Endocrinology Vol. 138, No. 7 2820-2828
Copyright © 1997 by The Endocrine Society
Glucocorticoid-Induced Differentiation of Fetal Rat Calvarial Osteoblasts Is Mediated by Bone Morphogenetic Protein-6
Scott D. Boden,
Gregory Hair,
Louisa Titus,
Michele Racine,
Kimberly McCuaig,
John M. Wozney and
Mark S. Nanes
Department of Orthopaedic Surgery and Division of Endocrinology,
Emory University School of Medicine and Veterans Affairs Medical
Center, Atlanta, Georgia 30033
Address all correspondence and requests for reprints to: Scott D. Boden, M.D., The Emory Spine Center, 2165 North Decatur Road, Decatur, Georgia 30033.
 |
Abstract
|
|---|
Glucocorticoids (GCs) at physiological concentrations promote
osteoblast differentiation from fetal calvarial cells, calvarial organ
cultures, and bone marrow stromal cells; however, the cellular pathways
involved are not known. Bone morphogenetic proteins (BMPs) are
recognized as important mediators of osteoblast differentiation.
Specific roles for individual BMPs during postembryonic membranous bone
formation have yet to be determined. We recently reported that GC
potentiated the osteoblast differentiation effects of BMP-2 and BMP-4,
but not of BMP-6, which, by itself, was the most potent of the three.
In the present study, we used fetal rat secondary calvarial cultures to
study the role of BMP-6 during early osteoblast differentiation.
Treatment with the GC triamcinolone (10-9 M)
resulted in a 5- to 8-fold increase in BMP-6 steady-state messenger RNA
levels, peaking at 12 h. In contrast, BMPs -2, -4, -5, -7, and
transforming growth factor (TGF)-ß1 messenger RNA levels increased by
less than 2-fold, after GC treatment, compared with untreated control
cultures at 24 h. BMP-6 protein secretion increased 6- to 7-fold
by 12 h and 12-fold (from 7.5 to 90 ng/ml) by 24 h, as
measured by quantitative Western analysis. Treatment of cells with
oligodeoxynucleotides antisense to BMP-6 diminished secretion of BMP-6
protein and significantly inhibited the GC-induced differentiation, as
determined by a 10-fold decrease in the number of mineralized bone
nodules, compared with controls that were treated with sense
oligonucleotides or no oligonucleotides (ANOVA, P
< 0.05). The antisense oligonucleotide inhibition of differentiation
was rescued by treatment with exogenous recombinant human BMP-6. We
conclude that GC-induced differentiation of osteoblasts from the
pluripotent precursors is mediated, in part, by BMP-6. These results
suggest that BMP-6 has an important and unique role during early
osteoblast differentiation.
 |
Introduction
|
|---|
OSTEOBLASTS ARE thought to be derived from
pluripotent mesenchymal stem cells. Although glucocorticoids (GCs) at
pharmacologic doses inhibit osteoblast function (1, 2), GCs at
physiological concentration can promote osteoblast differentiation from
mesenchymal precursors and enhance expression of the mature osteoblast
phenotype. GCs can promote increased numbers of nodules and higher
levels of osteocalcin secretion in primary and secondary rat calvarial
cell cultures (3, 4, 5). Similar results have been observed in chick
osteoblast cultures (6) and bone organ cultures (7). GCs also have been
noted to induce osteoblastic expression in chick, mouse, rat, and human
marrow stromal cell cultures (8, 9, 10, 11, 12, 13, 14, 15). The mechanism by which GCs
promote osteoblast differentiation is unknown.
Bone morphogenetic proteins (BMPs) are growth factors found in bone
matrix that have been shown to be important regulators of membranous
and endochondral bone formation (16, 17). A synergism between GCs and
BMP-2 for induction of osteoblast differentiation from marrow
stromal cells has been reported (8). We recently extended
that observation to a fetal rat calvarial cell culture model and
demonstrated GC potentiation of the differentiating effect of BMP-2 and
BMP-4 but only minimal potentiation of the effects of BMP-6. In our
culture model, BMP-6 had a greater effect on differentiation than BMP-2
or BMP-4, as measured by discrete mineralized nodule formation (5).
In this investigation, we explored the mechanism of GC stimulation of
osteoblast differentiation and the possible mediation of GC action by
BMP-6. We found that GC treatment results in a significant and
selective increase in BMP-6 message levels and protein expression.
Furthermore, blocking the expression of BMP-6 protein, using antisense
deoxyoligonucleotides, resulted in a loss of the GC effect on
differentiation that could be rescued only with exogenous recombinant
human (rh)BMP-6. These results suggest that BMP-6 is an important early
mediator in osteoblast differentiation.
 |
Materials and Methods
|
|---|
Materials
rhBMP-2, -4, and -6, produced in Chinese hamster ovary cells,
were obtained from Genetics Institute (Cambridge, MA). MEM supplemented
with L-glutamine was purchased from GIBCO BRL
(Gaithersburg, MD); BGJb bone culture medium, the GC
triamcinolone acetonide, ß-glycerophosphate (ß-GlyP), and ascorbic
acid from Sigma (St. Louis, MO); and heat-inactivated FBS from HyClone
(Logan, UT). Timed pregnant Sprague-Dawley rats were purchased from
Charles River Laboratories (Raleigh, NC).
Calvarial cell preparation
After approval by the Institutional Animal Care and Use
Committee, fetal Sprague-Dawley rats were removed at 20-days gestation
and decapitated and the heads submerged in sterile PBS with 1%
penicillin/streptomycin-5000 U (GIBCO). The crania were dissected using
sterile technique in the laminar flow hood. Parietal and frontal bones
were dissected free from the sutures and subjected to four collagenase
digestions (type 1:type II = 6:1). The specific activity of
collagenase (Worthington Enzymes, Freehold, NJ) was 43 IU/ml in the
first digestion and 172 IU/ml for the remaining three digestions. All
digestions were carried out at 32 C for 20 min each. Cells from the
latter two digestions were pooled to provide a rat osteoblastic
(rOB)-enriched cell suspension (5). The pooled cells were washed,
pelleted, resuspended in MEM/10% FBS, counted by hemocytometer, and
seeded in T-75 vented flasks (Corning, Corning, NY) at 1 x
106 cells/flask. Cells were grown at 37 C in 5%
CO2 with humidification. The cells were fed at 48 h
and again at 96 h with MEM/10% FBS. Seven days after seeding, the
primary culture was trypsinized and passed into 6-well plates at 1
x 105 cells/35-mm well) as first subculture cells. Cells
were grown for an additional 7 days, during which time they reached
second confluence (day zero). Beginning on day 0, media were changed
and treatments (GCs and/or cytokines) were applied under a laminar-flow
hood every 34 days. The standard culture protocol was as follows:
days 07 = MEM, 10% FBS, 50 µg/ml ascorbic acid; days
814 = BGJb medium, 10% FBS, 5 mM
ß-GlyP (as a source of inorganic phosphate to permit mineralization).
Alternatively, for stimulus switch/change experiments: days 03 =
MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 1; days
47 = MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 2;
days 814 = BGJb medium, 10% FBS, 5 mM
ß-GlyP. Endpoint analysis of bone nodule formation and osteocalcin
secretion was performed at day 14.
The dose of rhBMP-6 was chosen as 50 ng/ml, based on pilot experiments
in this system that demonstrated a midrange effect on the dose response
curve. The dose of triamcinolone (GC) was chosen as 1 nM,
based on previous dose-response experiments in this culture system
(5).
Quantitation of bone formation
Cultures were fixed overnight in 70% ethanol and stained with
von Kossa silver stain. A semiautomated computerized video image
analysis system (Optomax 5, Optomax, Hollis, NH) was used to quantitate
nodules in each well. This automated technique was validated previously
against a manual counting technique and demonstrated an r value of 0.92
(P < 0.000001) (5). All data are expressed as the
mean ± SEM, calculated from 56 wells at each
condition. Each experiment was reconfirmed at least two times using
cells from different calvarial preparations.
Quantitation of osteocalcin secretion
Osteocalcin levels in the medium were measured using a
competitive RIA with a monospecific polyclonal antibody (PAb) raised in
our laboratory against the C-terminal octapeptide of rat osteocalcin,
as described previously, except for use of an acetylated peptide analog
as radioligand and standard (18). Osteocalcin values were reported as
pmol/ml medium (3-day production). Values are expressed as the
mean ± SEM of triplicate determinations for 56
wells for each condition. Each experiment was reconfirmed at least two
times using cells from different calvarial preparations.
RNA extraction and purification
Cellular RNA from duplicate 35-mm wells (6-well culture dish)
was harvested to yield statistical triplicates using 4 M
guanidine isothiocyanate solution (19). Briefly, medium was aspirated
from wells, wells overlaid with 0.6 ml guanidine isothiocyanate
solution per duplicate, and plates swirled for 510 sec. Samples were
stored at -70 C for up to 7 days before being processed.
RNA was purified by a modification of standard methods (19). Briefly,
thawed samples received 60 µl 2.0 M sodium acetate (pH
4.0), 550 µl phenol (water saturated), and 150 µl
chloroform:isoamyl alcohol (49:1); were vortexed, centrifuged
(10,000 x g; 20 min; 4 C); the aqueous phase
transferred to a fresh tube; and the RNA precipitated overnight (-20
C) upon addition of 600 µl isopropanol.
Samples were centrifuged (20 min; 10,000 x g),
supernatant aspirated gently, pellets resuspended in 400 µl diethyl
pyrocarbonate (DEPC)-treated water, extracted once with
phenol:chloroform (1:1), extracted with chloroform:isoamyl alcohol
(24:1), and precipitated overnight at -20 C after addition of 40 µl
sodium acetate (3.0 M; pH 5.2) and 1.0 ml absolute ethanol.
Samples were centrifuged (10,000 x g; 20 min), washed
twice with 70% ethanol, air dried for 510 min, and resuspended to 20
µl in DEPC-treated water. Optical densities were determined using a
Beckman DU 640 Spectrophotometer (Beckman Instruments Inc., Schaumburg,
IL).
RT-PCR
RNA was subjected to RT by a modification of standard
methodologies (20). Briefly, denatured total RNA (5 µg in 10.5 µl
total vol in DEPC-treated H2O at 65 C for 5 min) was added
to tubes containing 4 µl 5 x MMLV-RT buffer (GIBCO), 2 µl
deoxynucleotide triphosphates, 2 µl oligo dT17-mer (10 pmol/ml), 0.5
µl RNAsin (40 U/ml, Promega, Madison, WI), 1 µl MMLV-RT (GIBCO),
and the final vol adjusted to 20 µl. Samples were reverse transcribed
at 37 C for 1 h, and the reaction was halted by heating at 95 C
for 5 min.
Transcribed samples (5 µl) were subjected to PCR using standard
methodologies (20). Briefly, samples were added to tubes containing
water and appropriate amounts of PCR buffer (Perkin Elmer, Foster City,
CA), 25 mM MgCl2, dNTPs, forward and reverse
primers (10 pM final concentration) for glyceraldehyde
phosphate dehydrogenase (GAPDH) or BMP-6, 32P-deoxycytosine
triphosphate, and Amplitaq (Perkin Elmer). PCR was performed for 22
cycles (94 C, 30 sec; 58 C, 30 sec; 72 C, 20 sec). Primer sequences
from 5' to 3' were: BMP-6 (forward) = GTACCGGCGGCTCAAGACGC, BMP-6
(reverse) = GGGACGAGCTGGCTGCTTCG, GAPDH (forward) =
CTGGTCATCAATGGGAAAC, GAPDH (reverse) = CAAAGTTGTCA-TGGATGACC.
Quantitation of RT-PCR products by PAGE and PhosphorImager
analysis
RT-PCR products received 5 µl/tube loading dye, were mixed,
heated (65 C x 10 min), centrifuged, and 10 µl each subjected
to 12% PAGE under standard conditions (19). Gels were then incubated
in gel-preserving buffer (10% vol/vol glycerol, 7% vol/vol acetic
acid, 40% vol/vol methanol, 43% deionized water) for 30 min, dried at
80 C on a GelDryer (Bio-Rad Laboratories, Hercules, CA) in
vacuo 12 h, and analyzed by PhosphorImager (Molecular Dynamics,
Sunnyvale, CA). Visualized band intensities were measured after
background correction. Intensities were normalized to a GAPDH control
(a housekeeping gene not regulated by GC) to account for unequal
loading and potential changes in cell number at different points in
time.
Ribonuclease (RNAse) protection assay (RPA)
Labeled riboprobe for BMP-6 messenger RNA (mRNA) was prepared
from BMP-6 vector, generously supplied by Drs. Wozney and Celeste
(Genetics Institute). Briefly, the SP6 promoter site was used to
initiate the complementary riboprobe strand (Riboprobe Gemini II,
Promega). Labeled riboprobe was added to a sample of total RNA (10100
µg) resuspended in 20 µl hybridization buffer, and RPA was
performed according to standard protocol (Boehringer Mannheim Kit No.
1427580). Purified double-stranded RNA was separated by 6% urea
denaturing gel electrophoresis, and the presence of BMP-6 RNA was
determined by phosphorimaging.
Quantitation of BMP-6 protein
BMP-6 protein was quantitated by Western blot analysis of
homogenates prepared from whole cultures. Cells were scraped into the
medium and lysed by repeated freezing at -70 C and thawing. Resulting
microvesicles were sonicated five times (Heat Systems, Ultrasonics,
Inc.) for 30 sec at full power and cooled in ice. Homogenates were
stored at -70 C in the presence of 0.5 mM
phenylmethysulfonyl fluoride and 0.2 mM leupeptin for up to
3 weeks before analysis.
Proteins (50 µg) within the homogenates were separated under reducing
conditions by 12% PAGE (21). Gels were transblotted to polyvinylidene
difluoride membrane (Bio-Rad) in Tris-glycine buffer overnight at 75 mA
(22). Where necessary, proteins were visualized by transient Ponceau
staining (23). The membranes were prewashed (5 x 10 min) in
Tris-buffered saline (TBS), blocked for 1 h at room temperature
with TBS/10% FBS/3% BSA, and washed (3 x 5 min) in TBS/1% FBS.
PAb specific to the mature region of BMP-6 (1 µg/ml 2A06-TB3, a
generous gift of Drs. Wozney and Celeste at Genetics Institute) was
applied overnight at 4 C to biotinylated goat antirabbit antiserum
(Bio-Rad) diluted 1:250 in TBS/1% FBS. Membranes were washed again
(3 x 5 min) in TBS/1% FBS, exposed for 1 h at room
temperature to horseradish peroxidase-conjugated streptavidin (Bio-Rad)
diluted 1:250 in TBS/1% FBS, and washed (3 x 5 min) in TBS/1%
FBS. Bands were visualized using the TMB Peroxidase Substrate System
(KPL, Gaithersburg, MD). Lanes were scanned and digitized using a
densitometer (Scanjet II, Hewlett-Packard) and the total density in
each lane quantitated using densitometric software (Molecular
Dynamics). The specificity of 2A06-TB3 for BMP-6 was confirmed by
preblocking the primary antibody with 5-fold molar excess of rhBMP-6.
The optimum antibody dilution was determined by serial antibody
dilution curves using 10 µg rhBMP-5, 6, and 7 as antigen. The
dilution chosen had minimal cross-reactivity with BMP-5 or BMP-7.
Antisense treatment and cell culture
Antisense oligonucleotide inhibition of BMP-6 expression was
accomplished with a specific 19-base oligonucleotide binding 7
nucleotides downstream of the translation start site. Oligonucleotides
spanning the methionyl initiation codon were not used because of
homology with other members of the TGF-ß superfamily. BMP-6 antisense
oligonucleotide sequence was as follows: 5'-TGCTAGTTGCTGTGATGTC-3'.
Controls were treated with the complementary sense oligonucleotide or
no oligonucleotide treatment. Transfection of DNA was accomplished with
similar results using either of two protocols (in the presence or
absence of lipofectamine). In both protocols, 11 µg sense or
antisense BMP-6 oligonucleotides were incubated in MEM for 45 min at
room temperature. Either more MEM or preincubated lipofectamine + MEM
(7% vol/vol; 45 min at room temperature) was added to achieve a final
oligonucleotide concentration of 0.1 µM. The resulting
mixture was incubated 15 min at room temperature.
Treatment of cells with one of the three oligonucleotide mixtures
(antisense, sense, or vehicle) was performed in standard media with or
without GC stimulation. Media containing lipofectamine were changed
after 4 h of incubation and replaced with fresh media with neither
lipofectamine nor oligonucleotides. Cultures transfected without
lipofectamine had their media changed at 24 h to media containing
no oligonucleotide. Protein was harvested at 0, 12, 24, 48, and 72
h; RNA was harvested at 0, 12, 24, 36, 48, 60, and 72 h or 0, 1,
3, 5, and 7 days. Several cultures from each experiment were grown to
14 days (including the usual media change to BGJb at day 7)
to determine mineralized nodule counts and osteocalcin secretion.
Statistical methods
Nodule counts and osteocalcin levels from representative
experiments are expressed as the mean ± SEM from an
N = 56 per group. Data were normalized to the maximum value for
each parameter to allow simultaneous graphing of nodule counts,
mineralized areas, and osteocalcin. For RT-PCR, RPA, or Western blot
analysis, data from triplicate samples of representative experiments
were used to determine the mean ± SEM. Graphs are
shown normalized to either day zero or no-treatment controls and
expressed as fold increases above control values. Statistical
significance was evaluated using a one-way ANOVA with post
hoc multiple comparison corrections of Bonferroni (Sigmastat,
Jandel Scientific, Corte Madera, CA).
levels for significance were
defined as P less than 0.05.
 |
Results
|
|---|
GC increase of BMP-6 mRNA levels
We first measured the effect of GC on BMP mRNA levels by RT-PCR.
Figure 1
demonstrates a 5.6-fold induction of BMP-6
steady-state mRNA levels after 24 h of GC treatment, compared with
untreated cells at the same time point. In contrast, mRNA levels for
BMP-2, BMP-4, BMP-5, BMP-7, and TGF-ß1 were increased with GC
treatment by less than 2-fold (F = 69.8, P <
0.0001).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 1. GC treatment preferentially enhances BMP-6 mRNA
levels, compared with mRNA for other members of the TGF-ß
superfamily. Secondary fetal rat calvarial cell cultures were treated
with or without the GC triamcinolone (1 nM) for 24 h.
Total RNA was extracted and RT-PCR performed on triplicate samples
using specific primers for each species. PCR product was normalized to
GAPDH PCR product. Data are presented as the fold increase of each mRNA
species over the respective level found in control cultures not treated
with GC. Values are expressed as mean ± SEM.
|
|
BMP-6 mRNA levels are not increased by BMP-2
In another set of experiments, we confirmed an increase of BMP-6
message by GC (F = 15.8, P < 0.0001) and
demonstrated that BMP-6 expression was not increased by rhBMP-2 (50
ng/ml x 24 h) treatment (Fig. 2A
). Treatment
with rhBMP-2 resulted in a slightly decreased level of BMP-6 mRNA. The
BMP-6 PCR product was sequenced by both automated and manual
techniques. By both methods, the sequence obtained was greater than
90% homologous to the published rat BMP-6 sequence and less than 75%
homologous to either mouse BMP-5 or rat BMP-7. The deduced amino acid
homology was 100% between our PCR product and published rat BMP-6
protein sequence. To confirm the quantitation of the RT-PCR technique,
the same RNA was analyzed using RNase RPA for BMP-6. Figure 2B
demonstrates nearly identical quantitation of the GC induction of BMP-6
(2.7 ± .4 vs. 2.5 ± 0.2, not significant) to
that of the RT-PCR method. The GC-induced increase in BMP-6 mRNA was
2-fold less than that seen in other experiments because the data in
Fig. 2
were obtained from a single calvarial cell preparation to
validate the mRNA quantitation. This emphasizes the rationale for
confirming all results in cells from three different calvarial
preparations, as was the case for all remaining experiments.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Effect of GC and rhBMP-2 on BMP-6 mRNA levels;
comparison of two methods of measurement. Secondary fetal rat calvarial
cell cultures were treated for 24 h with no addition, GC (1
nM triamcinolone), rhBMP-2 (50 ng/ml), or GC + rhBMP-2. A,
Total RNA was extracted from triplicate samples and BMP-6 mRNA was
quantitated, relative to GAPDH, by RT-PCR. Data are presented as the
mean ± SEM fold increase over BMP-6 mRNA levels in
untreated control cultures (arbitrarily set to 1). The
inset shows representative images from the
phosphorimager from which the quantitative data were obtained. Data
from three independent experiments were similar. B, Using 30 µg of
the same total RNA, BMP-6 mRNA was quantitated by RPA. The
inset shows representative images quantitated by
phosphorimager analysis. The mean ± SEM fold increase
in BMP-6 mRNA levels in response to each treatment is similar when
quantitated by either method.
|
|
Time course of GC induction of BMP-6 mRNA transcripts
Figure 3A
shows steady-state BMP-6 mRNA levels (by
RT-PCR) for 7 days of GC treatment. The peak BMP-6 mRNA level was seen
on day 1 and was 5.6 ± .5-fold greater than on day 0 (F =
92.3, P < 0.0001), whereas the increase in BMP-6
expression in untreated cells was only 1.7 ± .1-fold. This
experiment was repeated with more sampling time points in a 72-h time
period. Figure 3B
demonstrates an even greater increase in BMP-6
message level after 12 h of GC than that seen after 24 h
(13.7 ± 0.2 vs. 6.0 ± .7). Again, the untreated
cells showed minimal increase in BMP-6 expression (F = 60.4,
P < 0.0001).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Time course of GC-stimulated increase in BMP-6
mRNA levels. Secondary fetal rat calvarial cell cultures were treated
with (solid line) or without (dashed
line) GC (1 nM triamcinolone) for the indicated
time periods. Total RNA was extracted from triplicate samples and BMP-6
mRNA levels were measured by RT-PCR and normalized to GAPDH. Data are
expressed as mean ± SEM fold increase over
pretreatment values (arbitrarily set to 1). A, The time course was
similar in three independent experiments and demonstrated an early
increase in BMP-6 mRNA levels in response to GC treatment. B, An
earlier time course was then performed, demonstrating the peak rise in
BMP-6 mRNA to be at 12 h. Furthermore, a measurable rise was
already present at 2 and 6 h. The 24-h and 72-h time points
correlate well with the values obtained in the earlier time course
experiments (panel A). These data were confirmed in two independent
triplicate experiments.
|
|
Correlation of BMP-6 mRNA levels and BMP-6 protein synthesis
To confirm that an increase in BMP-6 mRNA levels resulted in
increased BMP-6 protein synthesis, we analyzed BMP-6 protein in whole
cultures treated in parallel with those described in Fig. 3B
. The peak
in total BMP-6 protein levels within these cultures was determined by
Western analysis to occur 24 h after GC treatment (Fig. 4A
); this was 12 h after the peak rise in BMP-6
mRNA levels. Significantly less BMP-6 protein was observed in the
untreated control cultures (F = 63.8, P <
0.0001). A representative blot of a gel run under reduced conditions
(Fig. 4B
) shows the expected four bands detected by the BMP-6 antibody.
The 90-kDa and 65-kDa bands represent pre-pro forms of BMP-6 that are
synthesized as homodimers. Before secretion, they are cleaved to the
16-kDa mature form, which when glycosylated, appears as a 23-kDa band.
The PAb was raised against an epitope within the mature region of the
BMP-6 protein and does not detect subunits cleaved from the pre-pro
homodimer. Identification of the various BMP-6 species was aided by
electrophoresing the same samples under nonreducing conditions. When
not reduced, 125-kDa and 45-kDa bands were detected by the BMP-6
specific antibody. These represent homodimers of the 65-kDa and 23-kDa
protein species. Gas phase sequence analysis determined that the 16-kDa
and 23-kDa bands contain N-terminal sequence consistent with rat BMP-6.
The quantitation data in Fig. 4A
includes all four bands detected by
the BMP-6 antibody under reducing conditions; however, the result is
unchanged when only the mature 16-kDa and 23-kDa species are considered
for quantitation.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4. Time course of GC-stimulated increase in BMP-6
protein levels. Secondary fetal rat calvarial cell cultures were
treated with (solid line) or without (dashed
line) GC (1 nM triamcinolone) for the indicated
time periods. Cells, matrix, and media were homogenized together and
the proteins separated under reducing conditions and analyzed three
times by Western blot analysis. A, Total BMP-6 protein in each lane at
the individual time points was compared with that before treatment (set
arbitrarily to 1) and expressed as the mean ± SEM. B,
Representative Western blot from cultures treated with or without GC
and analyzed as above. Four bands at 16, 23, 65, and 90 kDa were
visualized and represent various immature and mature forms of the
synthesized and secreted BMP-6 protein. Total densities (sum of the
intensity of the four bands) were used for quantitation in panel A.
|
|
In two additional experiments BMP-6 levels were analyzed separately in
the cell/matrix layer and in the medium (secreted BMP-6). The BMP-6
protein present during the first 12 h after GC treatment was
comprised of the 90-kDa and 65-kDa species and was mainly located in
the cell fraction. The 16-kDa and 23-kDa species were seen later (48
h), predominantly in the medium (data not shown). Using a standard
curve consisting of six doses of rhBMP-6 (0.5500 ng), we estimated
that the total BMP-6 protein increased from 5 ng/ml to 87 ng/ml at
48 h in the GC-treated cultures. There was only a minimal increase
in BMP-6 protein in the untreated control cultures.
Inhibition of BMP-6 protein synthesis
To determine if BMP-6 was a critical factor in GC-induced
osteoblast differentiation, we performed experiments with
oligodeoxynucleotides antisense to BMP-6. Antisense oligonucleotides
form DNA:RNA duplexes with the specific mRNA species, thereby blocking
binding of the mRNA to the 40 S ribosomal subunit and preventing
translation (24). Figure 5A
demonstrates a significant
decrease (F = 87.0, P < 0.0001) in BMP-6 protein
levels when untreated control cells were treated with antisense BMP-6
oligonucleotides for 12 h (67 ± 6% decrease); a larger
decrease was observed in cells stimulated to differentiate with GC
(84 ± 5% decrease). Similar results in BMP-6 protein levels
(74 ± 5% decrease) were observed after transfection of
oligonucleotides with lipofectamine for 4 h. Sense
oligonucleotides had no significant effect on BMP-6 protein, similar to
control cultures not treated with oligonucleotides. As expected, Fig. 5B
demonstrates that the steady-state BMP-6 mRNA levels, as measured by
RT-PCR, did not change as a result of the sense or antisense BMP-6
oligonucleotides or the lipofectamine (F = 20.0, P
< 0.0001). These data are consistent with the expected antisense
oligonucleotide inhibition of translation rather than
transcription.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5. Effect of BMP-6 sense and antisense
oligonucleotides on BMP-6 protein and mRNA levels. Secondary fetal rat
calvarial cell cultures were treated with or without GC (1
nM triamcinolone) in the presence of no oligonucleotide
(-), 100 nM BMP-6 sense oligonucleotide (S), or 100
nM BMP-6 antisense oligonucleotide (AS). Other cultures
were treated identically but with the addition of the transfection
agent lipofectamine (LF) for 4 h, followed by fresh medium without
lipofectamine for an additional 8 h. A, Twelve hours after
treatment was initiated, samples (pooled from two 35-mm cultures) were
homogenized and analyzed twice for BMP-6 protein by Western analysis.
Data were pooled from the two analyses and are presented as mean
± SEM fold change over the no-treatment value (set
arbitrarily to 1). The inset shows one of the gels that
was quantified to obtain the data presented graphically. B, Twelve
hours after treatment was initiated, total RNA was extracted from
triplicate samples and analyzed by RT-PCR for BMP-6 mRNA levels. Data
are presented as mean ± SEM relative to the
no-treatment value (set arbitrarily to 1). As expected, BMP-6 mRNA
levels were unchanged by oligonucleotide treatment, whereas BMP-6
protein synthesis was nearly completely blocked by BMP-6 antisense
oligonucleotides. Results were similar in each of two independent
experiments.
|
|
To determine the functional effects of blocking the early rise in BMP-6
in differentiating osteoblasts, we also measured the effect on a more
physiologically relevant endpoint, bone nodule formation (Fig. 6
). We elected not to measure alkaline phosphatase
activity as a potential early marker because of its lower tissue
specificity and more variable correlation with the mature osteoblast
phenotype, compared with nodule formation and osteocalcin secretion.
Formation of such mineralized nodules in vitro represents a
late stage in osteoblast differentiation, as these nodules are capable
of secreting the bone-specific matrix protein osteocalcin. The
oligonucleotides antisense to BMP-6 resulted in a significant decrease
in bone nodule formation: 79 ± 7% decrease (-GC); 91 ±
5% decrease (+GC); and 89 ± 5% decrease (+GC/lipofectamine)
(F = 90.2, P < 0.0001). Treatment with the sense
BMP-6 oligonucleotides did not result in a significant decrease in
nodule formation.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 6. Inhibition of BMP-6 protein synthesis blocks
nodule formation in rat calvarial cultures. Secondary fetal rat
calvarial cell cultures were treated, as in Fig. 5 , with or without GC
(1 nM triamcinolone) and in the presence of no
oligonucleotide (-), 100 nM BMP-6 sense oligonucleotide
(S), or 100 nM BMP-6 antisense oligonucleotide (AS). After
24 h, the medium was replaced with fresh medium devoid of
oligonucleotides. Other cultures were treated identically but with the
addition of the transfection agent lipofectamine (LF) for 4 h,
followed by fresh medium without lipofectamine for an additional 8
h. After the initial oligonucleotide treatment, cultures were continued
in MEM for the remainder of the first 7 days and then switched to
BGJb medium with 5 mM ß-GlyP to permit
mineralization of nodules. Fourteen days after the initial treatment,
cultures (in six 35-mm wells per treatment group) were von Kossa
stained and the nodules counted. Data are expressed as the mean ±
SEM and are representative of five independent
experiments.
|
|
Rescue of antisense oligonucleotide-treated cultures with rhBMP-6
(50 ng/ml x 7 days) prevented the inhibitory effect of the
antisense oligonucleotides (F = 1.3, P < .323)
and completely restored the differentiating effect of GC (Fig. 7
). Addition of rhBMP-6 reversed the effect of BMP-6
antisense oligonucleotides on GC-stimulated nodule formation and
eliminated the low rate of spontaneous nodule formation in control
cultures not treated with GC. Experiments in which rhBMP-2 (50
ng/ml x 7 days) was added after the BMP-6 antisense
oligonucleotide treatment, did not demonstrate restoration of
GC-induced differentiation (data not shown). These results indicate
that antisense oligonucleotides were not substantially toxic to the
cultures and also support the specificity of BMP-6 effects on early
osteoblast differentiation.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 7. Exogenous rhBMP-6 can prevent the BMP-6 antisense
oligonucleotide block of GC stimulation of osteoblast differentiation.
Secondary fetal rat calvarial cell cultures were treated, as in Fig. 6 , with or without GC (1 nM triamcinolone) and in the presence
of no oligonucleotide (-), 100 nM BMP-6 sense
oligonucleotide (S), or 100 nM BMP-6 antisense
oligonucleotide (AS). After 24 h, the medium was replaced with
fresh medium devoid of oligonucleotides. Other cultures were treated
identically, except for the addition of the transfection agent
lipofectamine (LF) for 4 h, followed by fresh medium without
lipofectamine for an additional 8 h. After the initial
oligonucleotide treatment, cultures were continued in MEM with 50 ng/ml
rhBMP-6 for the remainder of the first 7 days and then switched to
BGJb medium with 5 mM ß-GlyP to permit
mineralization of nodules. Fourteen days after the initial treatment,
cultures (in three 35-mm wells per treatment group) were von Kossa
stained and the nodules counted. Data are expressed as the mean ±
SEM and are representative of three independent
experiments. Addition of rhBMP-6 reversed the effect of BMP-6 antisense
oligonucleotides on GC-stimulated nodule formation and eliminated the
low rate of spontaneous nodule formation in control cultures not
treated with GC.
|
|
Substitution of BMP-6 for GC to initiate osteoblast
differentiation
In a previous study, we determined that rat osteoblast cultures
were more responsive to rhBMP-2 treatment after a 3-day pretreatment
with GC (5). Because an important mechanism of GC-induced osteoblast
differentiation seems to be induction of BMP-6, we attempted to
substitute rhBMP-6 directly for GC. We found that BMP-6 was able to
directly substitute for GC as the pretreatment agent sensitizing the
cells to BMP-2, as measured by both mineralized nodule counts (F =
251.9, P < 0.0001) (Fig. 8A
) and
osteocalcin secretion (F = 107.4, P < 0.0001) on
day 14 (Fig. 8B
). These results suggest that BMP-6 is largely
responsible for the differentiating effects of GCs in osteoblast
cultures. In addition, BMP-6 given early seems to potentiate the effect
of BMP-2 given later during differentiation, suggesting a unique
temporal sequence and specific roles for individual BMPs during
osteoblast differentiation.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 8. Pretreatment with rhBMP-6 can substitute for GC,
to enhance the effects of rhBMP-2 on nodule formation in calvarial
cultures. Secondary fetal rat calvarial cell cultures were treated on
days 03 with either nothing (NT), GC (1 nM
triamcinolone), or BMP-6 (50 ng/ml rhBMP-6). On days 47, treatment
was switched to either no treatment (NT) or BMP-2 (50 ng/ml rhBMP-2).
All cultures were grown in MEM + 50 µg/ml ascorbic acid + 10% FBS on
days 07 and switched to BGJb +10% FBS + 5 mM
ß-GlyP on days 814, to permit mineralization. A, Six 35-mm wells
per treatment group were von Kossa stained, and the nodules were
counted. Data are expressed as the nodule mean ± SEM
and are representative of three independent experiments. B, Before
staining on day 14, the medium from the above cultures was saved and
assayed for osteocalcin by RIA. Values are expressed as the means
± SEM from triplicate determinations from 56 cultures
that were repeated in two independent experiments.
|
|
 |
Discussion
|
|---|
Osteoblasts are thought to differentiate from pluripotent
mesenchymal cells upon exposure to specific signaling factors. Studies
have documented the involvement of transcription factors, such as the
basic helix-loop-helix family, as well as jun and fos in these
processes for the osteoblast pathway of differentiation (25, 26, 27, 28). More
recently, secreted growth factors also have been implicated in bone and
cartilage development. The TGF-ß superfamily, consisting of the BMPs
and other proteins, is involved in osteoblast differentiation, as well
as embryonic limb bud development (29, 30, 31, 32, 33, 34). Several members of this
gene family have been localized during intramembranous and endochondral
bone formation and are expressed in specific spatial and temporal
patterns (9, 35, 36, 37, 38). Specific roles for the various BMPs are not well
established for postembryonic bone formation.
In this study, we found that BMP-6 played a uniquely important role,
compared with BMPs-2, -4, -5, -7, or TGF-ß1, during early osteoblast
differentiation in a rat calvarial cell culture model. This result is
consistent with the hypothesis of Hughes et al. (39) that
BMP-6 may act principally on an early stage of osteoprogenitor cell
based on its greater potency, as demonstrated in a primary rat
calvarial cell culture system. In addition, these results reinforce our
previous observations that BMP-6 seemed to play an important role
during differentiation in a secondary rat calvarial cell culture system
(5).
Because of the close homology between BMP-6 and its other subfamily
members, BMP-5 and BMP-7, we took several precautions to insure that
the GC increase in BMP-6 expression was indeed specific to BMP-6.
First, we demonstrated that BMP-5 and BMP-7 mRNA were not induced with
GC treatment during the early (24 h) differentiation period, as
measured by RT-PCR. We then confirmed the authenticity of the sequence
of the BMP-6 PCR product. Although quantitative PCR can be unreliable,
similar quantitation by a second methodology, such as RNase protection,
increases the validity of the observation. In addition, we confirmed
the specificity of BMP-6 protein detection on Western blots by peptide
sequence analysis and by a series of antibody titrations targeting
BMP-5, 6, and 7. The anti-BMP-6 antiserum concentration for Western
blot analysis was determined, to avoid any substantial cross-reactivity
with BMP-5 or BMP-7.
The close correlation in timing of BMP-6 protein detection with
that of increased BMP-6 mRNA levels is an important observation in our
system. Previous studies have shown that BMP-6 protein is not found in
all tissues shown to express BMP-6 message (32). This suggests that
there may be tissue specific posttranscriptional regulation of BMP-6
expression.
Few studies have looked specifically at the role of BMP-6 during
bone formation. BMP-6 has been postulated to play a role during
epithelial differentiation, central nervous system development, and
hypertrophic cartilage (29, 32, 38, 40, 41). Tumors expressing BMP-6
have induced fibrosis and endochondral bone formation in
vivo (42). During primary rat calvarial cell differentiation,
BMP-6 mRNA has been detected on days 710 by Harris et al.
(43). BMP-6 expression increases during differentiation in the
pluripotential rOB cell line ROB-C26 (44). Additional evidence for a
crucial role of BMP-6 in osteoblast differentiation was highlighted
when the osteoinductive effect of matrix from C26 cells that
overexpressed BMP-6 was blocked by a neutralizing BMP-6 antibody (44).
In addition, treatment of the pluripotential rOB cells ROB-C26 with
retinoic acid results in osteoblastic differentiation that is
accompanied by an increase in BMP-6 expression and a decrease in
expression of BMP-2 and -4 (45).
Our demonstration of the ability to block GC-induced osteoblast
differentiation with oligonucleotides antisense to BMP-6 suggests that
the mechanism of GC-induced differentiation may share a common pathway
with that of retinoic acid via induction of BMP-6. Although we did not
observe a decrease in BMP-6 mRNA levels, we did observe a significant
decrease in BMP-6 protein expression and bone nodule formation. The
antisense oligonucleotides are presumed to inhibit the translation of
BMP-6 mRNA by preventing binding of mRNA to the 40 S ribosomal subunit
(24). We obtained similar results with 4 h of oligonucleotide
treatment in combination with lipofectamine and after 24 h of
treatment without a transfection agent.
Inspection of the BMP-6 protein bands, separated under reducing
conditions and detected by Western blot analysis, demonstrated that
12 h of GC treatment induced the higher molecular mass bands (90
kDa and 65 kDa). These bands are likely to represent newly synthesized
immature BMP-6 consistent with sizes previously reported (32). Before
secretion, a portion of the BMP-6 pre-pro molecule is cleaved,
resulting in the mature form, which can be glycosylated at several
different sites. The 16-kDa band represents the unglycosylated mature
form of BMP-6, whereas the 23-kDa band most likely represents the
glycosylated form of the mature molecule. The diffuse appearance of the
23-kDa band is most likely caused by variably glycosylated forms of the
mature BMP-6 molecule migrating slightly differently from each other.
Our data demonstrate that the GC treatment resulted in an induction of
all four of the detected BMP-6 species, with the larger sizes appearing
slightly earlier than the more mature, smaller, secreted forms.
Although other growth factors not measured in these studies may
play a role in early osteoblast differentiation, these data suggest
that BMP-6 is one of the more critical TGF-ß superfamily members. Not
only does the induction of BMP-6 enhance bone nodule formation in
cultures, but the specific inhibition of BMP-6 protein expression
directly interferes with nodule formation. These data, taken with the
observation that the biological activity of rhBMP-2 can be enhanced by
GC or by rhBMP-6, but that the BMP-6 antisense oligonucleotide
inhibition of nodule formation cannot be effectively rescued by
rhBMP-2, suggest that BMP-6 may represent a critical component of the
osteoblast differentiation pathway. These findings also demonstrate
that specific BMPs may have unique temporal and functional roles in
bone formation that are not necessarily redundant or interchangeable.
 |
Footnotes
|
|---|
This work was supported in part by the Smith and Nephew Richards
Research Grant through the Orthopaedic Research and Education
Foundation (to S.D.B.) and by Merit Review Grant Awards from the
Veterans Affairs Medical Center (to S.D.B. and M.S.N.).
Received January 14, 1997.
 |
References
|
|---|
-
Chaudhary LR, Avioli LV 1994 Dexamethasone
regulates IL-1b and TNF-a-induced interleukin-8 production in human
bone marrow stromal cells and osteoblast-like cells. Calcif Tissue Int 55:1620[CrossRef][Medline]
-
Kasperk C, Schneider U, Sommer U, Niethard F, Ziegler
R 1995 Differential effects of glucocorticoids on human
osteoblastic cell metabolism in vitro. Calcif Tissue Int 57:120126[CrossRef][Medline]
-
Bellows CG, Aubin JE, Neersche JNM 1987 Physiological concentrations of glucocorticoids stimulate formation of
bone nodules from isolated rat calvaria cells in vitro.
Endocrinology 121:19851992[Abstract]
-
Breen EC, Ignotz RA, McCabe L, Stein JL, Stein GS, Lian
JB 1994 TGF-b alters growth and differentiation related gene
expression in proliferating osteoblasts in vitro, preventing
development of the mature bone phenotype. J Cell Physiol 160:323335[CrossRef][Medline]
-
Boden SD, McCuaig K, Hair G, Racine M, Titus L, Wozney
JM, Nanes MS 1996 Differential effects and glucocorticoid
potentiation of bone morphogenetic protein action during rat osteoblast
differentiation in vitro. Endocrinology 137:34013407[Abstract]
-
Tenenbaum HC, Heersche JN 1985 Dexamethasone
stimulates osteogenesis in chick periosteum in vitro.
Endocrinology 117:22112217[Abstract]
-
McCulloch CAG, Tenenbaum HC 1986 Dexamethasone
induces proliferation and terminal differentiation of osteogenic cells
in tissue culture. Anat Rec 215:397402[CrossRef][Medline]
-
Rickard DJ, Sullivan TA, Shenker BJ, Leboy PS, Kazhdan
I 1994 Induction of rapid osteoblast differentiation in rat bone
marrow stromal cell cultures by dexamethasone and BMP-2. Dev Biol 161:218228[CrossRef][Medline]
-
Leboy PS, Beresford JN, Devlin C, Owen ME 1991 Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell
cultures. J Cell Physiol 146:370378[CrossRef][Medline]
-
Kazhdan I, Sullivan TA, Leboy PS 1992 Rapid
osteoblast differentiation in primary cultures of rat bone marrow
stromal cells. J Bone Miner Res 7:S203
-
Benayahu D, Kletter Y, Zipori D, Wientroub S 1989 Bone marrow-derived stromal cell line expressing osteoblastic phenotype
in vitro and osteogenic capacity in vivo. J Cell
Physiol 140:17[CrossRef][Medline]
-
Cheng SL, Yang JW, Rifas L, Zhang S, Avioli LV 1994 Differentiation of human bone marrow osteogenic stromal cells in
vitro: induction of the osteoblast phenotype by dexamethasone.
Endocrinology 134:277286[Abstract]
-
Simmons DJ, Seitz P, Kidder L, Klein GL, Waeltz M,
Gundberg CM, Tabuchi C, Yang C, Zhang RW 1991 Partial
characterization of rat marrow stromal cells. Calcif Tissue Int 48:326334[Medline]
-
Kamalia N, McCulloch CAG, Tenenbaum HC, Limeback H 1992 Dexamethasone recruitment of self-renewing osteoprogenitor cells
in chick bone marrow stromal cell cultures. Blood 79:320326[Abstract/Free Full Text]
-
Kasugai S, Todescan R, Nagata T, Yao K, Butler WT, Sodek
J 1991 Expression of bone matrix proteins associated with
mineralized tissue formation by adult rat bone marrow cells in
vitro: inductive effects of dexamethasone on the osteoblastic
phenotype. J Cell Physiol 147:111120[CrossRef][Medline]
-
Wozney JM 1989 Bone morphogenetic proteins. Prog
Growth Factor Res 1:267280[CrossRef][Medline]
-
Wozney JM, Rosen V 1993 Bone morphogenetic
proteins. In: Mundy GR, Martin TJ (eds) Handbook of Experimental
Pharmacology. Physiology and Pharmacology of Bone. Springer-Verlag,
Berlin, vol 107:725748
-
Nanes MS, Rubin J, Titus L, Hendy GN, Catherwood BD 1990 a-Interferon inhibits 1,25-dihydroxyvitamin D3 stimulated
synthesis of bone gla protein in rat osteosarcoma cells by a
pretranslational mechanism. Endocrinology 127:588594[Abstract]
-
Sambrook J, Fritsch EF, Maniatis T 1989 Molecular
Cloning. Cold Spring Harbor Laboratory Press, Plainview
-
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,
Smith HA, Struhl K 1990 Current Protocols in Molecular Biology.
Wiley, Trenton, pp 15.3.115.3.8
-
Laemmli UK 1970 Cleavage of structural proteins
during the assembly of the head of bacteriophage T2. Nature 227:680685[CrossRef][Medline]
-
Towbin H, Staehelin T, Gordon J 1995 Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets. Procedures and some applications. Proc Natl Acad
Sci USA 76:43504354
-
Salinovich O, Monelaro RC 1986 Reversible staining
and peptide mapping of proteins transferred to nitrocellulose after
separation by SDS-PAGE. Anal Biochem 156:341347[CrossRef][Medline]
-
Reddy SV, Takahashi S, Dallas M, Williams RE,
Neckers L, Roodman GD 1994 Interleukin-6 antisense
deoxyoligonucleotides inhibit bone resorption by giant cells from human
giant cell tumors of bone. J Bone Miner Res 9:753757[Medline]
-
Olson EN, Klein WH 1994 bHLH factors in
muscle development: dead lines and commitments, what to leave in and
what to leave out. Genes Dev 8:18[Free Full Text]
-
Lian JB, Stein GS, Bortell R, Owen TA 1991 Phenotype suppression: a postulated molecular mechanism for mediating
the relationship of proliferation and differentiation by fos/jun
interactions at AP-1 sites in steroid responsive promoter elements of
tissue-specific genes. J Cell Biochem 45:914[CrossRef][Medline]
-
Shalhoub V, Conlon D, Tassainari M, Quinn C, Partridge
N, Stein G, Lian JB 1992 Glucocorticoids promote development of
the osteoblast phenotype by selectively modulating expression of cell
growth and differentiation associated genes. J Cell Biochem 50:425440[CrossRef][Medline]
-
Subramaniam M, Colvard D, Keeting PE, Rasmussen K, Riggs
BL, Spelsberg TC 1992 Glucocorticoid regulation of alkaline
phosphatase, osteocalcin, and proto-oncogenes in normal human
osteoblast-like cells. J Cell Biochem 50:411424[CrossRef][Medline]
-
Lyons KM, Pelton RW, Hogan BLM 1989 Patterns of
expression of murine Vgr-1 and BMP-2a RNA suggest that transforming
growth factor-B like genes coordinately regulate aspects of embryonic
development. Genes Dev 3:16571668[Abstract/Free Full Text]
-
Jones CM, Simon-Chazottes D, Guenet J, Hogan BLM 1992 Isolation of Vgr-2, a novel member of the transforming growth
factor-B-related gene family. Mol Endocrinol 6:19611968[Abstract]
-
Jones CM, Lyons KM, Lapan PM, Wright CVE, Hogan BLM 1992 DVR-4 (bone morphogenetic protein-4) as a posterior-ventralizing
factor in Xenopus mesoderm induction. Development 115:639647[Abstract]
-
Wall NA, Blessing M, Wright CVE, Hogan BLM 1993 Biosynthesis and in vivo localization of the
decapentaplegic-Vg-related protein, DVR-6 (bone morphogenetic
protein-6). J Cell Biol 120:493502[Abstract/Free Full Text]
-
Jones CM, Lyons KM, Hogan BLM 1991 Involvement of
bone morphogenetic protein-4 (BMP-4) and Vgr-1 in morphogenesis and
neurogenesis in the mouse. Development 111:531542[Abstract]
-
Ozkaynak E, Schnegelsberg PNJ, Jin DF, Clifford GM,
Warren FD, Drier EA, Oppermann H 1992 Osteogenic protein-2: a new
member of the transforming growth factor-b superfamily expressed early
in embryogenesis. J Biol Chem 267:2522025227[Abstract/Free Full Text]
-
Vainio S, Karavanova I, Jowett A, Thesleff I 1993 Identification of BMP-4 as signal mediating secondary induction between
epithelial and mesenchymal tissues during early tooth development. Cell 75:4558[CrossRef][Medline]
-
Vukicevic S, Latin V, Chen P, Batorsky R, Reddi AH,
Sampath TK 1994 Localization of osteogenic protein-1 (bone
morphogenetic protein-7) during human embryonic development: high
affinity binding to basement membranes. Biochem Biophys Res Commun 198:693700[CrossRef][Medline]
-
Chang SC, Hoang B, Thomas JT, Vukicevic S, Luyten FP,
Ryba NJP, Kozak CA, Reddi AH, Moos M 1994 Cartilage-derived
morphogenetic proteins: new members of the transforming growth factor-b
superfamily predominantly expressed in long bones during human
embryonic development. J Biol Chem 269:2822728234[Abstract/Free Full Text]
-
Carey DE, Liu X 1995 Expression of bone
morphogenetic protein-6 messenger RNA in bovine growth plate
chondrocytes of different size. J Bone Miner Res 10:401405[Medline]
-
Hughes FJ, Collyer J, Stanfield M, Goodman SA 1995 The effects of bone morphogenetic protein-2, -4, and -6 on
differentiation of rat osteoblast cells in vitro.
Endocrinology 136:26712677[Abstract]
-
Drozdoff V, Wall NA, Pledger WJ 1994 Expression and
growth inhibitory effect of decapentaplegic Vg-related protein 6:
evidence for a regulatory role in keratinocyte differentiation. Proc
Natl Acad Sci USA 91:55285532[Abstract/Free Full Text]
-
Bentley H, Hamdy FC, Hart KA, Seid JM, Williams JL,
Johnstone D, Russell RGG 1982 Expression of bone morphogenetic
proteins in human prostatic adenocarcinoma and benign
prostatic hyperplasia. Br J Cancer 66:11591163
-
Gitelman SE, Kobrin MS, Ye J, Lopez AR, Lee A, Derynck
R 1994 Recombinant Vgr-1/BMP-6 expressing tumors induce fibrosis
and endochondral bone formation in vivo. J Cell Biol 126:15951609[Abstract/Free Full Text]
-
Harris SE, Harris MA, Feng JQ, Sabatini M, Wozney J,
Rosen V, Moutastsos I, Bonewald L, Mundy GR 1992 Expression of
bone morphogenetic proteins (BMPs) during differentiation of fetal rat
calvarial osteoblasts in vitro. J Bone Miner Res
7:S120
-
Gitelman SE, Kirk M, Ye J, Filvaroff EH, Kahn AJ,
Derynck R 1995 Vgr-1/BMP-6 induces osteoblastic differentiation of
pluripotential mesenchymal cells. Cell Growth Differ 6:827836[Abstract]
-
Gazit D, Ebner R, Kahn AJ, Derynck R 1993 Modulation of expression and cell surface binding of members of the
transforming growth factor-ß superfamily during retinoic acid induced
osteoblastic differentiation of multipotential mesenchymal cells. Mol
Endocrinol 7:189198[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
R. Garimella, S. E. Tague, J. Zhang, F. Belibi, N. Nahar, B. H. Sun, K. Insogna, J. Wang, and H. C. Anderson
Expression and Synthesis of Bone Morphogenetic Proteins by Osteoclasts: A Possible Path to Anabolic Bone Remodeling
J. Histochem. Cytochem.,
June 1, 2008;
56(6):
569 - 577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Donn, A. Berry, A. Stevens, S. Farrow, J. Betts, R. Stevens, C. Clayton, J. Wang, L. Warnock, J. Worthington, et al.
Use of gene expression profiling to identify a novel glucocorticoid sensitivity determining gene, BMPRII
FASEB J,
February 1, 2007;
21(2):
402 - 414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Derfoul, G. L. Perkins, D. J. Hall, and R. S. Tuan
Glucocorticoids Promote Chondrogenic Differentiation of Adult Human Mesenchymal Stem Cells by Enhancing Expression of Cartilage Extracellular Matrix Genes
Stem Cells,
June 1, 2006;
24(6):
1487 - 1495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Deregowski, E. Gazzerro, L. Priest, S. Rydziel, and E. Canalis
Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/beta-Catenin but Not Bone Morphogenetic Protein Signaling
J. Biol. Chem.,
March 10, 2006;
281(10):
6203 - 6210.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang
Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass
Endocrinology,
May 1, 2005;
146(5):
2415 - 2423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, E. M. Schwarz, M. J. Zuscik, R. N. Rosier, A. M. Ionescu, J. E. Puzas, H. Drissi, T.-J. Sheu, and R. J. O'Keefe
Retinoic Acid Stimulates Chondrocyte Differentiation and Enhances Bone Morphogenetic Protein Effects through Induction of Smad1 and Smad5
Endocrinology,
June 1, 2003;
144(6):
2514 - 2523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev.,
April 1, 2003;
24(2):
218 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Pereira, A. N. Economides, and E. Canalis
Bone Morphogenetic Proteins Induce Gremlin, a Protein That Limits Their Activity in Osteoblasts
Endocrinology,
December 1, 2000;
141(12):
4558 - 4563.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gilbert, X. He, P. Farmer, S. Boden, M. Kozlowski, J. Rubin, and M. S. Nanes
Inhibition of Osteoblast Differentiation by Tumor Necrosis Factor-{alpha}
Endocrinology,
November 1, 2000;
141(11):
3956 - 3964.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Pereira, D. Durant, and E. Canalis
Transcriptional regulation of connective tissue growth factor by cortisol in osteoblasts
Am J Physiol Endocrinol Metab,
September 1, 2000;
279(3):
E570 - E576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yamaguchi, T. Komori, and T. Suda
Regulation of Osteoblast Differentiation Mediated by Bone Morphogenetic Proteins, Hedgehogs, and Cbfa1
Endocr. Rev.,
August 1, 2000;
21(4):
393 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. O. Abu, A. Horner, V. Kusec, J. T. Triffitt, and J. E. Compston
The Localization of the Functional Glucocorticoid Receptor {alpha} in Human Bone
J. Clin. Endocrinol. Metab.,
February 1, 2000;
85(2):
883 - 889.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. A. Zlotolow, A. R. Vaccaro, M. L. Salamon, and T. J. Albert
The Role of Human Bone Morphogenetic Proteins in Spinal Fusion
J. Am. Acad. Ortho. Surg.,
January 1, 2000;
8(1):
3 - 9.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Binkert, M. Demetriou, B. Sukhu, M. Szweras, H. C. Tenenbaum, and J. W. Dennis
Regulation of Osteogene |