help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boden, S. D.
Right arrow Articles by Nanes, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boden, S. D.
Right arrow Articles by Nanes, M. S.
Endocrinology Vol. 138, No. 7 2820-2828
Copyright © 1997 by The Endocrine Society


ARTICLES

Glucocorticoid-Induced Differentiation of Fetal Rat Calvarial Osteoblasts Is Mediated by Bone Morphogenetic Protein-6

Scott D. Boden, Gregory Hair, Louisa Titus, Michele Racine, Kimberly McCuaig, John M. Wozney and Mark S. Nanes

Department of Orthopaedic Surgery and Division of Endocrinology, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, Georgia 30033

Address all correspondence and requests for reprints to: Scott D. Boden, M.D., The Emory Spine Center, 2165 North Decatur Road, Decatur, Georgia 30033.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucocorticoids (GCs) at physiological concentrations promote osteoblast differentiation from fetal calvarial cells, calvarial organ cultures, and bone marrow stromal cells; however, the cellular pathways involved are not known. Bone morphogenetic proteins (BMPs) are recognized as important mediators of osteoblast differentiation. Specific roles for individual BMPs during postembryonic membranous bone formation have yet to be determined. We recently reported that GC potentiated the osteoblast differentiation effects of BMP-2 and BMP-4, but not of BMP-6, which, by itself, was the most potent of the three. In the present study, we used fetal rat secondary calvarial cultures to study the role of BMP-6 during early osteoblast differentiation.

Treatment with the GC triamcinolone (10-9 M) resulted in a 5- to 8-fold increase in BMP-6 steady-state messenger RNA levels, peaking at 12 h. In contrast, BMPs -2, -4, -5, -7, and transforming growth factor (TGF)-ß1 messenger RNA levels increased by less than 2-fold, after GC treatment, compared with untreated control cultures at 24 h. BMP-6 protein secretion increased 6- to 7-fold by 12 h and 12-fold (from 7.5 to 90 ng/ml) by 24 h, as measured by quantitative Western analysis. Treatment of cells with oligodeoxynucleotides antisense to BMP-6 diminished secretion of BMP-6 protein and significantly inhibited the GC-induced differentiation, as determined by a 10-fold decrease in the number of mineralized bone nodules, compared with controls that were treated with sense oligonucleotides or no oligonucleotides (ANOVA, P < 0.05). The antisense oligonucleotide inhibition of differentiation was rescued by treatment with exogenous recombinant human BMP-6. We conclude that GC-induced differentiation of osteoblasts from the pluripotent precursors is mediated, in part, by BMP-6. These results suggest that BMP-6 has an important and unique role during early osteoblast differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OSTEOBLASTS ARE thought to be derived from pluripotent mesenchymal stem cells. Although glucocorticoids (GCs) at pharmacologic doses inhibit osteoblast function (1, 2), GCs at physiological concentration can promote osteoblast differentiation from mesenchymal precursors and enhance expression of the mature osteoblast phenotype. GCs can promote increased numbers of nodules and higher levels of osteocalcin secretion in primary and secondary rat calvarial cell cultures (3, 4, 5). Similar results have been observed in chick osteoblast cultures (6) and bone organ cultures (7). GCs also have been noted to induce osteoblastic expression in chick, mouse, rat, and human marrow stromal cell cultures (8, 9, 10, 11, 12, 13, 14, 15). The mechanism by which GCs promote osteoblast differentiation is unknown.

Bone morphogenetic proteins (BMPs) are growth factors found in bone matrix that have been shown to be important regulators of membranous and endochondral bone formation (16, 17). A synergism between GCs and BMP-2 for induction of osteoblast differentiation from marrow stromal cells has been reported (8). We recently extended that observation to a fetal rat calvarial cell culture model and demonstrated GC potentiation of the differentiating effect of BMP-2 and BMP-4 but only minimal potentiation of the effects of BMP-6. In our culture model, BMP-6 had a greater effect on differentiation than BMP-2 or BMP-4, as measured by discrete mineralized nodule formation (5).

In this investigation, we explored the mechanism of GC stimulation of osteoblast differentiation and the possible mediation of GC action by BMP-6. We found that GC treatment results in a significant and selective increase in BMP-6 message levels and protein expression. Furthermore, blocking the expression of BMP-6 protein, using antisense deoxyoligonucleotides, resulted in a loss of the GC effect on differentiation that could be rescued only with exogenous recombinant human (rh)BMP-6. These results suggest that BMP-6 is an important early mediator in osteoblast differentiation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
rhBMP-2, -4, and -6, produced in Chinese hamster ovary cells, were obtained from Genetics Institute (Cambridge, MA). MEM supplemented with L-glutamine was purchased from GIBCO BRL (Gaithersburg, MD); BGJb bone culture medium, the GC triamcinolone acetonide, ß-glycerophosphate (ß-GlyP), and ascorbic acid from Sigma (St. Louis, MO); and heat-inactivated FBS from HyClone (Logan, UT). Timed pregnant Sprague-Dawley rats were purchased from Charles River Laboratories (Raleigh, NC).

Calvarial cell preparation
After approval by the Institutional Animal Care and Use Committee, fetal Sprague-Dawley rats were removed at 20-days gestation and decapitated and the heads submerged in sterile PBS with 1% penicillin/streptomycin-5000 U (GIBCO). The crania were dissected using sterile technique in the laminar flow hood. Parietal and frontal bones were dissected free from the sutures and subjected to four collagenase digestions (type 1:type II = 6:1). The specific activity of collagenase (Worthington Enzymes, Freehold, NJ) was 43 IU/ml in the first digestion and 172 IU/ml for the remaining three digestions. All digestions were carried out at 32 C for 20 min each. Cells from the latter two digestions were pooled to provide a rat osteoblastic (rOB)-enriched cell suspension (5). The pooled cells were washed, pelleted, resuspended in MEM/10% FBS, counted by hemocytometer, and seeded in T-75 vented flasks (Corning, Corning, NY) at 1 x 106 cells/flask. Cells were grown at 37 C in 5% CO2 with humidification. The cells were fed at 48 h and again at 96 h with MEM/10% FBS. Seven days after seeding, the primary culture was trypsinized and passed into 6-well plates at 1 x 105 cells/35-mm well) as first subculture cells. Cells were grown for an additional 7 days, during which time they reached second confluence (day zero). Beginning on day 0, media were changed and treatments (GCs and/or cytokines) were applied under a laminar-flow hood every 3–4 days. The standard culture protocol was as follows: days 0–7 = MEM, 10% FBS, 50 µg/ml ascorbic acid; days 8–14 = BGJb medium, 10% FBS, 5 mM ß-GlyP (as a source of inorganic phosphate to permit mineralization). Alternatively, for stimulus switch/change experiments: days 0–3 = MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 1; days 4–7 = MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 2; days 8–14 = BGJb medium, 10% FBS, 5 mM ß-GlyP. Endpoint analysis of bone nodule formation and osteocalcin secretion was performed at day 14.

The dose of rhBMP-6 was chosen as 50 ng/ml, based on pilot experiments in this system that demonstrated a midrange effect on the dose response curve. The dose of triamcinolone (GC) was chosen as 1 nM, based on previous dose-response experiments in this culture system (5).

Quantitation of bone formation
Cultures were fixed overnight in 70% ethanol and stained with von Kossa silver stain. A semiautomated computerized video image analysis system (Optomax 5, Optomax, Hollis, NH) was used to quantitate nodules in each well. This automated technique was validated previously against a manual counting technique and demonstrated an r value of 0.92 (P < 0.000001) (5). All data are expressed as the mean ± SEM, calculated from 5–6 wells at each condition. Each experiment was reconfirmed at least two times using cells from different calvarial preparations.

Quantitation of osteocalcin secretion
Osteocalcin levels in the medium were measured using a competitive RIA with a monospecific polyclonal antibody (PAb) raised in our laboratory against the C-terminal octapeptide of rat osteocalcin, as described previously, except for use of an acetylated peptide analog as radioligand and standard (18). Osteocalcin values were reported as pmol/ml medium (3-day production). Values are expressed as the mean ± SEM of triplicate determinations for 5–6 wells for each condition. Each experiment was reconfirmed at least two times using cells from different calvarial preparations.

RNA extraction and purification
Cellular RNA from duplicate 35-mm wells (6-well culture dish) was harvested to yield statistical triplicates using 4 M guanidine isothiocyanate solution (19). Briefly, medium was aspirated from wells, wells overlaid with 0.6 ml guanidine isothiocyanate solution per duplicate, and plates swirled for 5–10 sec. Samples were stored at -70 C for up to 7 days before being processed.

RNA was purified by a modification of standard methods (19). Briefly, thawed samples received 60 µl 2.0 M sodium acetate (pH 4.0), 550 µl phenol (water saturated), and 150 µl chloroform:isoamyl alcohol (49:1); were vortexed, centrifuged (10,000 x g; 20 min; 4 C); the aqueous phase transferred to a fresh tube; and the RNA precipitated overnight (-20 C) upon addition of 600 µl isopropanol.

Samples were centrifuged (20 min; 10,000 x g), supernatant aspirated gently, pellets resuspended in 400 µl diethyl pyrocarbonate (DEPC)-treated water, extracted once with phenol:chloroform (1:1), extracted with chloroform:isoamyl alcohol (24:1), and precipitated overnight at -20 C after addition of 40 µl sodium acetate (3.0 M; pH 5.2) and 1.0 ml absolute ethanol. Samples were centrifuged (10,000 x g; 20 min), washed twice with 70% ethanol, air dried for 5–10 min, and resuspended to 20 µl in DEPC-treated water. Optical densities were determined using a Beckman DU 640 Spectrophotometer (Beckman Instruments Inc., Schaumburg, IL).

RT-PCR
RNA was subjected to RT by a modification of standard methodologies (20). Briefly, denatured total RNA (5 µg in 10.5 µl total vol in DEPC-treated H2O at 65 C for 5 min) was added to tubes containing 4 µl 5 x MMLV-RT buffer (GIBCO), 2 µl deoxynucleotide triphosphates, 2 µl oligo dT17-mer (10 pmol/ml), 0.5 µl RNAsin (40 U/ml, Promega, Madison, WI), 1 µl MMLV-RT (GIBCO), and the final vol adjusted to 20 µl. Samples were reverse transcribed at 37 C for 1 h, and the reaction was halted by heating at 95 C for 5 min.

Transcribed samples (5 µl) were subjected to PCR using standard methodologies (20). Briefly, samples were added to tubes containing water and appropriate amounts of PCR buffer (Perkin Elmer, Foster City, CA), 25 mM MgCl2, dNTPs, forward and reverse primers (10 pM final concentration) for glyceraldehyde phosphate dehydrogenase (GAPDH) or BMP-6, 32P-deoxycytosine triphosphate, and Amplitaq (Perkin Elmer). PCR was performed for 22 cycles (94 C, 30 sec; 58 C, 30 sec; 72 C, 20 sec). Primer sequences from 5' to 3' were: BMP-6 (forward) = GTACCGGCGGCTCAAGACGC, BMP-6 (reverse) = GGGACGAGCTGGCTGCTTCG, GAPDH (forward) = CTGGTCATCAATGGGAAAC, GAPDH (reverse) = CAAAGTTGTCA-TGGATGACC.

Quantitation of RT-PCR products by PAGE and PhosphorImager analysis
RT-PCR products received 5 µl/tube loading dye, were mixed, heated (65 C x 10 min), centrifuged, and 10 µl each subjected to 12% PAGE under standard conditions (19). Gels were then incubated in gel-preserving buffer (10% vol/vol glycerol, 7% vol/vol acetic acid, 40% vol/vol methanol, 43% deionized water) for 30 min, dried at 80 C on a GelDryer (Bio-Rad Laboratories, Hercules, CA) in vacuo 1–2 h, and analyzed by PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Visualized band intensities were measured after background correction. Intensities were normalized to a GAPDH control (a housekeeping gene not regulated by GC) to account for unequal loading and potential changes in cell number at different points in time.

Ribonuclease (RNAse) protection assay (RPA)
Labeled riboprobe for BMP-6 messenger RNA (mRNA) was prepared from BMP-6 vector, generously supplied by Drs. Wozney and Celeste (Genetics Institute). Briefly, the SP6 promoter site was used to initiate the complementary riboprobe strand (Riboprobe Gemini II, Promega). Labeled riboprobe was added to a sample of total RNA (10–100 µg) resuspended in 20 µl hybridization buffer, and RPA was performed according to standard protocol (Boehringer Mannheim Kit No. 1427–580). Purified double-stranded RNA was separated by 6% urea denaturing gel electrophoresis, and the presence of BMP-6 RNA was determined by phosphorimaging.

Quantitation of BMP-6 protein
BMP-6 protein was quantitated by Western blot analysis of homogenates prepared from whole cultures. Cells were scraped into the medium and lysed by repeated freezing at -70 C and thawing. Resulting microvesicles were sonicated five times (Heat Systems, Ultrasonics, Inc.) for 30 sec at full power and cooled in ice. Homogenates were stored at -70 C in the presence of 0.5 mM phenylmethysulfonyl fluoride and 0.2 mM leupeptin for up to 3 weeks before analysis.

Proteins (50 µg) within the homogenates were separated under reducing conditions by 12% PAGE (21). Gels were transblotted to polyvinylidene difluoride membrane (Bio-Rad) in Tris-glycine buffer overnight at 75 mA (22). Where necessary, proteins were visualized by transient Ponceau staining (23). The membranes were prewashed (5 x 10 min) in Tris-buffered saline (TBS), blocked for 1 h at room temperature with TBS/10% FBS/3% BSA, and washed (3 x 5 min) in TBS/1% FBS. PAb specific to the mature region of BMP-6 (1 µg/ml 2A06-TB3, a generous gift of Drs. Wozney and Celeste at Genetics Institute) was applied overnight at 4 C to biotinylated goat antirabbit antiserum (Bio-Rad) diluted 1:250 in TBS/1% FBS. Membranes were washed again (3 x 5 min) in TBS/1% FBS, exposed for 1 h at room temperature to horseradish peroxidase-conjugated streptavidin (Bio-Rad) diluted 1:250 in TBS/1% FBS, and washed (3 x 5 min) in TBS/1% FBS. Bands were visualized using the TMB Peroxidase Substrate System (KPL, Gaithersburg, MD). Lanes were scanned and digitized using a densitometer (Scanjet II, Hewlett-Packard) and the total density in each lane quantitated using densitometric software (Molecular Dynamics). The specificity of 2A06-TB3 for BMP-6 was confirmed by preblocking the primary antibody with 5-fold molar excess of rhBMP-6. The optimum antibody dilution was determined by serial antibody dilution curves using 10 µg rhBMP-5, 6, and 7 as antigen. The dilution chosen had minimal cross-reactivity with BMP-5 or BMP-7.

Antisense treatment and cell culture
Antisense oligonucleotide inhibition of BMP-6 expression was accomplished with a specific 19-base oligonucleotide binding 7 nucleotides downstream of the translation start site. Oligonucleotides spanning the methionyl initiation codon were not used because of homology with other members of the TGF-ß superfamily. BMP-6 antisense oligonucleotide sequence was as follows: 5'-TGCTAGTTGCTGTGATGTC-3'. Controls were treated with the complementary sense oligonucleotide or no oligonucleotide treatment. Transfection of DNA was accomplished with similar results using either of two protocols (in the presence or absence of lipofectamine). In both protocols, 11 µg sense or antisense BMP-6 oligonucleotides were incubated in MEM for 45 min at room temperature. Either more MEM or preincubated lipofectamine + MEM (7% vol/vol; 45 min at room temperature) was added to achieve a final oligonucleotide concentration of 0.1 µM. The resulting mixture was incubated 15 min at room temperature.

Treatment of cells with one of the three oligonucleotide mixtures (antisense, sense, or vehicle) was performed in standard media with or without GC stimulation. Media containing lipofectamine were changed after 4 h of incubation and replaced with fresh media with neither lipofectamine nor oligonucleotides. Cultures transfected without lipofectamine had their media changed at 24 h to media containing no oligonucleotide. Protein was harvested at 0, 12, 24, 48, and 72 h; RNA was harvested at 0, 12, 24, 36, 48, 60, and 72 h or 0, 1, 3, 5, and 7 days. Several cultures from each experiment were grown to 14 days (including the usual media change to BGJb at day 7) to determine mineralized nodule counts and osteocalcin secretion.

Statistical methods
Nodule counts and osteocalcin levels from representative experiments are expressed as the mean ± SEM from an N = 5–6 per group. Data were normalized to the maximum value for each parameter to allow simultaneous graphing of nodule counts, mineralized areas, and osteocalcin. For RT-PCR, RPA, or Western blot analysis, data from triplicate samples of representative experiments were used to determine the mean ± SEM. Graphs are shown normalized to either day zero or no-treatment controls and expressed as fold increases above control values. Statistical significance was evaluated using a one-way ANOVA with post hoc multiple comparison corrections of Bonferroni (Sigmastat, Jandel Scientific, Corte Madera, CA). {alpha} levels for significance were defined as P less than 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GC increase of BMP-6 mRNA levels
We first measured the effect of GC on BMP mRNA levels by RT-PCR. Figure 1Go demonstrates a 5.6-fold induction of BMP-6 steady-state mRNA levels after 24 h of GC treatment, compared with untreated cells at the same time point. In contrast, mRNA levels for BMP-2, BMP-4, BMP-5, BMP-7, and TGF-ß1 were increased with GC treatment by less than 2-fold (F = 69.8, P < 0.0001).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. GC treatment preferentially enhances BMP-6 mRNA levels, compared with mRNA for other members of the TGF-ß superfamily. Secondary fetal rat calvarial cell cultures were treated with or without the GC triamcinolone (1 nM) for 24 h. Total RNA was extracted and RT-PCR performed on triplicate samples using specific primers for each species. PCR product was normalized to GAPDH PCR product. Data are presented as the fold increase of each mRNA species over the respective level found in control cultures not treated with GC. Values are expressed as mean ± SEM.

 
BMP-6 mRNA levels are not increased by BMP-2
In another set of experiments, we confirmed an increase of BMP-6 message by GC (F = 15.8, P < 0.0001) and demonstrated that BMP-6 expression was not increased by rhBMP-2 (50 ng/ml x 24 h) treatment (Fig. 2AGo). Treatment with rhBMP-2 resulted in a slightly decreased level of BMP-6 mRNA. The BMP-6 PCR product was sequenced by both automated and manual techniques. By both methods, the sequence obtained was greater than 90% homologous to the published rat BMP-6 sequence and less than 75% homologous to either mouse BMP-5 or rat BMP-7. The deduced amino acid homology was 100% between our PCR product and published rat BMP-6 protein sequence. To confirm the quantitation of the RT-PCR technique, the same RNA was analyzed using RNase RPA for BMP-6. Figure 2BGo demonstrates nearly identical quantitation of the GC induction of BMP-6 (2.7 ± .4 vs. 2.5 ± 0.2, not significant) to that of the RT-PCR method. The GC-induced increase in BMP-6 mRNA was 2-fold less than that seen in other experiments because the data in Fig. 2Go were obtained from a single calvarial cell preparation to validate the mRNA quantitation. This emphasizes the rationale for confirming all results in cells from three different calvarial preparations, as was the case for all remaining experiments.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Effect of GC and rhBMP-2 on BMP-6 mRNA levels; comparison of two methods of measurement. Secondary fetal rat calvarial cell cultures were treated for 24 h with no addition, GC (1 nM triamcinolone), rhBMP-2 (50 ng/ml), or GC + rhBMP-2. A, Total RNA was extracted from triplicate samples and BMP-6 mRNA was quantitated, relative to GAPDH, by RT-PCR. Data are presented as the mean ± SEM fold increase over BMP-6 mRNA levels in untreated control cultures (arbitrarily set to 1). The inset shows representative images from the phosphorimager from which the quantitative data were obtained. Data from three independent experiments were similar. B, Using 30 µg of the same total RNA, BMP-6 mRNA was quantitated by RPA. The inset shows representative images quantitated by phosphorimager analysis. The mean ± SEM fold increase in BMP-6 mRNA levels in response to each treatment is similar when quantitated by either method.

 
Time course of GC induction of BMP-6 mRNA transcripts
Figure 3AGo shows steady-state BMP-6 mRNA levels (by RT-PCR) for 7 days of GC treatment. The peak BMP-6 mRNA level was seen on day 1 and was 5.6 ± .5-fold greater than on day 0 (F = 92.3, P < 0.0001), whereas the increase in BMP-6 expression in untreated cells was only 1.7 ± .1-fold. This experiment was repeated with more sampling time points in a 72-h time period. Figure 3BGo demonstrates an even greater increase in BMP-6 message level after 12 h of GC than that seen after 24 h (13.7 ± 0.2 vs. 6.0 ± .7). Again, the untreated cells showed minimal increase in BMP-6 expression (F = 60.4, P < 0.0001).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Time course of GC-stimulated increase in BMP-6 mRNA levels. Secondary fetal rat calvarial cell cultures were treated with (solid line) or without (dashed line) GC (1 nM triamcinolone) for the indicated time periods. Total RNA was extracted from triplicate samples and BMP-6 mRNA levels were measured by RT-PCR and normalized to GAPDH. Data are expressed as mean ± SEM fold increase over pretreatment values (arbitrarily set to 1). A, The time course was similar in three independent experiments and demonstrated an early increase in BMP-6 mRNA levels in response to GC treatment. B, An earlier time course was then performed, demonstrating the peak rise in BMP-6 mRNA to be at 12 h. Furthermore, a measurable rise was already present at 2 and 6 h. The 24-h and 72-h time points correlate well with the values obtained in the earlier time course experiments (panel A). These data were confirmed in two independent triplicate experiments.

 
Correlation of BMP-6 mRNA levels and BMP-6 protein synthesis
To confirm that an increase in BMP-6 mRNA levels resulted in increased BMP-6 protein synthesis, we analyzed BMP-6 protein in whole cultures treated in parallel with those described in Fig. 3BGo. The peak in total BMP-6 protein levels within these cultures was determined by Western analysis to occur 24 h after GC treatment (Fig. 4AGo); this was 12 h after the peak rise in BMP-6 mRNA levels. Significantly less BMP-6 protein was observed in the untreated control cultures (F = 63.8, P < 0.0001). A representative blot of a gel run under reduced conditions (Fig. 4BGo) shows the expected four bands detected by the BMP-6 antibody. The 90-kDa and 65-kDa bands represent pre-pro forms of BMP-6 that are synthesized as homodimers. Before secretion, they are cleaved to the 16-kDa mature form, which when glycosylated, appears as a 23-kDa band. The PAb was raised against an epitope within the mature region of the BMP-6 protein and does not detect subunits cleaved from the pre-pro homodimer. Identification of the various BMP-6 species was aided by electrophoresing the same samples under nonreducing conditions. When not reduced, 125-kDa and 45-kDa bands were detected by the BMP-6 specific antibody. These represent homodimers of the 65-kDa and 23-kDa protein species. Gas phase sequence analysis determined that the 16-kDa and 23-kDa bands contain N-terminal sequence consistent with rat BMP-6. The quantitation data in Fig. 4AGo includes all four bands detected by the BMP-6 antibody under reducing conditions; however, the result is unchanged when only the mature 16-kDa and 23-kDa species are considered for quantitation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Time course of GC-stimulated increase in BMP-6 protein levels. Secondary fetal rat calvarial cell cultures were treated with (solid line) or without (dashed line) GC (1 nM triamcinolone) for the indicated time periods. Cells, matrix, and media were homogenized together and the proteins separated under reducing conditions and analyzed three times by Western blot analysis. A, Total BMP-6 protein in each lane at the individual time points was compared with that before treatment (set arbitrarily to 1) and expressed as the mean ± SEM. B, Representative Western blot from cultures treated with or without GC and analyzed as above. Four bands at 16, 23, 65, and 90 kDa were visualized and represent various immature and mature forms of the synthesized and secreted BMP-6 protein. Total densities (sum of the intensity of the four bands) were used for quantitation in panel A.

 
In two additional experiments BMP-6 levels were analyzed separately in the cell/matrix layer and in the medium (secreted BMP-6). The BMP-6 protein present during the first 12 h after GC treatment was comprised of the 90-kDa and 65-kDa species and was mainly located in the cell fraction. The 16-kDa and 23-kDa species were seen later (48 h), predominantly in the medium (data not shown). Using a standard curve consisting of six doses of rhBMP-6 (0.5–500 ng), we estimated that the total BMP-6 protein increased from 5 ng/ml to 87 ng/ml at 48 h in the GC-treated cultures. There was only a minimal increase in BMP-6 protein in the untreated control cultures.

Inhibition of BMP-6 protein synthesis
To determine if BMP-6 was a critical factor in GC-induced osteoblast differentiation, we performed experiments with oligodeoxynucleotides antisense to BMP-6. Antisense oligonucleotides form DNA:RNA duplexes with the specific mRNA species, thereby blocking binding of the mRNA to the 40 S ribosomal subunit and preventing translation (24). Figure 5AGo demonstrates a significant decrease (F = 87.0, P < 0.0001) in BMP-6 protein levels when untreated control cells were treated with antisense BMP-6 oligonucleotides for 12 h (67 ± 6% decrease); a larger decrease was observed in cells stimulated to differentiate with GC (84 ± 5% decrease). Similar results in BMP-6 protein levels (74 ± 5% decrease) were observed after transfection of oligonucleotides with lipofectamine for 4 h. Sense oligonucleotides had no significant effect on BMP-6 protein, similar to control cultures not treated with oligonucleotides. As expected, Fig. 5BGo demonstrates that the steady-state BMP-6 mRNA levels, as measured by RT-PCR, did not change as a result of the sense or antisense BMP-6 oligonucleotides or the lipofectamine (F = 20.0, P < 0.0001). These data are consistent with the expected antisense oligonucleotide inhibition of translation rather than transcription.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 5. Effect of BMP-6 sense and antisense oligonucleotides on BMP-6 protein and mRNA levels. Secondary fetal rat calvarial cell cultures were treated with or without GC (1 nM triamcinolone) in the presence of no oligonucleotide (-), 100 nM BMP-6 sense oligonucleotide (S), or 100 nM BMP-6 antisense oligonucleotide (AS). Other cultures were treated identically but with the addition of the transfection agent lipofectamine (LF) for 4 h, followed by fresh medium without lipofectamine for an additional 8 h. A, Twelve hours after treatment was initiated, samples (pooled from two 35-mm cultures) were homogenized and analyzed twice for BMP-6 protein by Western analysis. Data were pooled from the two analyses and are presented as mean ± SEM fold change over the no-treatment value (set arbitrarily to 1). The inset shows one of the gels that was quantified to obtain the data presented graphically. B, Twelve hours after treatment was initiated, total RNA was extracted from triplicate samples and analyzed by RT-PCR for BMP-6 mRNA levels. Data are presented as mean ± SEM relative to the no-treatment value (set arbitrarily to 1). As expected, BMP-6 mRNA levels were unchanged by oligonucleotide treatment, whereas BMP-6 protein synthesis was nearly completely blocked by BMP-6 antisense oligonucleotides. Results were similar in each of two independent experiments.

 
To determine the functional effects of blocking the early rise in BMP-6 in differentiating osteoblasts, we also measured the effect on a more physiologically relevant endpoint, bone nodule formation (Fig. 6Go). We elected not to measure alkaline phosphatase activity as a potential early marker because of its lower tissue specificity and more variable correlation with the mature osteoblast phenotype, compared with nodule formation and osteocalcin secretion. Formation of such mineralized nodules in vitro represents a late stage in osteoblast differentiation, as these nodules are capable of secreting the bone-specific matrix protein osteocalcin. The oligonucleotides antisense to BMP-6 resulted in a significant decrease in bone nodule formation: 79 ± 7% decrease (-GC); 91 ± 5% decrease (+GC); and 89 ± 5% decrease (+GC/lipofectamine) (F = 90.2, P < 0.0001). Treatment with the sense BMP-6 oligonucleotides did not result in a significant decrease in nodule formation.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. Inhibition of BMP-6 protein synthesis blocks nodule formation in rat calvarial cultures. Secondary fetal rat calvarial cell cultures were treated, as in Fig. 5Go, with or without GC (1 nM triamcinolone) and in the presence of no oligonucleotide (-), 100 nM BMP-6 sense oligonucleotide (S), or 100 nM BMP-6 antisense oligonucleotide (AS). After 24 h, the medium was replaced with fresh medium devoid of oligonucleotides. Other cultures were treated identically but with the addition of the transfection agent lipofectamine (LF) for 4 h, followed by fresh medium without lipofectamine for an additional 8 h. After the initial oligonucleotide treatment, cultures were continued in MEM for the remainder of the first 7 days and then switched to BGJb medium with 5 mM ß-GlyP to permit mineralization of nodules. Fourteen days after the initial treatment, cultures (in six 35-mm wells per treatment group) were von Kossa stained and the nodules counted. Data are expressed as the mean ± SEM and are representative of five independent experiments.

 
Rescue of antisense oligonucleotide-treated cultures with rhBMP-6 (50 ng/ml x 7 days) prevented the inhibitory effect of the antisense oligonucleotides (F = 1.3, P < .323) and completely restored the differentiating effect of GC (Fig. 7Go). Addition of rhBMP-6 reversed the effect of BMP-6 antisense oligonucleotides on GC-stimulated nodule formation and eliminated the low rate of spontaneous nodule formation in control cultures not treated with GC. Experiments in which rhBMP-2 (50 ng/ml x 7 days) was added after the BMP-6 antisense oligonucleotide treatment, did not demonstrate restoration of GC-induced differentiation (data not shown). These results indicate that antisense oligonucleotides were not substantially toxic to the cultures and also support the specificity of BMP-6 effects on early osteoblast differentiation.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. Exogenous rhBMP-6 can prevent the BMP-6 antisense oligonucleotide block of GC stimulation of osteoblast differentiation. Secondary fetal rat calvarial cell cultures were treated, as in Fig. 6Go, with or without GC (1 nM triamcinolone) and in the presence of no oligonucleotide (-), 100 nM BMP-6 sense oligonucleotide (S), or 100 nM BMP-6 antisense oligonucleotide (AS). After 24 h, the medium was replaced with fresh medium devoid of oligonucleotides. Other cultures were treated identically, except for the addition of the transfection agent lipofectamine (LF) for 4 h, followed by fresh medium without lipofectamine for an additional 8 h. After the initial oligonucleotide treatment, cultures were continued in MEM with 50 ng/ml rhBMP-6 for the remainder of the first 7 days and then switched to BGJb medium with 5 mM ß-GlyP to permit mineralization of nodules. Fourteen days after the initial treatment, cultures (in three 35-mm wells per treatment group) were von Kossa stained and the nodules counted. Data are expressed as the mean ± SEM and are representative of three independent experiments. Addition of rhBMP-6 reversed the effect of BMP-6 antisense oligonucleotides on GC-stimulated nodule formation and eliminated the low rate of spontaneous nodule formation in control cultures not treated with GC.

 
Substitution of BMP-6 for GC to initiate osteoblast differentiation
In a previous study, we determined that rat osteoblast cultures were more responsive to rhBMP-2 treatment after a 3-day pretreatment with GC (5). Because an important mechanism of GC-induced osteoblast differentiation seems to be induction of BMP-6, we attempted to substitute rhBMP-6 directly for GC. We found that BMP-6 was able to directly substitute for GC as the pretreatment agent sensitizing the cells to BMP-2, as measured by both mineralized nodule counts (F = 251.9, P < 0.0001) (Fig. 8AGo) and osteocalcin secretion (F = 107.4, P < 0.0001) on day 14 (Fig. 8BGo). These results suggest that BMP-6 is largely responsible for the differentiating effects of GCs in osteoblast cultures. In addition, BMP-6 given early seems to potentiate the effect of BMP-2 given later during differentiation, suggesting a unique temporal sequence and specific roles for individual BMPs during osteoblast differentiation.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 8. Pretreatment with rhBMP-6 can substitute for GC, to enhance the effects of rhBMP-2 on nodule formation in calvarial cultures. Secondary fetal rat calvarial cell cultures were treated on days 0–3 with either nothing (NT), GC (1 nM triamcinolone), or BMP-6 (50 ng/ml rhBMP-6). On days 4–7, treatment was switched to either no treatment (NT) or BMP-2 (50 ng/ml rhBMP-2). All cultures were grown in MEM + 50 µg/ml ascorbic acid + 10% FBS on days 0–7 and switched to BGJb +10% FBS + 5 mM ß-GlyP on days 8–14, to permit mineralization. A, Six 35-mm wells per treatment group were von Kossa stained, and the nodules were counted. Data are expressed as the nodule mean ± SEM and are representative of three independent experiments. B, Before staining on day 14, the medium from the above cultures was saved and assayed for osteocalcin by RIA. Values are expressed as the means ± SEM from triplicate determinations from 5–6 cultures that were repeated in two independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Osteoblasts are thought to differentiate from pluripotent mesenchymal cells upon exposure to specific signaling factors. Studies have documented the involvement of transcription factors, such as the basic helix-loop-helix family, as well as jun and fos in these processes for the osteoblast pathway of differentiation (25, 26, 27, 28). More recently, secreted growth factors also have been implicated in bone and cartilage development. The TGF-ß superfamily, consisting of the BMPs and other proteins, is involved in osteoblast differentiation, as well as embryonic limb bud development (29, 30, 31, 32, 33, 34). Several members of this gene family have been localized during intramembranous and endochondral bone formation and are expressed in specific spatial and temporal patterns (9, 35, 36, 37, 38). Specific roles for the various BMPs are not well established for postembryonic bone formation.

In this study, we found that BMP-6 played a uniquely important role, compared with BMPs-2, -4, -5, -7, or TGF-ß1, during early osteoblast differentiation in a rat calvarial cell culture model. This result is consistent with the hypothesis of Hughes et al. (39) that BMP-6 may act principally on an early stage of osteoprogenitor cell based on its greater potency, as demonstrated in a primary rat calvarial cell culture system. In addition, these results reinforce our previous observations that BMP-6 seemed to play an important role during differentiation in a secondary rat calvarial cell culture system (5).

Because of the close homology between BMP-6 and its other subfamily members, BMP-5 and BMP-7, we took several precautions to insure that the GC increase in BMP-6 expression was indeed specific to BMP-6. First, we demonstrated that BMP-5 and BMP-7 mRNA were not induced with GC treatment during the early (24 h) differentiation period, as measured by RT-PCR. We then confirmed the authenticity of the sequence of the BMP-6 PCR product. Although quantitative PCR can be unreliable, similar quantitation by a second methodology, such as RNase protection, increases the validity of the observation. In addition, we confirmed the specificity of BMP-6 protein detection on Western blots by peptide sequence analysis and by a series of antibody titrations targeting BMP-5, 6, and 7. The anti-BMP-6 antiserum concentration for Western blot analysis was determined, to avoid any substantial cross-reactivity with BMP-5 or BMP-7.

The close correlation in timing of BMP-6 protein detection with that of increased BMP-6 mRNA levels is an important observation in our system. Previous studies have shown that BMP-6 protein is not found in all tissues shown to express BMP-6 message (32). This suggests that there may be tissue specific posttranscriptional regulation of BMP-6 expression.

Few studies have looked specifically at the role of BMP-6 during bone formation. BMP-6 has been postulated to play a role during epithelial differentiation, central nervous system development, and hypertrophic cartilage (29, 32, 38, 40, 41). Tumors expressing BMP-6 have induced fibrosis and endochondral bone formation in vivo (42). During primary rat calvarial cell differentiation, BMP-6 mRNA has been detected on days 7–10 by Harris et al. (43). BMP-6 expression increases during differentiation in the pluripotential rOB cell line ROB-C26 (44). Additional evidence for a crucial role of BMP-6 in osteoblast differentiation was highlighted when the osteoinductive effect of matrix from C26 cells that overexpressed BMP-6 was blocked by a neutralizing BMP-6 antibody (44). In addition, treatment of the pluripotential rOB cells ROB-C26 with retinoic acid results in osteoblastic differentiation that is accompanied by an increase in BMP-6 expression and a decrease in expression of BMP-2 and -4 (45).

Our demonstration of the ability to block GC-induced osteoblast differentiation with oligonucleotides antisense to BMP-6 suggests that the mechanism of GC-induced differentiation may share a common pathway with that of retinoic acid via induction of BMP-6. Although we did not observe a decrease in BMP-6 mRNA levels, we did observe a significant decrease in BMP-6 protein expression and bone nodule formation. The antisense oligonucleotides are presumed to inhibit the translation of BMP-6 mRNA by preventing binding of mRNA to the 40 S ribosomal subunit (24). We obtained similar results with 4 h of oligonucleotide treatment in combination with lipofectamine and after 24 h of treatment without a transfection agent.

Inspection of the BMP-6 protein bands, separated under reducing conditions and detected by Western blot analysis, demonstrated that 12 h of GC treatment induced the higher molecular mass bands (90 kDa and 65 kDa). These bands are likely to represent newly synthesized immature BMP-6 consistent with sizes previously reported (32). Before secretion, a portion of the BMP-6 pre-pro molecule is cleaved, resulting in the mature form, which can be glycosylated at several different sites. The 16-kDa band represents the unglycosylated mature form of BMP-6, whereas the 23-kDa band most likely represents the glycosylated form of the mature molecule. The diffuse appearance of the 23-kDa band is most likely caused by variably glycosylated forms of the mature BMP-6 molecule migrating slightly differently from each other. Our data demonstrate that the GC treatment resulted in an induction of all four of the detected BMP-6 species, with the larger sizes appearing slightly earlier than the more mature, smaller, secreted forms.

Although other growth factors not measured in these studies may play a role in early osteoblast differentiation, these data suggest that BMP-6 is one of the more critical TGF-ß superfamily members. Not only does the induction of BMP-6 enhance bone nodule formation in cultures, but the specific inhibition of BMP-6 protein expression directly interferes with nodule formation. These data, taken with the observation that the biological activity of rhBMP-2 can be enhanced by GC or by rhBMP-6, but that the BMP-6 antisense oligonucleotide inhibition of nodule formation cannot be effectively rescued by rhBMP-2, suggest that BMP-6 may represent a critical component of the osteoblast differentiation pathway. These findings also demonstrate that specific BMPs may have unique temporal and functional roles in bone formation that are not necessarily redundant or interchangeable.


    Footnotes
 
This work was supported in part by the Smith and Nephew Richards Research Grant through the Orthopaedic Research and Education Foundation (to S.D.B.) and by Merit Review Grant Awards from the Veterans Affairs Medical Center (to S.D.B. and M.S.N.).

Received January 14, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chaudhary LR, Avioli LV 1994 Dexamethasone regulates IL-1b and TNF-a-induced interleukin-8 production in human bone marrow stromal cells and osteoblast-like cells. Calcif Tissue Int 55:16–20[CrossRef][Medline]
  2. Kasperk C, Schneider U, Sommer U, Niethard F, Ziegler R 1995 Differential effects of glucocorticoids on human osteoblastic cell metabolism in vitro. Calcif Tissue Int 57:120–126[CrossRef][Medline]
  3. Bellows CG, Aubin JE, Neersche JNM 1987 Physiological concentrations of glucocorticoids stimulate formation of bone nodules from isolated rat calvaria cells in vitro. Endocrinology 121:1985–1992[Abstract]
  4. Breen EC, Ignotz RA, McCabe L, Stein JL, Stein GS, Lian JB 1994 TGF-b alters growth and differentiation related gene expression in proliferating osteoblasts in vitro, preventing development of the mature bone phenotype. J Cell Physiol 160:323–335[CrossRef][Medline]
  5. Boden SD, McCuaig K, Hair G, Racine M, Titus L, Wozney JM, Nanes MS 1996 Differential effects and glucocorticoid potentiation of bone morphogenetic protein action during rat osteoblast differentiation in vitro. Endocrinology 137:3401–3407[Abstract]
  6. Tenenbaum HC, Heersche JN 1985 Dexamethasone stimulates osteogenesis in chick periosteum in vitro. Endocrinology 117:2211–2217[Abstract]
  7. McCulloch CAG, Tenenbaum HC 1986 Dexamethasone induces proliferation and terminal differentiation of osteogenic cells in tissue culture. Anat Rec 215:397–402[CrossRef][Medline]
  8. Rickard DJ, Sullivan TA, Shenker BJ, Leboy PS, Kazhdan I 1994 Induction of rapid osteoblast differentiation in rat bone marrow stromal cell cultures by dexamethasone and BMP-2. Dev Biol 161:218–228[CrossRef][Medline]
  9. Leboy PS, Beresford JN, Devlin C, Owen ME 1991 Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell cultures. J Cell Physiol 146:370–378[CrossRef][Medline]
  10. Kazhdan I, Sullivan TA, Leboy PS 1992 Rapid osteoblast differentiation in primary cultures of rat bone marrow stromal cells. J Bone Miner Res 7:S203
  11. Benayahu D, Kletter Y, Zipori D, Wientroub S 1989 Bone marrow-derived stromal cell line expressing osteoblastic phenotype in vitro and osteogenic capacity in vivo. J Cell Physiol 140:1–7[CrossRef][Medline]
  12. Cheng SL, Yang JW, Rifas L, Zhang S, Avioli LV 1994 Differentiation of human bone marrow osteogenic stromal cells in vitro: induction of the osteoblast phenotype by dexamethasone. Endocrinology 134:277–286[Abstract]
  13. Simmons DJ, Seitz P, Kidder L, Klein GL, Waeltz M, Gundberg CM, Tabuchi C, Yang C, Zhang RW 1991 Partial characterization of rat marrow stromal cells. Calcif Tissue Int 48:326–334[Medline]
  14. Kamalia N, McCulloch CAG, Tenenbaum HC, Limeback H 1992 Dexamethasone recruitment of self-renewing osteoprogenitor cells in chick bone marrow stromal cell cultures. Blood 79:320–326[Abstract/Free Full Text]
  15. Kasugai S, Todescan R, Nagata T, Yao K, Butler WT, Sodek J 1991 Expression of bone matrix proteins associated with mineralized tissue formation by adult rat bone marrow cells in vitro: inductive effects of dexamethasone on the osteoblastic phenotype. J Cell Physiol 147:111–120[CrossRef][Medline]
  16. Wozney JM 1989 Bone morphogenetic proteins. Prog Growth Factor Res 1:267–280[CrossRef][Medline]
  17. Wozney JM, Rosen V 1993 Bone morphogenetic proteins. In: Mundy GR, Martin TJ (eds) Handbook of Experimental Pharmacology. Physiology and Pharmacology of Bone. Springer-Verlag, Berlin, vol 107:725–748
  18. Nanes MS, Rubin J, Titus L, Hendy GN, Catherwood BD 1990 a-Interferon inhibits 1,25-dihydroxyvitamin D3 stimulated synthesis of bone gla protein in rat osteosarcoma cells by a pretranslational mechanism. Endocrinology 127:588–594[Abstract]
  19. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning. Cold Spring Harbor Laboratory Press, Plainview
  20. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith HA, Struhl K 1990 Current Protocols in Molecular Biology. Wiley, Trenton, pp 15.3.1–15.3.8
  21. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T2. Nature 227:680–685[CrossRef][Medline]
  22. Towbin H, Staehelin T, Gordon J 1995 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedures and some applications. Proc Natl Acad Sci USA 76:4350–4354
  23. Salinovich O, Monelaro RC 1986 Reversible staining and peptide mapping of proteins transferred to nitrocellulose after separation by SDS-PAGE. Anal Biochem 156:341–347[CrossRef][Medline]
  24. Reddy SV, Takahashi S, Dallas M, Williams RE, Neckers L, Roodman GD 1994 Interleukin-6 antisense deoxyoligonucleotides inhibit bone resorption by giant cells from human giant cell tumors of bone. J Bone Miner Res 9:753–757[Medline]
  25. Olson EN, Klein WH 1994 bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out. Genes Dev 8:1–8[Free Full Text]
  26. Lian JB, Stein GS, Bortell R, Owen TA 1991 Phenotype suppression: a postulated molecular mechanism for mediating the relationship of proliferation and differentiation by fos/jun interactions at AP-1 sites in steroid responsive promoter elements of tissue-specific genes. J Cell Biochem 45:9–14[CrossRef][Medline]
  27. Shalhoub V, Conlon D, Tassainari M, Quinn C, Partridge N, Stein G, Lian JB 1992 Glucocorticoids promote development of the osteoblast phenotype by selectively modulating expression of cell growth and differentiation associated genes. J Cell Biochem 50:425–440[CrossRef][Medline]
  28. Subramaniam M, Colvard D, Keeting PE, Rasmussen K, Riggs BL, Spelsberg TC 1992 Glucocorticoid regulation of alkaline phosphatase, osteocalcin, and proto-oncogenes in normal human osteoblast-like cells. J Cell Biochem 50:411–424[CrossRef][Medline]
  29. Lyons KM, Pelton RW, Hogan BLM 1989 Patterns of expression of murine Vgr-1 and BMP-2a RNA suggest that transforming growth factor-B like genes coordinately regulate aspects of embryonic development. Genes Dev 3:1657–1668[Abstract/Free Full Text]
  30. Jones CM, Simon-Chazottes D, Guenet J, Hogan BLM 1992 Isolation of Vgr-2, a novel member of the transforming growth factor-B-related gene family. Mol Endocrinol 6:1961–1968[Abstract]
  31. Jones CM, Lyons KM, Lapan PM, Wright CVE, Hogan BLM 1992 DVR-4 (bone morphogenetic protein-4) as a posterior-ventralizing factor in Xenopus mesoderm induction. Development 115:639–647[Abstract]
  32. Wall NA, Blessing M, Wright CVE, Hogan BLM 1993 Biosynthesis and in vivo localization of the decapentaplegic-Vg-related protein, DVR-6 (bone morphogenetic protein-6). J Cell Biol 120:493–502[Abstract/Free Full Text]
  33. Jones CM, Lyons KM, Hogan BLM 1991 Involvement of bone morphogenetic protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse. Development 111:531–542[Abstract]
  34. Ozkaynak E, Schnegelsberg PNJ, Jin DF, Clifford GM, Warren FD, Drier EA, Oppermann H 1992 Osteogenic protein-2: a new member of the transforming growth factor-b superfamily expressed early in embryogenesis. J Biol Chem 267:25220–25227[Abstract/Free Full Text]
  35. Vainio S, Karavanova I, Jowett A, Thesleff I 1993 Identification of BMP-4 as signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development. Cell 75:45–58[CrossRef][Medline]
  36. Vukicevic S, Latin V, Chen P, Batorsky R, Reddi AH, Sampath TK 1994 Localization of osteogenic protein-1 (bone morphogenetic protein-7) during human embryonic development: high affinity binding to basement membranes. Biochem Biophys Res Commun 198:693–700[CrossRef][Medline]
  37. Chang SC, Hoang B, Thomas JT, Vukicevic S, Luyten FP, Ryba NJP, Kozak CA, Reddi AH, Moos M 1994 Cartilage-derived morphogenetic proteins: new members of the transforming growth factor-b superfamily predominantly expressed in long bones during human embryonic development. J Biol Chem 269:28227–28234[Abstract/Free Full Text]
  38. Carey DE, Liu X 1995 Expression of bone morphogenetic protein-6 messenger RNA in bovine growth plate chondrocytes of different size. J Bone Miner Res 10:401–405[Medline]
  39. Hughes FJ, Collyer J, Stanfield M, Goodman SA 1995 The effects of bone morphogenetic protein-2, -4, and -6 on differentiation of rat osteoblast cells in vitro. Endocrinology 136:2671–2677[Abstract]
  40. Drozdoff V, Wall NA, Pledger WJ 1994 Expression and growth inhibitory effect of decapentaplegic Vg-related protein 6: evidence for a regulatory role in keratinocyte differentiation. Proc Natl Acad Sci USA 91:5528–5532[Abstract/Free Full Text]
  41. Bentley H, Hamdy FC, Hart KA, Seid JM, Williams JL, Johnstone D, Russell RGG 1982 Expression of bone morphogenetic proteins in human prostatic adenocarcinoma and benign prostatic hyperplasia. Br J Cancer 66:1159–1163
  42. Gitelman SE, Kobrin MS, Ye J, Lopez AR, Lee A, Derynck R 1994 Recombinant Vgr-1/BMP-6 expressing tumors induce fibrosis and endochondral bone formation in vivo. J Cell Biol 126:1595–1609[Abstract/Free Full Text]
  43. Harris SE, Harris MA, Feng JQ, Sabatini M, Wozney J, Rosen V, Moutastsos I, Bonewald L, Mundy GR 1992 Expression of bone morphogenetic proteins (BMPs) during differentiation of fetal rat calvarial osteoblasts in vitro. J Bone Miner Res 7:S120
  44. Gitelman SE, Kirk M, Ye J, Filvaroff EH, Kahn AJ, Derynck R 1995 Vgr-1/BMP-6 induces osteoblastic differentiation of pluripotential mesenchymal cells. Cell Growth Differ 6:827–836[Abstract]
  45. Gazit D, Ebner R, Kahn AJ, Derynck R 1993 Modulation of expression and cell surface binding of members of the transforming growth factor-ß superfamily during retinoic acid induced osteoblastic differentiation of multipotential mesenchymal cells. Mol Endocrinol 7:189–198[Abstract]



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
R. Garimella, S. E. Tague, J. Zhang, F. Belibi, N. Nahar, B. H. Sun, K. Insogna, J. Wang, and H. C. Anderson
Expression and Synthesis of Bone Morphogenetic Proteins by Osteoclasts: A Possible Path to Anabolic Bone Remodeling
J. Histochem. Cytochem., June 1, 2008; 56(6): 569 - 577.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
R. Donn, A. Berry, A. Stevens, S. Farrow, J. Betts, R. Stevens, C. Clayton, J. Wang, L. Warnock, J. Worthington, et al.
Use of gene expression profiling to identify a novel glucocorticoid sensitivity determining gene, BMPRII
FASEB J, February 1, 2007; 21(2): 402 - 414.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Derfoul, G. L. Perkins, D. J. Hall, and R. S. Tuan
Glucocorticoids Promote Chondrogenic Differentiation of Adult Human Mesenchymal Stem Cells by Enhancing Expression of Cartilage Extracellular Matrix Genes
Stem Cells, June 1, 2006; 24(6): 1487 - 1495.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Deregowski, E. Gazzerro, L. Priest, S. Rydziel, and E. Canalis
Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/beta-Catenin but Not Bone Morphogenetic Protein Signaling
J. Biol. Chem., March 10, 2006; 281(10): 6203 - 6210.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang
Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass
Endocrinology, May 1, 2005; 146(5): 2415 - 2423.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Li, E. M. Schwarz, M. J. Zuscik, R. N. Rosier, A. M. Ionescu, J. E. Puzas, H. Drissi, T.-J. Sheu, and R. J. O'Keefe
Retinoic Acid Stimulates Chondrocyte Differentiation and Enhances Bone Morphogenetic Protein Effects through Induction of Smad1 and Smad5
Endocrinology, June 1, 2003; 144(6): 2514 - 2523.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev., April 1, 2003; 24(2): 218 - 235.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. C. Pereira, A. N. Economides, and E. Canalis
Bone Morphogenetic Proteins Induce Gremlin, a Protein That Limits Their Activity in Osteoblasts
Endocrinology, December 1, 2000; 141(12): 4558 - 4563.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Gilbert, X. He, P. Farmer, S. Boden, M. Kozlowski, J. Rubin, and M. S. Nanes
Inhibition of Osteoblast Differentiation by Tumor Necrosis Factor-{alpha}
Endocrinology, November 1, 2000; 141(11): 3956 - 3964.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. C. Pereira, D. Durant, and E. Canalis
Transcriptional regulation of connective tissue growth factor by cortisol in osteoblasts
Am J Physiol Endocrinol Metab, September 1, 2000; 279(3): E570 - E576.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Yamaguchi, T. Komori, and T. Suda
Regulation of Osteoblast Differentiation Mediated by Bone Morphogenetic Proteins, Hedgehogs, and Cbfa1
Endocr. Rev., August 1, 2000; 21(4): 393 - 411.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. O. Abu, A. Horner, V. Kusec, J. T. Triffitt, and J. E. Compston
The Localization of the Functional Glucocorticoid Receptor {alpha} in Human Bone
J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 883 - 889.
[Abstract] [Full Text]


Home page
J Am Acad Orthop SurgHome page
D. A. Zlotolow, A. R. Vaccaro, M. L. Salamon, and T. J. Albert
The Role of Human Bone Morphogenetic Proteins in Spinal Fusion
J. Am. Acad. Ortho. Surg., January 1, 2000; 8(1): 3 - 9.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Binkert, M. Demetriou, B. Sukhu, M. Szweras, H. C. Tenenbaum, and J. W. Dennis
Regulation of Osteogene