev., December 1, 2001; 22(6): 800 - 817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. P. Smith, A. Kamyar, W. Niu, J. Wang, B. Cercek, S. D. Chernausek, and J. A. Fagin IGF-Binding Protein-4 Expression and IGF-Binding Protein-4 Protease Activity Are Regulated Coordinately in Smooth Muscle During Postnatal Development and After Vascular Injury Endocrinology, October 1, 2001; 142(10): 4420 - 4427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.M. Rivera, Y.A. Chandrasekher, A.C.O. Evans, L.C. Giudice, and J.E. Fortune A Potential Role for Insulin-Like Growth Factor Binding Protein-4 Proteolysis in the Establishment of Ovarian Follicular Dominance in Cattle Biol Reprod, July 1, 2001; 65(1): 102 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Gimbel, D. Chelius, T. K. Hunt, and E. M. Spencer A Novel Approach to Reducing Postoperative Intraperitoneal Adhesions Through the Inhibition of Insulinlike Growth Factor I Activity Arch Surg, March 1, 2001; 136(3): 311 - 317. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Fernandez-Celemin and J.-P. Thissen Interleukin-6 Stimulates Hepatic Insulin-Like Growth Factor Binding Protein-4 Messenger Ribonucleic Acid and Protein Endocrinology, January 1, 2001; 142(1): 241 - 248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. SCHNEIDER, H. LAHM, M. WU, A. HOEFLICH, and E. WOLF Transgenic mouse models for studying the functions of insulin-like growth factor-binding proteins FASEB J, April 1, 2000; 14(5): 629 - 640. [Abstract] [Full Text]
|
|
|
|
 |
|
 I. Demori, S. Balocco, A. Voci, and E. Fugassa Increased insulin-like growth factor binding protein-4 expression after partial hepatectomy in the rat Am J Physiol Gastrointest Liver Physiol, March 1, 2000; 278(3): G384 - G389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Anwar, A. A. Zahid, L. Phillips, and P. Delafontaine Insulin-Like Growth Factor Binding Protein-4 Expression Is Decreased by Angiotensin II and Thrombin in Rat Aortic Vascular Smooth Muscle Cells Arterioscler. Thromb. Vasc. Biol., February 1, 2000; 20(2): 370 - 376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Byun, S. Mohan, C. Kim, K. Suh, M. Yoo, H. Lee, D. J. Baylink, and X. Qin Studies on Human Pregnancy-Induced Insulin-Like Growth Factor (IGF)-Binding Protein-4 Proteases in Serum: Determination of IGF-II Dependency and Localization of Cleavage Site J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 373 - 381. [Abstract] [Full Text]
|
|
|
|
|
|
V. Hwa, Y. Oh, and R. G. Rosenfeld The Insulin-Like Growth Factor-Binding Protein (IGFBP) Superfamily Endocr. Rev., December 1, 1999; 20(6): 761 - 787. [Abstract] [Full Text]
|
|
|
|
|
|
D. R. Clemmons, G. Horvitz, W. Engleman, T. Nichols, A. Moralez, and G. A. Nickols Synthetic {alpha}V{beta}3 Antagonists Inhibit Insulin-Like Growth Factor-I-Stimulated Smooth Muscle Cell Migration and Replication Endocrinology, October 1, 1999; 140(10): 4616 - 4621. [Abstract] [Full Text]
|
|
|
|
|
|
S. Mazerbourg, J. Zapf, R. S. Bar, D. R. Brigstock, C. Lalou, M. Binoux, and P. Monget Insulin-Like Growth Factor Binding Protein-4 Proteolytic Degradation in Ovine Preovulatory Follicles: Studies of Underlying Mechanisms Endocrinology, September 1, 1999; 140(9): 4175 - 4184. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. C. Martin, J. L. Fowlkes, B. Babic, and R. Khokha Insulin-like Growth Factor II Signaling in Neoplastic Proliferation Is Blocked by Transgenic Expression of the Metalloproteinase Inhibitor TIMP-1 J. Cell Biol., August 23, 1999; 146(4): 881 - 892. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||
—
