| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Articles |
and ß
Center for Biotechnology and Department of Medical Nutrition, Karolinska Institute (G.G.J.M.K., K.G., E.E., J.-Å.G.); and KaroBio AB (B.C., J.H., S.N.) Huddinge, Sweden
Address all correspondence and requests for reprints to: George Kuiper, Center for Biotechnology, Karolinska Institute, NOVUM, S-14186 Huddinge, Sweden. E-mail: george.kuiper{at}cbt.ki.se
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß,
which differ in the C-terminal ligand binding domain and in the
N-terminal transactivation domain. In this study we investigated the
messenger RNA expression of both ER subtypes in rat tissues by RT-PCR
and compared the ligand binding specificity of the ER subtypes.
Saturation ligand binding analysis of in vitro
synthesized human ER and rat ERß protein revealed a single binding
component for 16-iodo-17ß-estradiol with high affinity
[dissociation constant (Kd) = 0.1 nM for ER
protein and 0.4 nM for ERß protein]. Most estrogenic
substances or estrogenic antagonists compete with
16-[125I]iodo-17ß-estradiol for binding to both ER
subtypes in a very similar preference and degree; that is,
diethylstilbestrol > hexestrol > dienestrol >
4-OH-tamoxifen > 17ß-estradiol > coumestrol,
ICI-164384 > estrone, 17-estradiol > nafoxidine,
moxestrol > clomifene > estriol, 4-OH-estradiol >
tamoxifen, 2-OH-estradiol, 5-androstene-3ß,17ß-diol, genistein for
the ER protein and dienestrol > 4-OH-tamoxifen >
diethylstilbestrol > hexestrol > coumestrol,
ICI-164384 > 17ß-estradiol > estrone,
genistein > estriol > nafoxidine,
5-androstene-3ß,17ß-diol > 17-estradiol, clomifene,
2-OH-estradiol > 4-OH-estradiol, tamoxifen, moxestrol for the
ERß protein. The rat tissue distribution and/or the relative level of
ER and ERß expression seems to be quite different,
i.e. moderate to high expression in uterus, testis,
pituitary, ovary, kidney, epididymis, and adrenal for ER and
prostate, ovary, lung, bladder, brain, uterus, and testis for ERß.
The described differences between the ER subtypes in relative ligand
binding affinity and tissue distribution could contribute to the
selective action of ER agonists and antagonists in different tissues.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subtype). The rat ERß
cDNA encodes a protein of 485 amino acid residues with a calculated mol
wt of 54200. Rat ERß protein is highly homologous to rat ER
protein, particularly in the DNA binding domain (> 90% amino acid
identity) and in the C-terminal ligand binding domain (LBD) (55%).
Saturation ligand binding experiments with in vitro
synthesized ERß protein revealed a single binding component for
17ß-estradiol (E2) with high affinity [dissociation
constant (Kd) = 0.6 nM]. Expression of ERß
was investigated by in situ hybridization, and prominent
expression was found in rat prostate (secretory epithelial cells)
and ovary (granulosa cells). In cotransfection experiments of Chinese
hamster ovary (CHO) cells with an ERß expression vector and an
estrogen-regulated reporter gene, maximal stimulation of reporter gene
activity was found during incubation with 1 nM
E2 (4). The biological significance of the existence of two ER subtypes is at this moment unclear. Perhaps the existence of two ER subtypes provides, at least in part, an explanation for the selective actions of estrogens in different target tissues (5). In fact, the high degree of interspecies conservation of the individual ER subtypes throughout vertebrate evolution (Ref. 6 and our unpublished observations) could suggest that the basis for the selective effects of estrogens resides in the control of different subsets of estrogen-responsive promoters by the two ER subtypes. This would implicate differential expression of the ER subtypes in target tissues.
The overall homology between the rat ER protein LBD and rat ERß
protein LBD is not more than 55% (Fig. 1
).
Interestingly, the ERß protein LBD encompassing amino acid residues
223–457 has a low homolgy with the ER protein LBD between amino
acid residues 344–403, whereas outside this stretch the homology is
considerably higher (amino acid residues 223–343 and 404–457). The
structural core of the LBD of the human ER protein has recently been
mapped by restricted proteolysis, and only one single region within
this core was found to be easily accessible to proteases (7). This
surface-exposed protease accessible region (human ER LBD amino acid
residues 465–468) is in the center of the stretch showing lowest
homology with ERß protein. The amino acid sequence stretches of the
ERß LBD between amino acids 223–343 and 404–457 are probably,
similarly to the highly homologous stretches in the ER LBD, part of
a compact hydrophobic (non-surface-exposed) entity directly contacting
the ligand. Although several parts of these stretches are completely
conserved, and the amino acid alterations often are conservative, it is
possible that interesting differences in ligand binding affinity and/or
specificity exist between the ER subtypes. Chemically quite diverse
compounds (estrogens, some androgens, phytoestrogens, antiestrogens,
and environmental estrogens) have been shown in the past to have
estrogenizing activity and to interact with the ER from rat uterus and
human breast tumor cells (Ref. 8 and references therein).
|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-[125I]iodo-E2
([125I]E2) was obtained from New England
Nuclear (Boston, MA). The unlabeled steroids E2,
17-estradiol, estrone, estriol, dehydroepiandrosterone,
5-dihydrotestosterone, testosterone, progesterone,
corticosterone, moxestrol
(11ß-methoxy-17-ethynyl-1,3,5(10)-estratrien-3,17ß-diol),
4-hydroxy-estradiol (1,3,5(10)-estratriene-3,4,17ß-triol),
2-hydroxy-estradiol (1,3,5(10)-estratriene-2,3,17ß-triol),
5-androstenediol (5-androstene-3ß,17ß-diol), 4-andro-stenediol
(4-androstene-3ß,17ß-diol), 3-androstanediol
(5-andro-stane-3,17ß-diol), 3ß-androstanediol
(5-androstane-3ß,17ß-diol), 5-androstanedione
(5-androstane-3,17-dione), 5ß-androstanedione
(5ß-androstane-3,17-dione), 4-androstenedione
(4-androstene-3,17-dione), norethynodrel
(17-ethynyl-17-hydroxy-5(10)-estren-3-one), noreth-indrone
(19nor-4-androsten-17-ethynyl-17ß-ol-3-one), 19-nortestosterone
(4-estren-17ß-ol-3-one), ß-sitosterol
(24ß-ethyl-5-cholesten-3ß-ol), and estrone-3-sulfate
(3-hydroxy-1,3,5(10)estratrien-17-one-3-sulfate) were obtained from
Steraloids Inc. (Wilton, NH) except for dehydroepiandrosterone and
moxestrol (RU 2858), which were obtained from Ikapharm (Ramat-Gan,
Israel) and from Roussel Uclaf (Romainville, France), respectively. The phytoestrogen coumestrol (2-(2,4-dihydroxyphenyl)-6-hydroxy-3-benzofurancarboxylic acid lactone) was obtained from Eastman Kodak (Rochester, NY) and genistein (4,5,7-trihydroxyisoflavone) and ß-zearalanol (2,4-dihydroxy-6-[6ß,10-dihydroxyundecyl]benzoic acid µ-lactone) were from Sigma (St. Louis, MO).
The synthetic estrogens diethylstilbestrol (4,4'-(1,2-diethyl-1,
2-ethene-diyl)bisphenol), hexestrol
(4,4'-(1,2-diethyl-1,2-ethane-diyl)bisphenol), and dienestrol
(4,4'-(1,2-diethylidene-1,2-ethane-diyl)bisphenol) were obtained from
Sigma. The antiestrogens tamoxifen
(1-p-ß-dimethylamino-ethoxyphenyl-trans-1,2-diphenylbut-1-ene),
4-OH-tamoxifen
(1-(p-dimethylaminoethoxyphenyl)1-(4-hydroxyphenyl)-2-phenyl-but-1-ene),
clomiphene
(1-(p-(ß-diethylaminoethoxy)phenyl)-1,2-diphenylchloro-ethylene),
nafoxidine
1-(2-[p-(3,4-dihydro-6-methoxy-2-phenyl-1-naphtyl)-phenoxy]-ethyl)pyrrolidine
hydrochloride, and ICI-164384
(N-n-butyl-11-(3,17ß-dihydroxyestra-1,3,5(10)trien-7-yl)-N-methylundecanamide)
were obtained from Sigma or synthesized by KaroBio AB (ICI-164384)
(Huddinge, Sweden). The environmental estrogens Bisphenol A
(2,2-bis(4-hydroxyphenyl)propane) and methoxychlor
(1,1,1-trichloro-2,2-bis(p-methoxy-phenyl)ethane) were
obtained from Aldrich (Germany). The structural formulas and chemical
properties of all the competitors used can be found in the Merck Index
or elsewhere (8, 9, 10).
Sephadex G25 columns (QS-2A) were obtained from Isolab (Akron, OH). All other chemicals were of the highest purity available.
In vitro transcription and translation
The 2.6 kbp rat ERß cDNA (4) was subcloned into the
EcoRI site of pBluescript (Stratagene, La Jolla, CA). The
plasmid pT7ßhER (11) containing the wild type (HEGO) human ER
sequence was a kind gift from Dr. B.W. O’Malley and co-workers (Baylor
College of Medicine, Houston, TX). Human ER and rat ERß protein
was synthesized in vitro using the TnT-coupled reticulocyte
lysate system (Promega, Madison, WI) with T7-RNA polymerase, during a
90 min reaction at 30 C. Translation reaction mixtures (50-µl
portions) were snap-frozen and stored at -70 C until further use.
Saturation ligand binding analysis
Translation reaction mixtures were diluted in buffer A (20
mM HEPES, pH = 7.9; 150 mM NaCl, 10%
wt/vol glycerol, 1 mM EDTA, 6 mM
monothioglycerol, and 10 mM Na2
MoO4) and kept at 4 C. Aliquots equivalent to
0.25 µl ER translation mixture or 2 µl ERß translation mixture
were incubated in duplo with 10–800 pM
[125I]-E2 in the presence or absence of a
300-fold excess of diethylstilbestrol for 16 h at 4 C. The final
incubation volume was 200 µl, and to the ER incubation series
unprogrammed reticulocyte lysate was added to equalize the total
protein concentrations. Free and unbound radioligand was separated by
gelfiltration over G-25 columns at 4 C as described (12). Bound
radioactivity was measured in a Wallac 
-counter (Turku, Finland)
with 70% efficiency. Specific binding was determined by subtracting
nonspecific binding from total binding, and the free ligand
concentration was estimated by subtracting total bound ligand from
added ligand. The equilibrium Kd was calculated as the free
concentration of radioligand at half-maximal binding by fitting data to
the Hill equation (13) and by linear Scatchard transformation
(14). Curve fitting was done in KaleidaGraph 2.1.3 (Abelbeck
Software, PA).
Ligand competition experiments
Competitors were dissolved in dimethylsulfoxide at a
concentration of 1 mM, except for coumestrol, genistein,
and ß-zearalanol, which were dissolved in ethanol. Translation
reaction mixtures were diluted with buffer A and kept at 4 C. Aliquots
equivalent to 0.25 µl ER translation mixture or 2 µl ERß
translation mixture were added to dilutions containing
[125I]-E2 and the respective competitors. The
final concentration of radioligand was 125–150 pM, and the
incubation time was 16 h at 4 C. Unprogrammed reticulocyte lysate
was added to the ER series to equalize protein concentrations.
Competitors were present at concentrations between 10-4
M and 10-10 M; each competition
curve consisting of eight concentrations in duplicates. Free and bound
ligand were separated by gelfiltration over Sephadex G-25 columns as
described (12). The data were evaluated by a nonlinear four-parameter
logistic model (15) to estimate the IC50 value (the
concentration of competitor at half-maximal specific binding). Relative
binding affinity (RBA) of each competitor was calculated as the ratio
of concentrations of E2 and competitor required to reduce
the specific radioligand binding by 50% (= ratio of IC50
values). The RBA value for E2 was arbitrarily set at 100.
The Cheng-Prusoff equation (13, 14) was used to calculate the
Ki of the various competitors.
PCR analysis of rat tissue total RNA
Male and female rats (6–8 weeks old) were killed by cervical
dislocation, and tissues were collected. Tissue samples were
immediately processed for total RNA isolation according to the acid
guanidinium thiocyanate-phenol-chloroform single-step extraction
protocol (16). The integrity and quality of the purified RNA was
controlled by formaldehyde denaturing agarose gel electrophoresis and
by measurement of the A260/A280 nm ratio. Only RNA samples exhibiting
an A260/A280 ratio >1.6 and showing integrity of the RNA by
electrophoresis were used in further experiments. The RNA isolated from
spleen and brain cortex appeared degraded and was discarded.
Random hexamer-primer cDNA synthesis was performed as described (17, 18). For the PCR amplification, 5% of the synthesized cDNA was added
to a PCR reaction mixture as described (17) and amplified for 30 cycles
by incubation at 95 C for 30 sec, 57 C for 15 sec, 72 C for 60 sec, and
a final incubation at 72 C for 3 min, all in a PCR 9600 thermocycler
(Perkin-Elmer, Norwalk, CT). The oligonucleotides erbkg1:
5'TTCCCGGCAGCACCAGTAACC (+38 relative to ATG) and erbkg2:
5'TCCCTCTTTGCGTTTGGACTA (+279 relative to ATG) were used for
amplification of a 262-bp fragment of the ERß messenger RNA (mRNA).
The oligonucleotides kgb5: 5'AATTCTGACAATCGACGCCAG (+472 relative to
ATG) and kgb6: 5'GTGCTTCAACATTCTCCCTCCTC (+794 relative to ATG) were
used for amplification of a 344-bp fragment of the rat ER mRNA. The
oligonucleotides used for the amplification of actin mRNA are
previously described (17). After agarose gel electrophoresis and
blotting to nitrocellulose filters, the PCR products were hybridized to
the internal oligonucleotides: ERUR 4: 5'GGGACTCTTTTGAGGTTCTGC
(+163-182 relative to ATG) for ERß, KG50: 5'GCAGCGAGAAGGGAAACATGA
(+518-538 relative to ATG) for ER, and actin primer:
5'GATGACCCAGATCATGTTTGA (+434-454 relative ATG) for actin according to
a previously described protocol (17).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and rat ERß
protein synthesized in reticulocyte lysates for the ligand binding
experiments.
To obtain optimal conditions for the determination of equilibrium
Kds and RBAs of various ligands, the ER concentration in
the binding assay was lowered to 10–20 pM. At these low ER
concentrations radioligand and/or competitor depletion can be excluded
while maintaining high receptor recovery during separation of bound and
unbound ligand by the use of a gel filtration assay instead of the
traditional charcoal adsorption assay (12). The low ER concentration
made it necessary to employ radioiodinated estradiol as a probe,
because the specific radioactivity of tritiated estradiol was too low
to maintain sufficient accuracy. Radioiodinated E2
(16-[125I]iodo-E2) binds to the ER with
high affinity and specificity as shown by its use in dry-mount
autoradiographic techniques and various ligand binding assays (19, 20).
In Fig. 2 the result of a saturation ligand binding
assay with [125I]-E2 is shown. Single point
assays (not shown) were used to equalize the amount of ER and ERß
protein used (10–15 pM). The nonspecific binding was 
8%
of total binding over the whole radioligand concentration range used.
The Kd values calculated from the saturation curves (Fig. 2) were 0.06 nM for ER protein and 0.24 nM
for ERß protein. Linear transformation of saturation data (Scatchard
plots in Fig. 2) revealed a single population of binding sites for
16-iodo-E2 with a Kd of 0.1 nM
for the ER protein and 0.4 nM for the ERß protein. The
measured Kd values are in agreement with the finding that
almost maximal stimulation of reporter gene activity by ER and ERß
protein was previously found during incubation with 1 nM
E2 (4). Although the ERß protein has a four times lower
affinity for 16-iodo-E2 in this system compared with the
ER protein, both Kd values are within the range (0.1–1
nM) generally reported for estradiol binding to ERs in
various systems (1).
|
and ERß protein and ERß protein
concentrations of 10–15 pM and a
[125I]-E2 concentration of about 150
pM, so that for both ERs the total receptor concentration
was 0.1 Kd and the radioligand concentration was 
10
times the ER concentration. Under such experimental conditions
radioligand or competitor depletion can be excluded (14).
In total 37 substances were tested for both ER subtypes (Fig. 3 and Table 1). In Fig. 3 several
examples of typical competitor curves obtained are shown. In all cases
monophasic curves were obtained for compounds with significant
affinity. The slopes of the curves were almost similar, enabling the
use of IC50 values to calculate RBA values (Table 1), with
an RBA value of 100 for E2 for each receptor. For the ER
as well as ERß protein, the estradiol binding was stereospecific
because 17-estradiol showed a two times and 10 times lower affinity,
respectively (Table 1), compared with E2, which is in
agreement with previous findings on stereospecific binding of estradiol
by the ER (21). However, in making such comparisons, it should be kept
in mind that most, if not all, ER ligand binding studies done in the
past 30 yr actually involved mixtures of ER and ERß protein. This
is certainly the case for many studies in which rat uterus cytosol was
used (see following). The present study is the first in which the
ligand binding properties of both ER subtypes are measured separately,
and caution is needed when comparing RBAs from this study with the
previous studies involving mixtures of ER subtypes.
|
|
-estradiol (ER) > estriol >
catecholestrogens, 17-estradiol (ERß) > estrone-3-sulfate.
Overall the ER and ERß proteins show the binding characteristics
and relative affinity for the physiological estrogens found to be
characteristic for an ER protein (1, 8, 22). The stilbene estrogens,
which consist of a composite diphenolic ring structure, bind with high
affinity to both ER subtypes. However, different orders of competition
were found: diethylstilbestrol > hexestrol >
dienestrol > (E2) for ER and dienestrol >
diethylstilbestrol > hexestrol > (E2) for
ERß.
The extra methoxy group at C11 and the ethynyl group at C17 of
moxestrol (RU 2858) lowered the affinity compared with E2
for the ER protein by only a factor of 2 but for the ERß protein
by a factor of 20. Moxestrol is in use as a radioligand in ER assays,
and is known to have a lower binding affinity than E2 under
certain assay conditions (23).
The triphenylethylene (anti)estrogens were developed by successive
chemical modifications of the triphenylethylene nucleus, formed by the
addition of an extra phenyl ring to the stilbene nucleus as present in
for instance diethylstilbestrol (9, 10). Interestingly, the measured
order of affinity for the tested triphenylethylene (anti)estrogens was
the same for both ER subtypes: 4OH-tamoxifen >> nafoxidine >
clomifene > tamoxifen. The steroidal antiestrogen ICI 164384 had
a high affinity for ER as well as for ERß, confirming that
extensions at C7 do not preclude ligand-ER interactions (9, 24).
It has been known for a long time that a number of compounds classified
as androgens (C19 steroids) can evoke estrogen-like effects in the
female genital tract and in the mammary glands (25). Of all the
androgens tested only those with a hydroxyl group at C3 and C17 had
significant affinity for both ER subtypes (Table 1
). The relative
flatness of the A-ring with respect to the B-ring is also important,
given the clear difference in affinity for both ER subtypes between
5-androstenediol and 4-androstenediol. The binding affinity of
3ß-androstanediol and 5-androstenediol for both ER subtypes is in
agreement with previous studies showing specific binding to the rat
uterus ER and estrogenic responses in rat uterus and mammary tumors for
both steroids (26, 27).
Norethynodrel and norethindrone, progestins derived from
19-nor-testosterone, and 19-nor-testosterone itself have an intrinsic
estrogenic potential as shown by the induction of alkaline phosphatase
activity in ER-positive human endometrial cancer Ishikawa cells (28).
The apparent binding affinity of norethynodrel and norethindrone for
both ER subtypes was however, only about 1/500th of that for
E2 (Table 1), and the need for a conversion into more
active metabolites by aromatization or hydroxylation at C-3 has been
suggested (28).
Several plant-derived nonsteroidal compounds such as genistein and
coumestrol have estrogenic activity (8). These compounds increase rat
uterine weight and stimulate growth of breast tumor cells and compete
with E2 for binding to ER protein as well as stimulate the
activity of reporter genes in the presence of ER protein (Ref. 29 and
references therein). Both coumestrol and genistein had a significantly
higher affinity for ERß protein (Table 1), which is interesting in
the light of the high expression of ERß mRNA in the secretory
epithelial cells of the prostate, and the prostate cancer protective
properties that have been associated with these compounds (30).
Zearalanols are fungal metabolites or derivatives thereof that have
been associated with estrogenizing syndromes in cattle fed with
mold-infected grain (8). Despite the fact that zearalanols are
structurally very different to known steroidal and nonsteroidal
estrogens, they interact with the rat uterus cytosolic ER (31). Also,
in our competition assays ß-zearalanol interacted with both ER
subtypes with a similar affinity (Table 1), as was reported previously
for the rat uterus ER protein (31).
Abnormal sexual development in reptiles as well as the increasing
incidence of certain human reproductive tract abnormalities (such as
hypospadias) has been associated with increased exposure to and body
burdens of so-called estrogenic environmental chemicals (32, 33). These
effects from estrogenic chemicals as, for instance, the pesticide
methoxychlor and the plastics ingredient bisphenol A, are postulated to
be mediated via the ER because these compounds have estrogenic effects
(increase of uterine weight) in female rats (8, 32, 33). Bisphenol A
and methoxychlor both inhibited the binding of
[125I]-E2 by the ER and ERß protein, and
the inhibition seemed to be stronger for the ERß protein (Table 1).
However, it was clearly a very low affinity interaction, and the fact
cannot be excluded that it involved different sites on the ER than
those involved in the binding of E2.
Expression of ER and ERß mRNA in rat tissues
To determine the relative distribution of ER and ERß mRNA,
total RNA was isolated from rat tissues and used for RT-PCR using
primers specific for each ER subtype. All tissues were taken from 6- to
8-week-old male rats, except uterus and ovary, which were taken from
8-week-old female rats. Although this assay was only semiquantitative,
it is clear that the relative distribution of both ER subtypes was
quite different (Fig. 4). Highest expression of ERß
mRNA was found in the ovary and prostate, which is in agreement with
our previous in situ hybridization experiments using male
and female rats of similar ages (4). In addition, testis, uterus,
bladder, and lung showed moderate expression, whereas pituitary,
epididymis, thymus, various brain sections, and spinal cord reveal low
expression of ERß mRNA. The ER mRNA was highly expressed in
epididymis, testis, pituitary, uterus, kidney, and adrenal, which all
showed moderate or no expression of ERß mRNA. Aside from weak
expression in thalamus/hypothalamus, the brain sections tested were
negative for ER mRNA. Ovary and uterus, which are known to contain
high amounts of ER protein (1), clearly expressed both ER subtypes. All
organs from male rats previously described to display specific binding
of [3H]-E2 to an 8S cytosolic protein,
i.e. liver, lung, adrenal, pituitary, prostate,
epididymis, and testis, showed clear expression of either ER subtype
mRNA or both (34, 35).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß protein is overall
quite similar for the physiological ligands, certainly when only the
order of competition is compared. The most interesting difference was
found for 17-estradiol, which has a five times higher affinity for
ER protein. The physiological action of 17-estradiol is quite
different from that of E2, because 17-estradiol is a
short-acting estrogen and actually a time-dependent mixed
agonist-antagonist in the rat/mouse uterus (1). Short-acting estrogens
(estrone, estriol, and 17-estradiol) do cause nuclear binding of the
hormone-receptor complex but only for a short period of time (1). It
would be interesting to see whether the difference found for
17-estradiol in our ligand binding assays is also present in a
transactivation assay system. For the other types of ligands tested,
i.e. antiestrogens, androgenic steroids, and
phyto-estrogens, there are some interesting differences in the RBAs
(Table 1), but it remains to be seen whether these differences are also
reflected in a transactivation assay system using different cellular
backgrounds. The ERß protein clearly displays all the ligand binding
characteristics of a classical ER protein (1, 8, 9, 10, 21, 22, 26, 27, 28, 29, 31, 36), and therefore it seems unlikely that a unique physiological
ligand for the ERß protein exists. The relative order of ligand
binding for various estrogens (diethylstilbestrol, estrone, and
estriol) is slightly different in this study than in our previous study
(4). Our previous rather preliminary assay (4) was hampered by
relatively high levels of nonspecific radioligand binding (30–40%
compared with about 5% in this report), which might explain the
difference.
A question of considerable interest is why, despite the numerous ligand
binding assays performed for the ER protein, an indication for the
existence of two ER subtypes was never published. Of course,
distinguishing between a mixed population of receptor subtypes and a
homogeneous receptor population by saturation or
homologous/heterologous competition assays is generally difficult. This
is only possible with certainty when the two subtypes differ
sufficiently in affinity (10- to 100-fold), and the range of ligand
concentrations examined is wide. Furthermore, the proportions of the
two subtypes must be appropriate (37). Of all the radioligands used in
ER assays (E2, DES, hexestrol, moxestrol,
16-iodo-estradiol), the difference in affinity for moxestrol between
both ER subtypes is the greatest (8-fold) in our experiments. In this
regard, it should be realized that to detect the existence of receptor
subtypes the higher affinity subtype should be less abundant than the
lower affinity subtype (37). Most ER ligand binding assays have been
done with uterus extracts and breast tumor extracts or cell lines, and
it could be that the right conditions for the detection of receptor
subtypes are not fulfilled in these cases. We have been unable to
detect the ERß mRNA in various breast tumor cell lines (MCF-7, T47D,
ZR75-1) by RT-PCR (our unpublished observations), whereas both subtypes
are expressed in rat (Fig. 4) and human uterus (not shown).
In prostate and ovary, the two tissues that express high levels of
ERß mRNA, it has been difficult to demonstrate the presence of ERs by
immunostaining with the available ER antibodies, although specific
binding of E2 could be measured (1, 8, 34). In human and
rat prostate at best only weak staining in stromal smooth muscle cells
was found (38, 39), which is in contrast with our results showing high
expression of ERß mRNA in the prostate secretory epithelial cells
(4). In the rat and human ovary, specific binding of estradiol was
found in intact follicles and granulosa cells (40, 41), but no ER could
be detected with available ER antibodies (41). These discrepancies
could be explained by the fact that the most frequently used ER protein
antibodies, H-222 and H-226 (42), do not cross-react with rat ERß
protein on immunoblots (our unpublished observations). The above
findings and our results could indicate that the ERß protein is the
predominant if not the only ER subtype present in rat prostate and
ovary. Of course this remains to be proven when specific ERß protein
antibodies become available. The fact that disruption of the ER gene
in vivo did not eliminate the ability of small follicles to
grow, as is evident from the presence of secondary follicles and antral
follicles in the ER knockout mouse (43), also argues for the
presence of alternative ER (ERß?) molecules. In fact, rat uterus,
ovary, testis, epididymis, and pituitary clearly express both ER
subtypes mRNAs. Although we have no data on ERß mRNA expression or
protein concentration in tissues of the ER knock-out mouse (43), the
possible presence of ERß protein should be kept in mind when
interpreting experiments using the ER knock-out mouse. Furthermore,
in the uterus of the ER knock-out mouse, residual E2
binding could be measured (43), which is likely caused by the presence
of ERß protein. In the brain of the ER knock-out mouse, specific
binding of E2 and modulation of progesterone receptor gene
expression by E2 was observed (44). Again this is most
likely caused by the presence of ERß protein, because the ERß mRNA
is broadly expressed in the rat brain and probably also in the mouse
brain at a low level. Detailed mapping of ER and ERß expression in
rat/mouse brain by in situ hybridization or using specific
antibodies for each subtype is of clear interest given the fact that
for the localization of ERs in the brain of various species antibodies
that do not recognize ERß have been used (45).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Supported by grants from the Swedish Cancer Society and from the
European Union (EU-PL95-1223) Climate and Environment Program.
Received September 27, 1996.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-[125I]iodo-estradiol with estrogen receptor and
other steroid-binding proteins. Proc Natl Acad Sci USA 77:328–332This article has been cited by other articles:
 |
|
 |
|
  Y. Ikeda, H. Tanaka, and M. Esaki Effects of Gestational Diethylstilbestrol Treatment on Male and Female Gonads during Early Embryonic Development Endocrinology, August 1, 2008; 149(8): 3970 - 3979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Raju and I. H. Chaudry Sex Steroids/Receptor Antagonist: Their Use as Adjuncts After Trauma-Hemorrhage for Improving Immune/Cardiovascular Responses and for Decreasing Mortality from Subsequent Sepsis Anesth. Analg., July 1, 2008; 107(1): 159 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-Y. Deng, P.-S. Hsieh, J.-P. Huang, L.-S. Lu, and L.-M. Hung Activation of Estrogen Receptor Is Crucial for Resveratrol-Stimulating Muscular Glucose Uptake via Both Insulin-Dependent and -Independent Pathways Diabetes, July 1, 2008; 57(7): 1814 - 1823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. de Cremoux, D. Rosenberg, J. Goussard, C. Bremont-Weil, F. Tissier, C. Tran-Perennou, L. Groussin, X. Bertagna, J. Bertherat, and M.-L. Raffin-Sanson Expression of progesterone and estradiol receptors in normal adrenal cortex, adrenocortical tumors, and primary pigmented nodular adrenocortical disease Endocr. Relat. Cancer, June 1, 2008; 15(2): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Hammoud, B. Tan, S. Badve, and R. M Bigsby Estrogen promotes tumor progression in a genetically defined mouse model of lung adenocarcinoma Endocr. Relat. Cancer, June 1, 2008; 15(2): 475 - 483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Wahlgren, K. Svechnikov, M.-L. Strand, K. Jahnukainen, M. Parvinen, J.-A. Gustafsson, and O. Soder Estrogen Receptor {beta} Selective Ligand 5{alpha}-Androstane-3{beta}, 17{beta}-Diol Stimulates Spermatogonial Deoxyribonucleic Acid Synthesis in Rat Seminiferous Epithelium in Vitro Endocrinology, June 1, 2008; 149(6): 2917 - 2922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. K. Nayak, H. J. Hathaway, C. Ramesh, J. B. Arterburn, D. Dai, L. A. Sklar, J. P. Norenberg, and E. R. Prossnitz Preclinical Development of a Neutral, Estrogen Receptor-Targeted, Tridentate 99mTc(I)-Estradiol-Pyridin-2-yl Hydrazine Derivative for Imaging of Breast and Endometrial Cancers J. Nucl. Med., June 1, 2008; 49(6): 978 - 986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Asai, T. Tokunaga, K. Kondo, T. Kawaguchi, S. Takayanagi, T. Shinmyozu, M. Nakai, Y. Yakabe, and Y. Shimohigashi Direct Measure of Fluorescence Intensity for Efficient Receptor-binding Assay: Conjugates of Ethinylcarboxyestradiol and 5(and 6)-Carboxyfluorescein via {alpha},{omega}-Diaminoalkanes as a Tracer for Estrogen Receptor J. Biochem., June 1, 2008; 143(6): 781 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Rasbach and R. G. Schnellmann Isoflavones Promote Mitochondrial Biogenesis J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 536 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Grossini, C. Molinari, D. A. S. G. Mary, F. Uberti, P. P. Caimmi, N. Surico, and G. Vacca Intracoronary Genistein Acutely Increases Coronary Blood Flow in Anesthetized Pigs through {beta}-Adrenergic Mediated Nitric Oxide Release and Estrogenic Receptors Endocrinology, May 1, 2008; 149(5): 2678 - 2687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Cederroth, M. Vinciguerra, A. Gjinovci, F. Kuhne, M. Klein, M. Cederroth, D. Caille, M. Suter, D. Neumann, R. W. James, et al. Dietary Phytoestrogens Activate AMP-Activated Protein Kinase With Improvement in Lipid and Glucose Metabolism Diabetes, May 1, 2008; 57(5): 1176 - 1185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Dip, S. Lenz, J.-P. Antignac, B. Le Bizec, H. Gmuender, and H. Naegeli Global gene expression profiles induced by phytoestrogens in human breast cancer cells Endocr. Relat. Cancer, March 1, 2008; 15(1): 161 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Mattingly, M. M. Ivanova, K. A. Riggs, N. S. Wickramasinghe, M. J. Barch, and C. M. Klinge Estradiol Stimulates Transcription of Nuclear Respiratory Factor-1 and Increases Mitochondrial Biogenesis Mol. Endocrinol., March 1, 2008; 22(3): 609 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Sperry and J. P. Minei Gender dimorphism following injury: making the connection from bench to bedside J. Leukoc. Biol., March 1, 2008; 83(3): 499 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.A. Walters, C.M. Allan, and D.J. Handelsman Androgen Actions and the Ovary Biol Reprod, March 1, 2008; 78(3): 380 - 389. [Abstract] [Full Text] [PDF]
|
; ERß = •) were calculated by subtracting
nonspecific bound counts from total bound counts. Inset,
Scatchard analysis of specific binding giving a Kd of 0.1
nM for ER
